ID: 1192303893

View in Genome Browser
Species Human (GRCh38)
Location X:69937629-69937651
Sequence TTTAAAAAACATGATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1014
Summary {0: 1, 1: 5, 2: 11, 3: 86, 4: 911}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192303893_1192303897 17 Left 1192303893 X:69937629-69937651 CCTTCCTCATCATGTTTTTTAAA 0: 1
1: 5
2: 11
3: 86
4: 911
Right 1192303897 X:69937669-69937691 TTAGTAGCTCTATAGAGTTCTGG 0: 1
1: 2
2: 0
3: 8
4: 70
1192303893_1192303898 18 Left 1192303893 X:69937629-69937651 CCTTCCTCATCATGTTTTTTAAA 0: 1
1: 5
2: 11
3: 86
4: 911
Right 1192303898 X:69937670-69937692 TAGTAGCTCTATAGAGTTCTGGG 0: 1
1: 2
2: 0
3: 7
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192303893 Original CRISPR TTTAAAAAACATGATGAGGA AGG (reversed) Intronic
900278887 1:1852524-1852546 TTTAAAAAATATTTTGAGGCCGG - Intronic
900848130 1:5120204-5120226 TTTAAAAAACAAAATGAGCAGGG + Intergenic
901108254 1:6774717-6774739 CTTAAAAATTATGATGAGGTAGG + Intergenic
901123460 1:6913112-6913134 GTTTACAAACATGAAGAGGAAGG - Intronic
901677466 1:10894464-10894486 TTGAAAAAACACCATGAGGCCGG - Intergenic
902034213 1:13444872-13444894 TTTATAAAACATGATGACTTTGG - Intergenic
902680274 1:18038849-18038871 TTGATAAAACATGGTGATGAAGG + Intergenic
903051232 1:20602714-20602736 ATAAAAACACATGATGAGGCTGG - Intronic
904274910 1:29375515-29375537 TTCAAAAAATTTGAAGAGGAGGG - Intergenic
904545013 1:31262721-31262743 ATTAAAAAAAATTATGAGGCTGG + Intronic
904669414 1:32152037-32152059 TTTGAACAACATGATGGGCATGG + Intronic
906023159 1:42649151-42649173 TTCAAAAAAAATAAAGAGGAGGG + Intronic
906520609 1:46464862-46464884 TTTAAAATACATGCTGAGAGTGG + Intergenic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
907591688 1:55679580-55679602 TTTAAAAAAAAAGAAGAGCAGGG - Intergenic
907680191 1:56555857-56555879 TTTAAATAACATGATGATGCTGG + Intronic
907721830 1:56979188-56979210 TTTTAATAACATGATACGGAGGG + Intergenic
908041189 1:60115465-60115487 TTTCTATAAAATGATGAGGATGG - Intergenic
908769303 1:67581976-67581998 TTCAAAAAACATTATGAGATAGG + Intergenic
908968902 1:69801250-69801272 TTCCAAAAACTTGAGGAGGAAGG - Intronic
908981461 1:69964082-69964104 TTTGTAAAATATGATGAGTAAGG - Intronic
909009655 1:70320154-70320176 TGGAAAGAACAAGATGAGGAAGG + Intronic
909153814 1:72044033-72044055 TTTACAACACATGATGATAAAGG - Intronic
909321997 1:74301397-74301419 CTCAAAAAAAATGATGGGGAGGG + Intronic
909706258 1:78588160-78588182 TTTAAAAAAGCAGAGGAGGAAGG + Intergenic
909882793 1:80901162-80901184 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
909946896 1:81673811-81673833 TTTAAAAAACTAGAAGAGGCTGG - Intronic
910303683 1:85737147-85737169 TTTAAAAAACATGATCAGTAGGG + Intronic
910641827 1:89472597-89472619 TTAAAAAACCATGATGAATATGG + Intergenic
911008129 1:93248999-93249021 TTTCAAAAAATTGAAGAGGAGGG - Intronic
911746790 1:101449493-101449515 ATTAAAAAATAAGATGAGGCTGG - Intergenic
911821776 1:102432934-102432956 TTGAAAAAAAATGATGGAGAAGG - Intergenic
911941132 1:104049003-104049025 TTGAAAAAAAGTGATGAGAACGG - Intergenic
911979078 1:104543461-104543483 TTTGTAAAACATGATAAAGATGG - Intergenic
912016531 1:105044133-105044155 TTCAAAAAAAGTGAAGAGGAGGG + Intergenic
912563955 1:110571734-110571756 TTTAAAGAACATAATGCAGAGGG - Intergenic
912803293 1:112735372-112735394 TTTAAAAATCATCATAAGGCTGG + Intergenic
913100953 1:115564964-115564986 TATAAAAAACATTAGGAGGAAGG + Intergenic
914406866 1:147383743-147383765 TTTATAAATGATGATAAGGAAGG + Intergenic
914897961 1:151693755-151693777 TTTAAAAAACTGGCAGAGGAGGG - Exonic
915184490 1:154093116-154093138 TTTTAAAAAAATGATTAAGATGG + Intronic
915803823 1:158823243-158823265 TTCAAAAAAATTGAGGAGGAAGG - Intergenic
915880124 1:159661035-159661057 TTTAAAAAAATTGAAGAAGATGG - Intergenic
916082550 1:161244080-161244102 TTTAAAAAAAATTCTGAGGCCGG + Intergenic
916371250 1:164097463-164097485 TTTAAAAAACATCATGAAATTGG - Intergenic
916664631 1:166955304-166955326 TTTACAAAATATTATGAGGCTGG + Intronic
916976222 1:170082617-170082639 TTTAAAAGATATAATGAGCAAGG + Intronic
917055208 1:170973577-170973599 TTTAAAAAAAATTATTAGGTTGG + Intronic
917148686 1:171921565-171921587 TTTAAAAAAAAGGAGGAGGAGGG - Intronic
917271997 1:173287020-173287042 TTTAAAAACCATAATGAGCTGGG + Intergenic
917673278 1:177294616-177294638 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
917971037 1:180207909-180207931 TTTCAAAAAAAGGATGAGAAAGG - Intergenic
918030729 1:180806827-180806849 TTTAAAAAAAATGATCTGGTGGG + Intronic
918083710 1:181227252-181227274 ATAAAAAAAAATGCTGAGGATGG - Intergenic
918396858 1:184122401-184122423 TTTAAAAAACATTTTTAGGCCGG + Intergenic
918514183 1:185344328-185344350 TTTAAAACACATGATGAGGCTGG - Intergenic
918827100 1:189338094-189338116 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
918898539 1:190380923-190380945 TGTAAATATCATAATGAGGAGGG - Intronic
918959141 1:191248899-191248921 TTTAAAAAAAAAGAAAAGGAGGG - Intergenic
919114898 1:193268909-193268931 TTTCAAAATTATTATGAGGAGGG + Intergenic
919357433 1:196542126-196542148 TTAAAAAACCATGATGTGAAAGG + Intronic
919553835 1:199027003-199027025 TTTAAGAAATAAGAGGAGGAAGG - Intergenic
919955589 1:202411691-202411713 TTTACAAAACCTTATGAGGTAGG + Intronic
919958643 1:202443345-202443367 TCTAAAAAACCTAATGATGAAGG - Intronic
920219519 1:204386530-204386552 TTTAAGAAACTTGAAGTGGAAGG - Intergenic
920453319 1:206077473-206077495 TATAAACAACATGGTGAGGCTGG + Intronic
920750126 1:208666397-208666419 TTTGCAAAACCTGATGAGAAAGG - Intergenic
920863403 1:209730715-209730737 TTTAATAAAGATGCTGAGAAAGG - Intronic
921339990 1:214125086-214125108 TTTAAACAAACAGATGAGGAAGG + Intergenic
921905535 1:220491906-220491928 TTTAAACAGCATTCTGAGGAAGG + Intergenic
922483251 1:225954114-225954136 TTTAAAAAACAGCAAGAGAAGGG - Intergenic
922843083 1:228660429-228660451 TTCCAAAAACTTGAAGAGGAGGG + Intergenic
922950108 1:229551940-229551962 TTTAGAAAACTAGAGGAGGAGGG - Intronic
923311670 1:232741574-232741596 TTTAAACAACATTAGGAGGTAGG - Intergenic
923324287 1:232867223-232867245 TCTTAAAAACATGATGGGGTGGG - Intergenic
923364061 1:233242282-233242304 TTTAAAAAATAAGAGTAGGATGG - Intronic
923938123 1:238787528-238787550 TATAAAAAAAATGGTGAGTAAGG + Intergenic
924154575 1:241162989-241163011 TTTAAAAAATGTGTTGAAGATGG + Intronic
1063686088 10:8238299-8238321 TTTAAAAAAGTTAATGAGGAAGG + Intergenic
1063898814 10:10710804-10710826 TTTAAAAAAGAAAATGAGGAGGG - Intergenic
1064090857 10:12382532-12382554 TTTAAAAACCAGGATGGGCATGG + Intronic
1064470529 10:15630728-15630750 ATTAAAAAACATGCAGAGGGAGG + Intronic
1064615053 10:17144945-17144967 TTTAAAAAACATGCAAAGGGAGG + Intronic
1065380299 10:25083491-25083513 TTTTAAAAATTTGATGAGGGAGG + Intergenic
1065499991 10:26370729-26370751 TTCCAAAAAAATGAGGAGGAGGG - Intergenic
1066144138 10:32539019-32539041 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1066150284 10:32608995-32609017 TTTTAAAAATTTGATGAGGCTGG + Intronic
1066162596 10:32750152-32750174 TTTAAAAAGCAAGATGAGAAAGG - Intronic
1066165271 10:32781264-32781286 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1066295373 10:34049417-34049439 TTTTAAAAACTAGATGAGAAGGG - Intergenic
1067215925 10:44302800-44302822 TTCAAAACAAATGGTGAGGAGGG + Intergenic
1067265499 10:44738915-44738937 TTCAAAAAAGTTGAAGAGGAGGG + Intergenic
1067321038 10:45221249-45221271 TTAAAAAAACAAGCTGAGGGTGG - Intergenic
1068357683 10:55931160-55931182 CTTTAATAACATGATGAGAAAGG + Intergenic
1068462666 10:57347952-57347974 TTTTAAAAAATTGAGGAGGAGGG - Intergenic
1070093708 10:73314921-73314943 TTTAAAAAACAGGCTGGGCACGG + Intronic
1070402937 10:76069237-76069259 TTTCACAAGCATGATGGGGAAGG + Intronic
1070652182 10:78245444-78245466 TTGAGAAAACATGAAGAGAAAGG - Intergenic
1070938642 10:80322766-80322788 TTTAAAAACCTTTATGTGGAAGG + Intergenic
1071060671 10:81568440-81568462 TTCCAAAAAATTGATGAGGAGGG + Intergenic
1071119667 10:82262786-82262808 TTTTACGAACACGATGAGGAGGG + Intronic
1071677248 10:87666252-87666274 TTAAAACAACAGGATGAGCATGG - Intronic
1071852303 10:89586302-89586324 TTTAAAAAAAATAATGAAAAAGG - Intronic
1071891820 10:90016533-90016555 TTCAAAAAAATTGAAGAGGAAGG - Intergenic
1072827756 10:98625804-98625826 TTTAAAACACATGAATAGGCCGG + Intronic
1072862138 10:99017560-99017582 TTTCAAAAAATTGAGGAGGAGGG - Intronic
1073497158 10:103903112-103903134 TTTAAAAAACAGGCTGTGGATGG - Intronic
1074176372 10:111008325-111008347 TTTAAAAAACATGGATATGAAGG - Intronic
1074332954 10:112538030-112538052 TTTTAAAAACACGAAGTGGATGG + Intronic
1074461122 10:113637625-113637647 ATTAAAAAACATCATTAGGCTGG + Intronic
1075012032 10:118881116-118881138 TTAAAAAAAATTGAAGAGGAGGG + Intergenic
1075019669 10:118942398-118942420 TTTAAAAAACATCATGTGCTGGG - Intergenic
1075497387 10:122936001-122936023 TTTTAAAAACTAGAAGAGGAGGG - Intronic
1075511636 10:123077276-123077298 TTTAAAAAACAAGAACAGGCTGG - Intergenic
1075947483 10:126448992-126449014 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1077260586 11:1617319-1617341 TATTAAAAACAAGAAGAGGAAGG + Intergenic
1077596194 11:3533801-3533823 TTTAAAAAAGAAGAAGAGGCTGG - Intergenic
1077821288 11:5744313-5744335 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1078235225 11:9478120-9478142 TTTAAAAAACATTAACAGGCCGG - Intronic
1078244097 11:9557709-9557731 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1078816408 11:14826774-14826796 TTACAAAAAAATGAGGAGGAAGG + Intronic
1079193542 11:18303195-18303217 TTTCGAAAACATGAAGAGGAGGG - Intronic
1079777209 11:24546807-24546829 TTTTAAAAAATTGAGGAGGAAGG - Intronic
1079979182 11:27131407-27131429 GTTAAATAACATTTTGAGGAGGG + Intergenic
1080094344 11:28387650-28387672 TTTCAAAAAACTGAAGAGGAAGG + Intergenic
1080539786 11:33255152-33255174 GTTAAAAAAAAAGATGAGGCCGG + Intergenic
1080862139 11:36159311-36159333 TTTAAAAAACTTGCTGGGTATGG + Intronic
1081389371 11:42511566-42511588 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1081543956 11:44056534-44056556 TTTAAAATACAGGATGAGGCCGG + Intronic
1081664212 11:44907022-44907044 TTCAAAAAGCCTGTTGAGGAAGG - Intronic
1082019527 11:47520360-47520382 TTCAAAAGAAATGATGATGAAGG - Intronic
1083040787 11:59684040-59684062 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
1083044734 11:59723899-59723921 TTTAAAATAAATGATTAGGCAGG + Intronic
1083144733 11:60749789-60749811 TTTTAAAAACCTTATGAGGTTGG - Intergenic
1083398419 11:62407047-62407069 TTTAAAAACAATGATAAGGCTGG + Intronic
1083536420 11:63471809-63471831 TTTAAAAAACATTAATAGGCTGG + Intronic
1084306173 11:68285153-68285175 TTTAAAATTCCTAATGAGGATGG + Intergenic
1084392276 11:68885286-68885308 TTTAAAACACTTGATCAGGCCGG + Intergenic
1085017201 11:73182615-73182637 TTTAAAGAACATTTTCAGGATGG - Intergenic
1085115691 11:73929758-73929780 TTAAGAAAACAGGATGAGGCTGG + Intergenic
1085542188 11:77282068-77282090 ATTAAAATATATGATGAGAATGG + Intronic
1086258077 11:84903938-84903960 TTTCAATAACATGATGTGAAAGG + Intronic
1086551180 11:88054237-88054259 TCAAAAAAACAAGATGAAGATGG - Intergenic
1086901912 11:92377177-92377199 TTCACAAAACATGTTGAAGAAGG + Intronic
1086902019 11:92378567-92378589 TTTAAAAATCTTTAAGAGGATGG - Intronic
1086932150 11:92705176-92705198 TTTAAAAAATCTGCTTAGGAGGG - Intronic
1087120078 11:94564354-94564376 TTTAAAAAACCCTATGTGGAAGG + Intronic
1087155865 11:94902482-94902504 TTCATAAAACTTGAGGAGGAGGG + Intergenic
1087305446 11:96484384-96484406 TTTGAAAAGCATGCTGAAGAAGG - Intronic
1087555856 11:99720131-99720153 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1087973791 11:104518768-104518790 TTAAAAAAGCATGATGTGGCCGG + Intergenic
1090105316 11:123848539-123848561 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1090309227 11:125720115-125720137 TTTAAGAAACAAGATGACCAGGG - Intergenic
1091355754 11:134936385-134936407 TTTATAAAAGTTGATGGGGAGGG - Intergenic
1091398109 12:166334-166356 TTTAAAAAAAATGAAGTGGAGGG - Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092059097 12:5533905-5533927 TTTTAAAAACATACTGAGAAGGG - Intronic
1092112603 12:5974417-5974439 TTTCAAAAAGAAGATGAGTAGGG - Intronic
1092603096 12:10088675-10088697 TTTAAAAAATATGGTGATTAAGG + Intronic
1093052823 12:14522466-14522488 TTCAAAAGACATGAAGAGGAGGG + Intronic
1093080688 12:14807126-14807148 TTTAAAGAACCTGCTGAGGGCGG - Intronic
1094132692 12:27091789-27091811 CTTAAAAAATGTGATGAGGTAGG + Intergenic
1094305870 12:29018541-29018563 TTTAATATATATGAAGAGGAAGG - Intergenic
1094461158 12:30697469-30697491 TTTAATAAAGATGATGATGTGGG + Intergenic
1095146268 12:38731417-38731439 TTTTAAAGACAGGATGTGGAGGG + Intronic
1095398853 12:41791688-41791710 TTTAAAAAGTAGGATTAGGATGG - Intergenic
1095459340 12:42425681-42425703 TTTTAAAAACCTGAGGAGGCTGG - Intronic
1095558720 12:43539724-43539746 TTTAAAAAGCATGCTGAAGAGGG + Intronic
1095613274 12:44157574-44157596 TTTTAAAAAAATAATGAGGTCGG + Intronic
1096854713 12:54472252-54472274 TTTCTTAAACATGATCAGGAAGG + Exonic
1097151099 12:56980526-56980548 TTTAAAACACGTAATGAGGCTGG - Intergenic
1097558950 12:61177180-61177202 TTTCAAAAAACTGAGGAGGAGGG - Intergenic
1097567112 12:61284865-61284887 TTTAAAAAACCTAAGGAAGATGG + Intergenic
1097729688 12:63114368-63114390 TTCCAAAAACTTGAGGAGGAGGG + Intergenic
1097896869 12:64833287-64833309 TTTTAAAAACATGTTGAGATGGG + Intronic
1097963538 12:65555735-65555757 TTTAAAAAACATTGTGTGGGAGG - Intergenic
1097986730 12:65790739-65790761 TTCAAAGAAAATGATGAAGATGG - Intergenic
1098145470 12:67493266-67493288 TTTTAAAAAGTTGAGGAGGATGG + Intergenic
1098148324 12:67520388-67520410 TGAAAATAACCTGATGAGGATGG + Intergenic
1098359376 12:69639963-69639985 TTCAAACAACCTGACGAGGAAGG + Intergenic
1098947110 12:76601299-76601321 AATAAAAAACATGATGAGGCTGG + Intergenic
1098968662 12:76824407-76824429 TTTAAAAATTATGATGATTAGGG + Intronic
1099032343 12:77542530-77542552 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1099911077 12:88834469-88834491 TTTAAAATAAATGATGATCAAGG + Intergenic
1099983861 12:89640214-89640236 TTTAAAAAAAATAATGGGGGTGG - Intronic
1100104489 12:91152531-91152553 TTTAAAAAAAATCATTAAGAAGG + Intronic
1101101976 12:101403222-101403244 TTTAAAAAATATCCTGAAGATGG - Intronic
1101255772 12:102974999-102975021 ATTAAAAAACATGGAGAGAATGG + Intergenic
1101764912 12:107688772-107688794 TTAGATAAATATGATGAGGAAGG + Exonic
1102902703 12:116650799-116650821 ATTTAAAAACATTATGTGGAAGG - Intergenic
1102911587 12:116718787-116718809 TTTAAAGGAAATGAGGAGGAAGG - Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103517386 12:121516118-121516140 CTTAAAAAGCAAGCTGAGGACGG + Intronic
1104210084 12:126680430-126680452 TTTAGAATACATCATGAGTAAGG + Intergenic
1104521239 12:129477307-129477329 TACAAAACACAGGATGAGGAGGG - Intronic
1104539784 12:129653185-129653207 TTTGATAACCAGGATGAGGAGGG + Intronic
1105063584 12:133176877-133176899 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1105332138 13:19427674-19427696 CTGATAAAACATGATGAGCAGGG - Intronic
1105879671 13:24593092-24593114 CTGATAAAACATGATGAGCAGGG + Intergenic
1105920172 13:24955987-24956009 CTGATAAAACATGATGAGCAGGG - Intergenic
1106158465 13:27179160-27179182 TTTCAACAACATGATGAAGTAGG - Intergenic
1106322841 13:28658676-28658698 TTTAAAAAACATAATATTGAAGG - Intergenic
1106387865 13:29305743-29305765 TTTCAAAAAATTGAAGAGGAGGG + Intronic
1106723442 13:32459762-32459784 TCCAAAAAAAATGAAGAGGAGGG + Intronic
1106963184 13:35025784-35025806 TGTAAAAAACAAAATGAAGATGG - Intronic
1107005533 13:35605553-35605575 TTGAAAAAAGATGATCAGGATGG + Intronic
1107089523 13:36462130-36462152 TAAAAAAAAAATAATGAGGAAGG - Intergenic
1107200836 13:37714813-37714835 TTTGAAAAGCATTATGAAGAAGG - Intronic
1107270997 13:38615917-38615939 GTTAAATTACATGATAAGGATGG - Intergenic
1107310948 13:39077035-39077057 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1107403706 13:40093707-40093729 TTTAAAAAAGATCATCATGATGG - Intergenic
1107468437 13:40668807-40668829 TTTAAAAAAATTGACGAGGCAGG + Intergenic
1107470417 13:40686353-40686375 ATTAAAAAAAAGGATGAGGCTGG - Intergenic
1107485962 13:40827749-40827771 CTGATAAAACATGATGAGCAGGG - Intergenic
1107574348 13:41701342-41701364 TTAAAAAAACATGTGCAGGAAGG + Intronic
1107647639 13:42511922-42511944 TTTAAAAAACATTATTAGCCAGG + Intergenic
1108097516 13:46919296-46919318 TTTAAAAAAATTGAGGAGGAGGG - Intergenic
1108289280 13:48942161-48942183 TTGATATAACTTGATGAGGAGGG - Intergenic
1108491727 13:50988847-50988869 ATTAAAAAATCTGAAGAGGATGG - Intergenic
1108649678 13:52464593-52464615 ATTCAAAAACATGATGATGTTGG - Intronic
1109332893 13:60952311-60952333 TTTAAAAAAAAGGAGGAGGGTGG - Intergenic
1109374994 13:61480938-61480960 TTTCAAAAAGTTGAGGAGGAGGG - Intergenic
1109528138 13:63603505-63603527 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1109569336 13:64165612-64165634 TTTAAATAAAATAATGAGGGAGG - Intergenic
1109695782 13:65955333-65955355 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1110307023 13:74000053-74000075 TTTAAAAAAAGTGGGGAGGAGGG - Intronic
1110782190 13:79479731-79479753 TTTAAAAAGAACTATGAGGAAGG + Intergenic
1111006441 13:82255820-82255842 TTTAAAAAACATTTTGAAAAGGG - Intergenic
1111027571 13:82551415-82551437 TTTTAAAAATATTATGAGAATGG - Intergenic
1111431135 13:88149657-88149679 TATAGAAAACATGAAGAGGCAGG + Intergenic
1111539032 13:89647371-89647393 TTTCCAAAACTTGAAGAGGAAGG + Intergenic
1111607111 13:90554147-90554169 TTTAAAGAACTTCATGATGAAGG + Intergenic
1111627150 13:90803723-90803745 TTTAGAAATCATGGTCAGGAAGG + Intergenic
1111638456 13:90935829-90935851 TTTAAAAAAGATGTTGAGAGAGG - Intergenic
1111703156 13:91715927-91715949 TTTTAAAAACAAGATGAGCATGG - Intronic
1111722154 13:91959500-91959522 TTCCAAAAACATGAGGAGGAAGG + Intronic
1111794756 13:92904819-92904841 TGAAAAAAAAATTATGAGGATGG - Intergenic
1111910196 13:94302651-94302673 TTTACAAAACCTAATGAGAATGG - Intronic
1112387626 13:98955019-98955041 TTTAAAAACCATAATTAGGCCGG + Intronic
1113031551 13:105998992-105999014 TTTTAAAAACCTGTGGAGGATGG + Intergenic
1113034861 13:106037634-106037656 TTTAAAAAACAATTTGGGGAAGG + Intergenic
1113149370 13:107244693-107244715 TTTCAAAAACATGGTGTGAAAGG - Intronic
1113273805 13:108705941-108705963 TTTTAAAAATATGAACAGGAAGG + Intronic
1114274305 14:21128383-21128405 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1114429030 14:22644729-22644751 TGAAAAAAATATGATGGGGATGG - Intergenic
1114764689 14:25357633-25357655 TTTAAAAAACATGTTTTGCAAGG - Intergenic
1114864083 14:26566456-26566478 TTTCAAAAACTTTATGAAGAAGG - Intronic
1115114921 14:29869144-29869166 TTTAAAAAAGAAGAAGAGGCTGG + Intronic
1115139211 14:30149273-30149295 TTCAAAAAAATTGAAGAGGAGGG + Intronic
1115667406 14:35567234-35567256 TATTAAAAACATGATGAAGTAGG + Intronic
1115862925 14:37709673-37709695 TTTACAAAACATGATTGGGAAGG - Intronic
1115976567 14:39003258-39003280 TGTGAAAAACATGGTAAGGAGGG + Intergenic
1116148432 14:41105422-41105444 TTTCAAAAAATTGAGGAGGATGG + Intergenic
1116311317 14:43330045-43330067 ATTAAAAAACATTATTAGGCCGG + Intergenic
1116650295 14:47582363-47582385 TTTTAAAAATGTGATGAGAATGG + Intronic
1116722131 14:48510562-48510584 TTTAAAAAATATAATTAGGCTGG - Intergenic
1117262958 14:54055583-54055605 TTTAAAATACATGACAAGGATGG - Intergenic
1117639213 14:57779539-57779561 TTCCAAAAACCTGAAGAGGAAGG + Intronic
1117828835 14:59730345-59730367 TTTAAAATACAACATGAGGTAGG - Intronic
1117856902 14:60043842-60043864 TTTAAAAAAATTGAAGAGGAAGG - Intronic
1118522970 14:66607536-66607558 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1118561462 14:67087860-67087882 TTAAAAAAAGAGGAAGAGGAAGG - Intronic
1118613614 14:67560337-67560359 GTTAAAAAGAATGAAGAGGATGG - Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1118856901 14:69630200-69630222 TTAAAAAAACTTGCCGAGGATGG + Intronic
1118944428 14:70371199-70371221 TTAAAAGAACATGAACAGGATGG + Exonic
1119135503 14:72214793-72214815 TTAAAAAAACATGGGGAGTAGGG + Intronic
1119340100 14:73869727-73869749 TTTAAAAAAAATAATCAGGCTGG + Intronic
1120607597 14:86598488-86598510 ATTAAAAAACATGCTTTGGATGG + Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1121706644 14:96001362-96001384 TTAAATAAGCATGGTGAGGAGGG - Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1122120160 14:99548850-99548872 TCTCAAAAACATGAAGAGGATGG + Intronic
1124477486 15:30047348-30047370 TTTAAAAAACATGTTTAGGACGG - Intergenic
1124930785 15:34117280-34117302 ATTAAAAAACAAGAAGAGGCAGG - Intergenic
1124949250 15:34301240-34301262 GTTAACAAACATGTTGAGGCCGG - Intronic
1125127266 15:36238894-36238916 TTTAAAACAGAAGATGAGGCCGG + Intergenic
1125247971 15:37663610-37663632 TTTCAAAAAAATGAGGAGGAGGG - Intergenic
1125818192 15:42604537-42604559 TTGAAAAAACGTGAAGAGGGAGG + Intronic
1125990868 15:44106523-44106545 TTTAAAAATCAGAATGAGGCAGG - Intronic
1126429984 15:48572908-48572930 TTTAAAAAACAAGAGGCGAAGGG + Intronic
1126574783 15:50185939-50185961 TTTTAAAAACATTCTGAGGCTGG + Intronic
1126902353 15:53327280-53327302 ATTAATAAAAATGAAGAGGATGG + Intergenic
1127143747 15:56003271-56003293 ATTAAAAAAAATGAAGAGGCCGG - Intergenic
1127376912 15:58393498-58393520 TTTAAAAAAAATGAGGTGGGTGG + Intronic
1127400643 15:58582103-58582125 TTAAAAAAAAAAGAAGAGGAGGG + Intergenic
1127812245 15:62574279-62574301 TTTAAAAAACATGATTAGCCAGG + Intronic
1127942766 15:63716682-63716704 TTTAATCAAAATAATGAGGAAGG - Intronic
1127973002 15:63976998-63977020 GTTAAAGAACACCATGAGGAAGG + Intronic
1127978040 15:64013511-64013533 TTAAGAAAACATGAGGAGAAGGG + Intronic
1128681468 15:69655435-69655457 TTTAAAAAACGTTCTGAAGATGG - Intergenic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1129822840 15:78616473-78616495 TTTCAAAGACAAGGTGAGGAGGG + Intronic
1129952934 15:79607887-79607909 TTTGAAAAACACAATGAGAAAGG + Intergenic
1130185824 15:81680805-81680827 TTTCAAAAAACTGAGGAGGAGGG + Intergenic
1130577949 15:85108993-85109015 TTTAAACAACATATTAAGGAAGG - Intronic
1130934573 15:88458025-88458047 TTTTAAAAAATTGATGAAGAAGG - Intergenic
1130963902 15:88683092-88683114 TTTAAAAAGCAAGATATGGAAGG - Intergenic
1131753346 15:95533848-95533870 TTGATACAATATGATGAGGATGG + Intergenic
1131804862 15:96110610-96110632 TTCAAAAAACATCAGGCGGAGGG - Intergenic
1131849242 15:96521003-96521025 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
1131902080 15:97098922-97098944 AATAAAAAAAATGATGAGGGTGG + Intergenic
1132007954 15:98247942-98247964 TTTTAAAAAAATGTTGAAGATGG + Intergenic
1133067620 16:3220556-3220578 TTTAAAAAACATTATCAAGACGG - Intergenic
1133114968 16:3573108-3573130 ATTAAAAAACATCAAAAGGAGGG + Intronic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133910882 16:10065598-10065620 TTTTAAAAACCTTATGAGGTAGG - Intronic
1134125303 16:11612326-11612348 TTTCACAAGAATGATGAGGACGG - Intronic
1134321675 16:13169904-13169926 TTTAAAATACATGTTCAGGCCGG + Intronic
1134377512 16:13691257-13691279 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1134480851 16:14618005-14618027 TTTAAAAAATATTATGAAGTAGG - Intronic
1135232053 16:20717805-20717827 TTAAAAAAAGAAGAAGAGGAAGG + Intronic
1135247037 16:20866043-20866065 TTTAAAAAACTTACTTAGGATGG - Intronic
1135680691 16:24454290-24454312 TTTACCAACCATAATGAGGATGG + Intergenic
1135800064 16:25485679-25485701 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1135838710 16:25853890-25853912 TTTCAAGAACTTGAAGAGGAGGG - Intronic
1136347051 16:29682674-29682696 AGAAAAAAACATGATGAGGCTGG - Intronic
1136643192 16:31585581-31585603 TTCCAAAAACATGAAAAGGACGG - Intergenic
1137309920 16:47245048-47245070 TTTAAAAAACATTTTTAGGCCGG + Intronic
1137333535 16:47525862-47525884 TTATAAAAGCATAATGAGGAAGG + Intronic
1138129518 16:54467760-54467782 TTTAAAAAAGAAAAGGAGGAAGG - Intergenic
1138527133 16:57615379-57615401 TCTAGAAAGCATGGTGAGGATGG + Intronic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1139092426 16:63664521-63664543 TATAAAATACATTATGAAGATGG - Intergenic
1139180839 16:64746764-64746786 TTTAATAAACATAATCAAGATGG - Intergenic
1139938717 16:70589917-70589939 TTTAAAAATCATGGTAAGGCCGG - Intronic
1140080452 16:71742085-71742107 TTTAAAACACATTATGAATAAGG + Intronic
1140509580 16:75497179-75497201 TTTAAAAATCATGAACAGGCCGG - Intergenic
1140949117 16:79798725-79798747 TTTAAAGATCAGGATGGGGAGGG + Intergenic
1141061801 16:80880152-80880174 TTTAAATAAAATGAAGAGAATGG - Intergenic
1142159929 16:88552111-88552133 ATTAAAAAATGTGATGAGGCTGG - Intergenic
1143134731 17:4705564-4705586 TTTAAAAAACAGCATAAAGAAGG - Intergenic
1144855798 17:18267067-18267089 TTTCTAAAAAATGATGAGCATGG - Intergenic
1144931867 17:18865678-18865700 TTTAAAAAATACTATTAGGATGG + Intronic
1146066582 17:29640375-29640397 TTTAAAAAACATACTTTGGAGGG - Intronic
1146388093 17:32395490-32395512 TTTTAAAAAAATGATTAAGATGG - Intergenic
1146434372 17:32829748-32829770 TTTAAAAAACAACATGAAGCCGG - Intronic
1146543080 17:33714595-33714617 TTTAAAAACCATGAACAGGAAGG + Intronic
1146980630 17:37158330-37158352 TTTAAAAGACTGGATGAGGCTGG + Intronic
1147040450 17:37714255-37714277 TTTAAAAGACATTTTTAGGAAGG + Intronic
1147130468 17:38404931-38404953 TTTAAGAAACTCGATGAAGAGGG + Exonic
1147319769 17:39638982-39639004 TTTAAAAAACTAGCTGAGCATGG + Intronic
1147507617 17:41035108-41035130 TTTAAGAAACATGAGGAGTTAGG - Intergenic
1148402183 17:47374765-47374787 TTTAAAAAACATTCAGAGAAGGG + Exonic
1149079847 17:52642089-52642111 TTTATGAAACATAATAAGGAAGG + Intergenic
1149127932 17:53257854-53257876 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1149944063 17:60901844-60901866 TTTAAAAAACAAAATGACAAGGG - Intronic
1150062489 17:62080720-62080742 GGTAAAAAACATGATGTGGAAGG - Intergenic
1150517822 17:65832809-65832831 TTTCAAAAAATTGAGGAGGAGGG + Intronic
1150555047 17:66246882-66246904 TTCAAAAACCATTATGTGGAAGG + Intronic
1150604885 17:66682182-66682204 TTCAAATAAGATGATGAAGATGG - Intronic
1150968743 17:70002644-70002666 TGTCAAAAAAATGATGAGGAAGG + Intergenic
1151031873 17:70750059-70750081 TTTAAAAAAAAAAATGATGATGG - Intergenic
1151418951 17:73985003-73985025 TTTAATAAACGTGAGGTGGATGG - Intergenic
1151544444 17:74784021-74784043 TTTTTAAAGCATGAAGAGGACGG - Intronic
1151629418 17:75300367-75300389 TTTAAAAATCATTATGAGCCAGG - Intergenic
1151896476 17:76983995-76984017 TTTTAAAAAAATGATGAGTCTGG + Intergenic
1152986131 18:322922-322944 TTTAAAAAAAATGAGTATGAAGG + Intronic
1153097986 18:1430950-1430972 TTTAAATAAAATGATGAGGGTGG + Intergenic
1153331825 18:3881616-3881638 GTTAAAAAACAAGATGAGCCGGG + Intronic
1153462160 18:5347806-5347828 TTCCAAAAAAATGAGGAGGAGGG + Intergenic
1155529403 18:26750821-26750843 TTTAAAAGAAATGATGAGGCTGG - Intergenic
1155609228 18:27644638-27644660 TTCAAAAAACATGAAGAATATGG + Intergenic
1155717347 18:28961464-28961486 CTTCAAAAACATGTTGAGCAAGG - Intergenic
1156253671 18:35376037-35376059 TTTAAAAAATATGATTAGACCGG - Intronic
1156671812 18:39479691-39479713 TTTCAACAACATGATGAAGCTGG + Intergenic
1156696132 18:39770484-39770506 TTTAAAAGACAGGAAGAGAAGGG - Intergenic
1156741846 18:40340256-40340278 TTTAAATATCATGCTGAGCAAGG + Intergenic
1156770829 18:40722033-40722055 TTTCAAAAAATTGATGAGGAGGG + Intergenic
1156883632 18:42109276-42109298 TTTAAAACACAAGAGAAGGAAGG - Intergenic
1157154514 18:45252847-45252869 ATTAAAAAGCATGATTAGGCTGG + Intronic
1157227935 18:45884581-45884603 TTTCAACAATATGGTGAGGATGG + Intronic
1158052142 18:53234982-53235004 TTTGAAAAACCTCATGAGGATGG + Intronic
1158063021 18:53369993-53370015 TTTCAAAAAACTGAAGAGGAGGG - Intronic
1158307129 18:56118241-56118263 TTTAAAACAACTGATAAGGAAGG + Intergenic
1158499131 18:57984186-57984208 ATTAAAAATGATGATGATGATGG - Intergenic
1159302640 18:66595772-66595794 TTTCAAAAATTTGAGGAGGATGG + Intronic
1159375653 18:67589191-67589213 TTTAAAAAACAGGAAGAGAAAGG - Intergenic
1159397412 18:67879957-67879979 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1159426420 18:68294139-68294161 TTGAAAAAAAATGATGATAATGG - Intergenic
1159439902 18:68464818-68464840 TTTAAAAAAAATTAGAAGGAAGG + Intergenic
1159495148 18:69193213-69193235 GTTATAAAACTTGATGAGGTAGG - Intergenic
1159668850 18:71198003-71198025 TTTAAAAACCAAGCTGAGAATGG + Intergenic
1159799588 18:72880895-72880917 TTTCAAAAACATGGATAGGACGG - Intergenic
1160286764 18:77550274-77550296 TTTAAACAACATGCTGGGGCTGG + Intergenic
1160301181 18:77680582-77680604 TTTAAAAAAAAAGAAGAGAATGG + Intergenic
1160312860 18:77812089-77812111 ATTAATAAACATGATAAGTAAGG + Intergenic
1160434921 18:78842712-78842734 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1161904223 19:7143122-7143144 TTTAAAAAAAATGATGGTGATGG - Intronic
1162748762 19:12815102-12815124 TGTAAAATACATGATGTGGCTGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164523392 19:28995864-28995886 TTAAAAAAAAATGAAGAGGGGGG + Intergenic
1164959880 19:32418985-32419007 TTTTAAAAATATGCTGAGAAAGG - Intronic
1165732689 19:38156526-38156548 TTTAGAAATCATCATGAGGCTGG + Intronic
1165949674 19:39467084-39467106 TTTAAAAAGATTGATGAGGCTGG + Intronic
1166211118 19:41307052-41307074 TTTAAAAAGCAAAATGGGGAGGG + Exonic
1166403269 19:42500157-42500179 TTTAAAAAAGAAGAGGAGGGAGG - Intergenic
1167663552 19:50810582-50810604 TTTGAAACATATGTTGAGGATGG + Intergenic
1168166294 19:54550393-54550415 TTTTAAAAATATCATGATGATGG + Intergenic
925273279 2:2630565-2630587 TTTAAATAAGATGGTGAGGTTGG + Intergenic
926772456 2:16390672-16390694 TTTAGAAATCAGGAAGAGGATGG + Intergenic
927456463 2:23254249-23254271 TTTAAATAACTTGATAAAGATGG - Intergenic
928250010 2:29667821-29667843 TTCAAAAAAATTGAAGAGGAGGG - Intronic
929180858 2:39037220-39037242 TTTCAAAAACAACAAGAGGATGG + Intronic
929340143 2:40805646-40805668 TTTTAAAAAAATGATGAAGTTGG - Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929371616 2:41231242-41231264 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
929389121 2:41448285-41448307 TCTAAGGAACATGATGAGGCTGG + Intergenic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
930075923 2:47405449-47405471 TTTAAAAAAAATTATAAGAAAGG + Intronic
930211113 2:48638186-48638208 TTTCAAAAAATTGAGGAGGAAGG + Intronic
930630358 2:53746779-53746801 TTGTAAAAACATAATGTGGAAGG - Intronic
930911948 2:56639922-56639944 TGTAAAAAAGATGTTGAGGTTGG + Intergenic
931266932 2:60668805-60668827 TTAAAAAAACACGATGTGGCCGG - Intergenic
931526478 2:63160777-63160799 TTTAAAAAACATCAGGTGAAAGG + Intronic
931857915 2:66323247-66323269 TTTAAAAAAAATGAAGAGAGGGG + Intergenic
932323837 2:70841469-70841491 TATGAAACACATGATGAAGATGG - Intergenic
932442487 2:71746581-71746603 TCTAAAAAACAGGGTGAAGATGG - Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932602357 2:73136841-73136863 TTTAAAAAAGATGAAAAAGAAGG - Intronic
932752856 2:74382774-74382796 TTTAAAAAATATGTGGAGGCCGG + Intronic
933625142 2:84589764-84589786 CTCAAAAAACATGAAGAGAAAGG + Intronic
935146393 2:100398407-100398429 TTTAAAAAACAAAATAAGGCCGG + Intronic
937196126 2:120158203-120158225 TTTCAAAAAATTGAGGAGGAGGG + Intronic
937483161 2:122284204-122284226 TTTATAAAACATGAGAATGAGGG + Intergenic
937519664 2:122696797-122696819 TTTAGAAAAAATGATAAAGAGGG + Intergenic
937746905 2:125424959-125424981 ATTAAAAAAAAACATGAGGAAGG - Intergenic
938178094 2:129154641-129154663 TATAAAAAACATGGTGAAGATGG + Intergenic
938418239 2:131122209-131122231 TTTAAAACACAGTATGAGGCCGG - Intronic
938423590 2:131165284-131165306 TTAAAAAAACATGATGCAGACGG - Intronic
938507256 2:131899271-131899293 TTTGAAAAAAATGAGAAGGAAGG + Intergenic
939232134 2:139442130-139442152 TTTAAGTAACAGGATGAGAAAGG - Intergenic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940438705 2:153687177-153687199 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
940447225 2:153790039-153790061 TTTCAAAAAATTGATGAGGAGGG + Intergenic
940491230 2:154363752-154363774 TTGCATAAACATGATGTGGAAGG - Intronic
940541052 2:155018508-155018530 TTTAAAAATCTTGATGGGGCAGG - Intergenic
940708224 2:157130236-157130258 TTTTAAAAAATTGAGGAGGAGGG + Intergenic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941048139 2:160699466-160699488 TTTGAAAAAAAAGATGGGGATGG + Intergenic
941085686 2:161114956-161114978 TTTGAAAAACAAAATCAGGAAGG - Intergenic
941103330 2:161322684-161322706 TTAAAAAAACATGACCAGGCCGG - Intronic
941196637 2:162460369-162460391 TTTTAAAAAAATATTGAGGATGG + Intronic
941329568 2:164163705-164163727 TTTAAAAAAACAGAAGAGGAGGG - Intergenic
941335484 2:164239270-164239292 TTTAAAAAGGATGATCAGGGAGG + Intergenic
941573738 2:167203587-167203609 CTTAAAAAACATGGAGAAGAAGG - Intronic
941677244 2:168356859-168356881 TTTAATAAAAATGATGCTGAAGG - Intergenic
941747058 2:169098087-169098109 TTTAAAATACATGAGAAGGTGGG + Intergenic
941792122 2:169564400-169564422 TTTAATAAAAATGCTGAGGTTGG - Intronic
941901292 2:170681398-170681420 TTTACATGACATGATTAGGAGGG - Intergenic
942316646 2:174702565-174702587 TTTAAAAAATATAATGGAGATGG + Intergenic
942538647 2:176992337-176992359 TTTCAAAAAATTGAAGAGGAGGG + Intergenic
942770730 2:179515072-179515094 ATTAAAAAACATATTGAGGCTGG - Intronic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
943265762 2:185729908-185729930 TTAAAAAATCATGAGGAGAAAGG + Intergenic
943511422 2:188831757-188831779 TTTAAAAAATATGAAGGAGAGGG - Intergenic
944425404 2:199577054-199577076 TTTAACATACAAGATGAAGAAGG - Intergenic
944562149 2:200950680-200950702 TTTCAATAACTTAATGAGGAGGG - Intronic
944601854 2:201311251-201311273 TTCCAAAAAAATGAGGAGGAGGG + Intronic
945031589 2:205669450-205669472 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
945135337 2:206621535-206621557 TATAAAAAACATTCTAAGGAAGG + Intergenic
945430547 2:209758612-209758634 TTCCAAAAACCTGAGGAGGAGGG + Intergenic
945502063 2:210588633-210588655 TTTAAGAAACATTATTATGATGG - Intronic
945562868 2:211359892-211359914 TTTAAAAAAGGAGATGAGGTAGG - Intergenic
945702015 2:213183380-213183402 TTTAAAATATATGCTGAGAAGGG + Intergenic
946831900 2:223735931-223735953 TTTTAAAAACATCATGAGCCAGG + Intergenic
947175435 2:227362205-227362227 TTTAAAAAACAGGATAACAAGGG - Exonic
948294305 2:236849257-236849279 TTTAAAAACAATGATCAGGCCGG + Intergenic
949074005 2:242043732-242043754 TTTAAAATTAATGATGAGTAAGG - Intergenic
1169354015 20:4892790-4892812 TTTTAAAAAGATGATGACGTGGG + Intronic
1169993574 20:11530854-11530876 TTCCAAAAACTTGAGGAGGAAGG + Intergenic
1170089891 20:12579300-12579322 TAGAAAAATCAGGATGAGGAAGG - Intergenic
1170477687 20:16732225-16732247 TTTAAAGACCATGAAGATGAGGG + Exonic
1170862374 20:20119154-20119176 TTCAAAAAAATTGAAGAGGAGGG - Intronic
1171567858 20:26210525-26210547 TTTAAAAAACATTACTAAGAGGG - Intergenic
1171725326 20:28613668-28613690 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171789527 20:29508156-29508178 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1171858007 20:30366292-30366314 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1172973022 20:38887343-38887365 CTTATAAACCATGATGTGGATGG + Intronic
1173008756 20:39161563-39161585 TTCAAAAAAACTGAAGAGGAAGG - Intergenic
1173035421 20:39404547-39404569 TTTAAGAAACATGATCTGGCCGG + Intergenic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1173772185 20:45670267-45670289 TTCCAAAAACTTGAGGAGGAGGG + Exonic
1174238715 20:49115595-49115617 TTTAAAAGACATTTTGAGGCTGG - Intronic
1174270037 20:49361429-49361451 ATTAAAAAACATAATAAGGCTGG + Intergenic
1174656995 20:52179871-52179893 TTTAAAAAATATTATCAAGAGGG + Intronic
1174908732 20:54582392-54582414 TTCAAAAAAACTGAAGAGGAAGG - Intronic
1175035799 20:56000596-56000618 TTTAAAATAAATGATAAAGATGG + Intronic
1175378381 20:58545184-58545206 TTAAATAAACATGATGTGGCTGG - Intergenic
1176740875 21:10600909-10600931 CTGATAAAACATGATGAGCAGGG + Intronic
1176786373 21:13261055-13261077 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1177325474 21:19582826-19582848 TTTTAAAGACATGAAGAGTAGGG + Intergenic
1177392386 21:20493155-20493177 TTTAATAACAATGATGAGAATGG + Intergenic
1177652203 21:23971920-23971942 TTTCAAAAAATAGATGAGGAAGG - Intergenic
1177984983 21:27963126-27963148 TTTGAAAAAAATGAGAAGGAAGG - Intergenic
1177990985 21:28036426-28036448 TTAAAAAAACAGGATTAGGCCGG + Intergenic
1178182658 21:30181083-30181105 TTCAAAAAAGATGCTGAGCATGG + Intergenic
1178530974 21:33375710-33375732 TTTAAAAAATATGTTCAGGCTGG + Intergenic
1178978418 21:37240718-37240740 TTTAAACAAATTGATGATGAAGG - Intronic
1179204122 21:39257554-39257576 TTTAAAAAAGGCCATGAGGAAGG + Intronic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1180178367 21:46102957-46102979 TTCAAAAAACTTGAAGAGAAGGG - Intronic
1180206159 21:46262260-46262282 TTTCAAAAAACTGAAGAGGAGGG + Intronic
1180256689 21:46634890-46634912 TTTAAAAAAAAAAATGTGGAAGG - Intergenic
1180542805 22:16467248-16467270 TCTGAAAAAAATGAGGAGGAAGG + Intergenic
1180646129 22:17340637-17340659 TTTAAAAAATATGTTGAGGCTGG + Intergenic
1182224606 22:28786674-28786696 ATTAAAAAAGATGATTAAGAAGG + Exonic
1182408326 22:30158390-30158412 TTTAATAATCCTGATTAGGAAGG - Intronic
1183685767 22:39360624-39360646 TTTAATATACATGCTGAGCACGG + Intronic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
1184571368 22:45327078-45327100 TTTAAAAAATATAATGAGTTGGG + Intronic
1184806496 22:46798025-46798047 TTTAAAAAATCTGGTGAGCATGG - Intronic
1184897955 22:47423164-47423186 TTTAAATAACAAGGTGAGCATGG - Intergenic
949097445 3:102294-102316 CTTACAAATGATGATGAGGATGG - Intergenic
949306062 3:2642546-2642568 TATAAAAAACATGGTCAGGCAGG - Intronic
949613116 3:5723862-5723884 TTTAAACCTCAGGATGAGGATGG + Intergenic
950273795 3:11641225-11641247 TTTAAAAATTAAGATGCGGATGG - Intronic
950873822 3:16251936-16251958 TTTTAAATTGATGATGAGGAAGG + Intergenic
950901988 3:16506178-16506200 TTTAAGCAAAATCATGAGGAAGG + Intronic
951267641 3:20588295-20588317 TTAAAACAAAATCATGAGGATGG - Intergenic
951283700 3:20783233-20783255 CTCCAAAAACATGAGGAGGAGGG + Intergenic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951620481 3:24596015-24596037 TTTGCAAAACATGACAAGGAGGG + Intergenic
951661255 3:25069056-25069078 TTTAAAAACCATGATGAGTATGG - Intergenic
951782036 3:26374400-26374422 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
952132324 3:30379414-30379436 TTTCAAAAAATAGATGAGGACGG - Intergenic
952294981 3:32053676-32053698 ATTAAAAAAAATAATGAGGATGG + Intronic
952548022 3:34443831-34443853 TTTAAAATATATGTAGAGGAGGG - Intergenic
952765160 3:36946747-36946769 TTTAAAAATCCTGATGTGGCTGG - Intergenic
953224607 3:41006166-41006188 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
953394166 3:42553941-42553963 TTTGGAAGACATGATAAGGAGGG - Intronic
953459444 3:43070966-43070988 TTTAAAAAAAATAATGAGGTGGG - Intergenic
953602072 3:44376790-44376812 TTTAAAAAACATGATTTGGCCGG + Intronic
953809637 3:46100975-46100997 TTTAAGGAAGTTGATGAGGAAGG - Intergenic
954348314 3:50020072-50020094 TTTAAAAAACTAGATGGGTATGG - Intronic
954990465 3:54836565-54836587 TTCTAAAATCATGATGAAGAAGG - Intronic
955578372 3:60391376-60391398 TTTAAAAACATTGATGAAGAAGG - Intronic
955584926 3:60466908-60466930 TTTCATAAAACTGATGAGGAAGG - Intronic
955886428 3:63603886-63603908 TTTCAAAAAATTGAGGAGGAAGG - Intronic
955961523 3:64345826-64345848 TTTTAATTACATGATGAGGCTGG - Intronic
956170000 3:66425565-66425587 TTTACAAAAAAGGGTGAGGATGG + Intronic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
957021589 3:75134352-75134374 TTAAAAAAACATCAAGAAGAGGG + Intergenic
957023832 3:75156198-75156220 TTTCAAAAAAATGATAAGTAAGG + Intergenic
957118352 3:76056433-76056455 TTTAAAAGGCATGATCATGATGG + Intronic
957258769 3:77873069-77873091 TTTTCAAAATAGGATGAGGAGGG + Intergenic
957265016 3:77952088-77952110 TTTATAAAAGATGACAAGGAAGG - Intergenic
957881736 3:86223669-86223691 TCTAAAAAAACTGAAGAGGAGGG + Intergenic
957950736 3:87122771-87122793 TTAAAAAAACAAAATAAGGAAGG + Intergenic
957961949 3:87267758-87267780 TTTAAAAAAGTAGATGAGCATGG - Intronic
957985206 3:87565591-87565613 TTTAAAAAAAATAATGATTAAGG - Intergenic
958059440 3:88460789-88460811 TTTATTAAACATTTTGAGGATGG + Intergenic
958123636 3:89326828-89326850 TTAAAAAAACAGAAAGAGGATGG - Intronic
958825883 3:99030422-99030444 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
958960023 3:100500795-100500817 TTTAAAAAAAATGACCAGCAAGG + Intronic
959012382 3:101093056-101093078 TTCAAAAGACATTATGAAGATGG + Intergenic
959098178 3:101979566-101979588 TTTAAAAAAAATAATGCAGAAGG + Intergenic
959163798 3:102751145-102751167 TTTAAAAAATATGGATAGGATGG + Intergenic
959519842 3:107313022-107313044 TTGCAAAAACTTGAGGAGGAAGG - Intergenic
959679951 3:109083618-109083640 TTCAAAAAAACTGAAGAGGAAGG + Intronic
959881740 3:111451291-111451313 TTTCAAAAACTTGAGGAGGAGGG + Intronic
959977910 3:112482795-112482817 TTTCAAAAAAATGAAGAGAAAGG + Intronic
960039025 3:113130497-113130519 AACACAAAACATGATGAGGAGGG + Intergenic
960205602 3:114893713-114893735 TGAAAAAAAAAAGATGAGGAAGG + Intronic
961206939 3:125091524-125091546 TATCACAAACATGATGAGAAGGG + Exonic
961246993 3:125463098-125463120 TTCAATAAACTTGATGAGGCAGG - Intronic
961248119 3:125474610-125474632 TTTAAAAAATTTCATGAGGCTGG - Intronic
961417484 3:126770862-126770884 TTTCAAAAAATTGAGGAGGAGGG - Intronic
961683530 3:128614648-128614670 TTTAGAAATCATAATGAGGCCGG + Intergenic
961863841 3:129939180-129939202 TTTAAAAACCCTGATGTGGGTGG - Intergenic
962470141 3:135699746-135699768 TCTTAAAAACATGATGCTGAGGG - Intergenic
962869387 3:139475023-139475045 TCTAAAGAACATGAAGAGGCCGG + Intronic
963363763 3:144308749-144308771 AATAAAAAAGTTGATGAGGAAGG - Intergenic
963516900 3:146320306-146320328 TTTCAAAAAGTTGAGGAGGAGGG + Intergenic
963840277 3:150097663-150097685 TTAAGAAAACAAGATGAGTAAGG + Intergenic
963967581 3:151389957-151389979 TTTAAAAAACTTTATGTTGAAGG + Exonic
964244963 3:154641241-154641263 ATTAAAAAACAATATGAGAAGGG + Intergenic
964388285 3:156172592-156172614 TTTAAAAAAGGGAATGAGGATGG + Intronic
965098832 3:164271391-164271413 TTTAAAAGAGCTGAAGAGGATGG + Intergenic
965873445 3:173287846-173287868 GTTAAAAAACAAATTGAGGAGGG - Intergenic
965900209 3:173630730-173630752 TTAAGAAAACATGTTAAGGAAGG - Intronic
965928084 3:174007851-174007873 TTGCACAAACATGATGAGGCTGG + Intronic
965956081 3:174371452-174371474 GTTCAAAAAAATGAAGAGGAAGG + Intergenic
966102559 3:176289678-176289700 TTTAAAAAAAATATTGAGGATGG - Intergenic
966605198 3:181814499-181814521 TTTTAACAACTTGATGAGGTAGG + Intergenic
967006234 3:185385525-185385547 TCCAAAAAAAATGAAGAGGAGGG + Intronic
967039755 3:185680410-185680432 TTCCAAAAAAATGAAGAGGAGGG + Intronic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
967709708 3:192692104-192692126 TTTAAAATAGATGAATAGGATGG - Intronic
967792975 3:193568752-193568774 CTTAAAAAAATTAATGAGGATGG + Intronic
968315311 3:197719178-197719200 GTTAAAGAACATCATGAGGCTGG + Intronic
968325199 3:197807515-197807537 ATTTAAAAACATGATGCGGCCGG - Intronic
968362485 3:198157230-198157252 TTTGAAAAACCTGCTGAGGCCGG - Intergenic
969178218 4:5416265-5416287 TTCAAGAAACATGACAAGGAAGG - Intronic
969588880 4:8109971-8109993 TTTAATAAAGATGGTGGGGAGGG + Intronic
970352491 4:15217003-15217025 TTTATTCAACATGATCAGGATGG - Intergenic
970744415 4:19277942-19277964 CTTACAAAACATGAAGAAGATGG - Intergenic
970860942 4:20701550-20701572 ATTAAATAACATGTAGAGGATGG - Intronic
971061463 4:22976687-22976709 TTAAAACAACATTATGAGAAAGG - Intergenic
972068892 4:34989397-34989419 ATTCAAAAATAAGATGAGGAGGG - Intergenic
972121330 4:35708140-35708162 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
972375372 4:38464872-38464894 TATACAAAAGAGGATGAGGATGG + Intergenic
972434496 4:39019442-39019464 TCTAAAAAACAATATGAGCAAGG - Intronic
973036210 4:45410643-45410665 TTTTAAAAACATAATGGGGCTGG - Intergenic
973310103 4:48700346-48700368 TGAAAAAAACCTGATGAGGTGGG - Intronic
973877664 4:55236431-55236453 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974297191 4:60016059-60016081 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
974501890 4:62715636-62715658 TTTCAAAAAATTGAAGAGGACGG - Intergenic
975793246 4:77978367-77978389 CTTAAAAAAATTGAAGAGGAAGG + Intergenic
975908465 4:79243293-79243315 TTAAAAAATGAAGATGAGGAAGG + Intronic
975918322 4:79351710-79351732 TTCAAAAAAATTGAAGAGGAGGG + Intergenic
976025024 4:80676491-80676513 TTCAAAAAAATTGAAGAGGAGGG - Intronic
976158266 4:82171250-82171272 TTTAAAACAAATGATATGGAGGG - Intergenic
976411394 4:84717093-84717115 TTTTAAACACATGAACAGGATGG + Intronic
976475512 4:85478019-85478041 TTGGAAAAACAAGATGGGGAAGG + Intronic
976586804 4:86807510-86807532 TTTAAAATGCATGATATGGATGG + Intronic
976814890 4:89136828-89136850 TTTAACAATCATCATGAGCAAGG + Intergenic
977001782 4:91513497-91513519 TTCAAAAAAACTGATGAGGAGGG - Intronic
977304572 4:95306495-95306517 TATAAAATACATGAAGAGGCAGG - Intronic
977846132 4:101769640-101769662 TTATAAAAACTTGAGGAGGAGGG - Intronic
977948300 4:102939510-102939532 TTCCAAAAAAATGAGGAGGAAGG + Intronic
978278953 4:106986272-106986294 TTTATAAAACATGAAGAAGGAGG - Intronic
978429086 4:108614661-108614683 TTTAAATGAGATGATTAGGATGG + Intergenic
978609368 4:110520557-110520579 TGTAAAGAACAGGATGCGGATGG - Intronic
979303927 4:119120452-119120474 TTAAAAAATCAAGATGAAGATGG + Intergenic
979792882 4:124808270-124808292 TTAAAAATACATTATGAGGCTGG + Intergenic
980124050 4:128756508-128756530 TTAAAAAAACAGTATAAGGATGG + Intergenic
980328328 4:131377439-131377461 TTTAAAAAAGAAGAAGAGCATGG - Intergenic
980815219 4:137938540-137938562 TTTCAAAAAAGTGAAGAGGAAGG + Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
980997394 4:139793058-139793080 TTTAAGAATGCTGATGAGGATGG + Intronic
981067058 4:140496956-140496978 TTTATAGAAAATGAAGAGGAGGG + Intronic
981520293 4:145654261-145654283 TTTAAAAATCATGACAAAGACGG + Intronic
982010057 4:151097914-151097936 TTTTAAAAAGATGATTAAGATGG - Intergenic
982208330 4:153014535-153014557 TTCAAAAGACATAATCAGGAAGG - Intergenic
982306620 4:153938890-153938912 TTTTAAAAACCTTAAGAGGAAGG - Intergenic
982526274 4:156483239-156483261 TTTTAAAATCAAGAAGAGGAAGG - Intergenic
982692237 4:158561922-158561944 TTTAAAATACAGGTTGAGGCCGG - Intronic
982866666 4:160521768-160521790 TTTAAATACCATGATGTAGAAGG - Intergenic
982879275 4:160690588-160690610 TTTCAAAAAATTGAAGAGGAAGG + Intergenic
982917888 4:161236270-161236292 TTTAAAAAACAAGATGACAGAGG + Intergenic
982939634 4:161533680-161533702 TTCAAAAAAATTGAGGAGGAGGG + Intronic
983419866 4:167503476-167503498 TCCAAAAAAAATTATGAGGAGGG - Intergenic
983443063 4:167812957-167812979 TTTAAGAAAGAAGATGAGGAAGG - Intergenic
983813053 4:172088292-172088314 TGTAATAAATATGATGAAGAGGG - Intronic
983876766 4:172886078-172886100 TTTCAAAAAATTGAAGAGGAGGG - Intronic
984054188 4:174905811-174905833 TTTAAAAAATTTCAAGAGGAAGG - Intronic
984096765 4:175444463-175444485 ATAAAAAAAGATCATGAGGAGGG + Intergenic
984321705 4:178205677-178205699 TTTAAAGAACATTTTGAGAAAGG + Intergenic
984643359 4:182195354-182195376 TTTAAAAAATATCTTGAGGCTGG + Intronic
984913082 4:184693521-184693543 TTTAAAAAACAAGATGAAGCAGG - Intronic
985435253 4:189924103-189924125 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986083820 5:4422230-4422252 TTTAAAAATCATTATGAAGAGGG - Intergenic
987374723 5:17223141-17223163 TTTAGAAAGCATGATTTGGAGGG + Intronic
987527548 5:19072753-19072775 TTTAAAAAATAAGATGACAATGG + Intergenic
987894536 5:23927095-23927117 TTTTAAAAAAATGATAAAGAGGG - Intergenic
987989773 5:25195360-25195382 TTTAAGAAATATGATGAGTAGGG - Intergenic
988542691 5:32126013-32126035 TTTTAAAAACAGAAAGAGGAAGG + Exonic
988897354 5:35692092-35692114 TTTAAAAAACGTGATAAGGCTGG - Intronic
989010010 5:36859682-36859704 TTTAAAAACCATGAAGTGGCAGG - Intergenic
989573037 5:42962838-42962860 TTTAAAAAAAATGGTGGGGGGGG + Intergenic
989764332 5:45062300-45062322 TTTAAAAATTATGCTGAGCATGG + Intergenic
990215299 5:53524921-53524943 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
990606571 5:57416692-57416714 TTTAAAGAACATGATTATTAAGG + Intergenic
990842821 5:60103256-60103278 TTCAAAACAAATGATGATGATGG + Intronic
990898033 5:60720160-60720182 TTCAAAAAAATTGAGGAGGAAGG + Intergenic
991567660 5:68021163-68021185 TTCAAATAACATTATGAGAAAGG - Intergenic
991644239 5:68785671-68785693 TTTAGAAGAGATGATGAGGGTGG - Intergenic
991645083 5:68793346-68793368 TTAGAAAAAAATGTTGAGGAAGG - Intergenic
991960842 5:72042611-72042633 TTTAAAAAACCAGCTGAGTATGG - Intergenic
992016897 5:72584424-72584446 TTTTAATAACATGATCTGGATGG + Intergenic
992032533 5:72736809-72736831 TTTCAAAAAATTGAGGAGGAAGG - Intergenic
992111928 5:73502623-73502645 TTTAAAAAACAAGATTTGGCTGG + Intronic
992225100 5:74612587-74612609 TTTTAAAAAAATGTTGAGGCAGG - Intergenic
992382578 5:76252908-76252930 TTTTAATAACATGAAGTGGAGGG - Intronic
992811177 5:80390187-80390209 TTTAAAAATCAGGGAGAGGAGGG - Intergenic
992857011 5:80872116-80872138 TTTAAATAACAGGATTAAGATGG - Intronic
993148133 5:84122696-84122718 ACTATAAAAAATGATGAGGAGGG + Intronic
993688358 5:90968729-90968751 TTTTAAAAACATTATGTAGAAGG + Intronic
993692090 5:91014410-91014432 TTCAAAAAAATTGAGGAGGAAGG - Intronic
993923719 5:93839556-93839578 TCCAAAAAAATTGATGAGGAAGG - Intronic
993941718 5:94066791-94066813 TTCCAAAAAAATGAAGAGGAGGG + Intronic
994134499 5:96269857-96269879 TTTAAAAAAATTGAGAAGGAGGG + Intergenic
994152608 5:96465760-96465782 TTTAAAAATCATGATGGATATGG + Intergenic
994236906 5:97373497-97373519 TTTCAAAAATTTGAGGAGGAGGG + Intergenic
994262391 5:97675243-97675265 TTTCAAAAAAATGAGGAGAAGGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
994356641 5:98800696-98800718 TTTAAAAACCATGATATGAAAGG - Intergenic
994409011 5:99382668-99382690 TTTCAAAAAATTGAGGAGGAGGG + Intergenic
994865696 5:105266788-105266810 TTTAAAGAACACGATCATGACGG - Intergenic
994899327 5:105749806-105749828 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
995017735 5:107330774-107330796 TGGAAATTACATGATGAGGAGGG - Intergenic
995099546 5:108282129-108282151 TTTCAAAAAATTGAGGAGGATGG + Intronic
995147412 5:108802211-108802233 TTTAAAAAAAATGATTGGTAAGG - Intronic
995162060 5:108993688-108993710 TTTCAAATACAAGTTGAGGATGG + Intronic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995455858 5:112351570-112351592 TTTCAAAAACCTGAAGAGGAGGG + Intronic
995516822 5:112962536-112962558 TTTAAAAAACTTGATTAGCTGGG - Intergenic
995734841 5:115288826-115288848 CTTAAAAAATAGGATGAGGTGGG + Intronic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
996068209 5:119103975-119103997 AATAAAAAACTTGATGAAGAAGG + Intronic
996861839 5:128076032-128076054 TTTTAAAAACATGAGTATGAAGG - Intergenic
997183916 5:131861985-131862007 TTTCAAAAAGTTGAAGAGGAGGG - Intronic
997222229 5:132178888-132178910 TTTAGAAATCATCATGAGGCTGG + Intergenic
997811321 5:136973267-136973289 TTTAAAAAATAGGTTGAGGCTGG - Intergenic
997884547 5:137618354-137618376 TTTAAAAACCATGATGCAAATGG + Exonic
998039065 5:138939713-138939735 TTTAAAAAATATGTTGAGGTCGG - Intergenic
998292064 5:140925709-140925731 TTTAGAAAACACCATGAGGCAGG - Intronic
998580826 5:143373926-143373948 TTTAAAAAATATGATGCCTATGG + Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998652821 5:144140720-144140742 TTAAAATAACATCATTAGGATGG + Intergenic
998735836 5:145139418-145139440 CTTAAGAAAATTGATGAGGAGGG - Intergenic
998859089 5:146425466-146425488 CTGAACAAACCTGATGAGGAGGG + Intergenic
999109154 5:149102280-149102302 TTCCAAAAACTTGAAGAGGACGG + Intergenic
999649607 5:153752454-153752476 TTTACACAAGATGATGATGATGG + Intronic
999783555 5:154870716-154870738 TTTCAGAAGCATGAAGAGGAAGG + Exonic
999943851 5:156573987-156574009 ATTAAAGAACAGGATGGGGATGG - Intronic
1000250754 5:159492480-159492502 TTTAAAAAACATATTGAAAAGGG + Intergenic
1000395263 5:160768157-160768179 TTTAAAATTCATGATGATGATGG - Intronic
1000479532 5:161754611-161754633 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1000581882 5:163044999-163045021 TTCCAAAAACATGAGGAGAAGGG + Intergenic
1000805303 5:165783186-165783208 TTTAAAAAGCATTCTGGGGATGG + Intergenic
1001800133 5:174535991-174536013 GTTAAACAAGATGATGAGTAGGG - Intergenic
1001846044 5:174922471-174922493 TTTAAAACACAAGTTGAGGCCGG + Intergenic
1002123805 5:177026305-177026327 CTTCAGAAACAAGATGAGGAAGG - Intronic
1002361863 5:178678536-178678558 TTCAAAACACATGATGAAAATGG - Intergenic
1002661896 5:180797040-180797062 TTTATATAACAGGATGGGGATGG + Intronic
1003038378 6:2664879-2664901 TTTAAAAATCAGGGAGAGGAGGG - Exonic
1003366125 6:5476625-5476647 TTTATAAAATATCATGGGGAGGG + Intronic
1003633858 6:7813485-7813507 TTTAAAAAACTAGCTGAGCATGG + Intronic
1004231519 6:13837949-13837971 TTTAAAGAAAATGATAAGGAAGG - Intergenic
1004444849 6:15688309-15688331 TTTAAAAAAAATCATTAGGTCGG - Intergenic
1004599667 6:17136152-17136174 TCCAAAAAAAATGAGGAGGAGGG + Intergenic
1004759684 6:18652782-18652804 ACTAAAAAACATGATTAAGAAGG + Intergenic
1005056015 6:21729326-21729348 TTTAAAAAAAATGTTCAAGAAGG + Intergenic
1005258645 6:24032707-24032729 TTTAAAAAGCTTTATTAGGATGG - Intergenic
1005304423 6:24499415-24499437 TTAAAAAAAGAAAATGAGGAAGG - Intronic
1005400821 6:25432227-25432249 TTTATATAAAATCATGAGGATGG + Intronic
1005766747 6:29018452-29018474 TTAAAAAAAATTGAAGAGGAGGG - Intergenic
1005880359 6:30053422-30053444 TTAAAAAAAACTGAAGAGGAAGG + Intergenic
1008067700 6:47067778-47067800 TTTTAAAAAAATCATGAAGAGGG - Intergenic
1008119469 6:47595402-47595424 TTTAAAAAGCATGATGGTGAAGG - Intronic
1008327090 6:50195596-50195618 TTTAAAAAAAATGATTAAAAAGG + Intergenic
1008938366 6:57017759-57017781 TTTAAAAACCATAAATAGGATGG - Intronic
1008980421 6:57476907-57476929 TTTAAATCACATAATGAGGCTGG - Intronic
1009168527 6:60369851-60369873 TTTAAATCACATAATGAGGCTGG - Intergenic
1009368288 6:62872931-62872953 TTTAAAAACCAGGTTGAGAAAGG + Intergenic
1009370081 6:62888728-62888750 TTTAAAAAGCAAGATTTGGAAGG - Intergenic
1009446478 6:63748521-63748543 TTCCAAAAAATTGATGAGGAGGG - Intronic
1009549391 6:65067774-65067796 TTTTAAAAACATGGTGAGTTTGG - Intronic
1010104725 6:72153703-72153725 TTTAGAAAACATTCAGAGGAGGG + Intronic
1010201475 6:73285908-73285930 TTTAAAGAACAAGCTGGGGATGG - Intronic
1010229609 6:73522964-73522986 TTTAAAAAACATTCTGTGTAAGG - Intronic
1010403341 6:75473864-75473886 TTTGAAAACCATGATCATGAAGG - Intronic
1010484180 6:76390034-76390056 TTTATAAAAGATGTTGAGGCTGG - Intergenic
1010544059 6:77127988-77128010 TCCAAAAAAAATGAAGAGGAAGG + Intergenic
1010638372 6:78288416-78288438 TTTAAAAAAACTGAAGAGGAGGG - Intergenic
1010767689 6:79795041-79795063 TTTAAAAAACATGAAGTGATAGG - Intergenic
1010965434 6:82200895-82200917 TTTAAAAAACATCTTTAGGCTGG - Intronic
1011208599 6:84929755-84929777 GTTAAAAAACATTGTAAGGATGG - Intergenic
1011359015 6:86501984-86502006 CTTAAACAACATGATGTGCAAGG - Intergenic
1011411308 6:87069417-87069439 CTTAAAAAAAATAATGAGGCTGG + Intergenic
1011928265 6:92675258-92675280 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1012282713 6:97347929-97347951 CTTAAAAAACAAGATTAAGAGGG + Intergenic
1012337709 6:98081641-98081663 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1012383733 6:98652666-98652688 TTTAAAAAAAAAAAAGAGGAAGG + Intergenic
1012765316 6:103359964-103359986 TTCAAAAAAAATCAAGAGGAAGG + Intergenic
1012793595 6:103733518-103733540 TTTAAAAAACAGGATCATCATGG + Intergenic
1012845987 6:104389368-104389390 TTCAAAAAAATTGAAGAGGAAGG + Intergenic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013340462 6:109209958-109209980 TTCCAAAAACATGAAAAGGAGGG - Intergenic
1013477675 6:110524169-110524191 TTTTAAAAACCTGATGATGAGGG - Intergenic
1013654581 6:112232390-112232412 CTTAAATAACATGAAAAGGATGG - Intronic
1013876878 6:114842322-114842344 TTTCAAAAAATTGAGGAGGAAGG + Intergenic
1013886783 6:114976928-114976950 TTTAAAAAAAATAATGATGTGGG - Intergenic
1013968929 6:115991805-115991827 TTCAAAAAAATTGAGGAGGAGGG - Intronic
1014158777 6:118142237-118142259 TTTAAAAAAGACAATGATGAGGG - Intronic
1014562802 6:122911690-122911712 TTCCAAAAACTTGAAGAGGAGGG - Intergenic
1015267639 6:131304570-131304592 TTTAAAATACATAATTAGCAAGG - Intergenic
1016394947 6:143613924-143613946 GTTAAGAAACATGCTGAGGCCGG + Intronic
1016902018 6:149112525-149112547 TTTAAAGACCATGAAGATGAGGG - Intergenic
1017026045 6:150181580-150181602 TTAAAAAAACATTATGTGCAAGG - Intronic
1017247328 6:152240492-152240514 TTTCAAAAACATTAGTAGGATGG - Intronic
1017515816 6:155154867-155154889 TTTTAAAATCATAAAGAGGACGG + Intronic
1017615016 6:156237288-156237310 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1017674800 6:156801493-156801515 TTCAAAAACAATGATGAGGCCGG - Intronic
1018132345 6:160744194-160744216 TTCAAAAAAACTGAGGAGGAGGG - Intronic
1018405757 6:163480436-163480458 CTTAAAAGACATGAGGCGGAGGG - Intronic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1019095457 6:169575789-169575811 TTTAAACAACATTATGTGTAGGG + Intronic
1019456669 7:1131250-1131272 TTTAAAAAGCATGATCATCATGG + Intronic
1019999332 7:4746217-4746239 TTTAAAAATCATGATTAAAAGGG - Intronic
1020092864 7:5351046-5351068 CTAAAAAAACATGATGATGCTGG + Intronic
1020245596 7:6426810-6426832 TTTAAAAAACAAAAAGAGGCCGG + Intronic
1020580763 7:9997458-9997480 TTCCAAAAACCTGAAGAGGAAGG + Intergenic
1021182571 7:17524951-17524973 TTCAAAAGAGATGATGAGTAAGG + Intergenic
1021256665 7:18400570-18400592 TTGAAAAGACTGGATGAGGAAGG + Intronic
1021446983 7:20744326-20744348 TTTAAAGAACATGAGGAGACTGG - Intronic
1021689238 7:23216164-23216186 TTTAAAAAAGAGGAAGAGGGTGG + Intergenic
1021976643 7:26017709-26017731 TTCCAAAAAATTGATGAGGAGGG - Intergenic
1021981513 7:26059899-26059921 TTTTAAAAACAGGATCAAGAGGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023112897 7:36832134-36832156 TTTAACAAAGATAATGATGAAGG + Intergenic
1023121768 7:36916423-36916445 TTTATAAAACCTGATAAGGTAGG - Intronic
1023520814 7:41048494-41048516 TTTAAAAAATATGATGTGCTTGG + Intergenic
1024117498 7:46207733-46207755 TTTTAAAAACCTTATGAGGCAGG + Intergenic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1026287871 7:68979377-68979399 TTGAGAAAACATGATGAGTCTGG + Intergenic
1026509191 7:71014239-71014261 TTAGAAACACATGAAGAGGAAGG - Intergenic
1026922269 7:74164707-74164729 TTTAAAAAACATGAGGGAGCGGG + Intergenic
1027357043 7:77367736-77367758 TTTCAAAAAATTGAGGAGGATGG - Intronic
1028230436 7:88301040-88301062 TTTAAAATACGTGCTGGGGATGG - Intronic
1028387283 7:90270510-90270532 TTTAAAAAGTAAGAAGAGGAAGG - Intronic
1028567732 7:92251262-92251284 TTTAAAATCCATGAAGAGAAGGG + Intronic
1029226458 7:99032370-99032392 TTTAAAAAATAACATGAGGCCGG + Intronic
1029942391 7:104494500-104494522 TTTATTAAAGATGATGAAGAAGG - Intronic
1030091399 7:105862009-105862031 TCTGCAAAAGATGATGAGGAAGG + Intronic
1030462676 7:109860114-109860136 TTTAAAAAAAATGATGATGATGG - Intergenic
1030601720 7:111600850-111600872 TTGAAAAAACATTATTAGCATGG + Intergenic
1031196009 7:118614682-118614704 ATTAAGGAACATGATGAAGAGGG + Intergenic
1031429142 7:121644776-121644798 TTGAGAAAAAATCATGAGGAAGG + Intergenic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1031967916 7:128041291-128041313 TTTAAAAAATAAGAGGTGGAGGG + Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032236842 7:130131980-130132002 TTTAAAAACTAGCATGAGGAAGG + Exonic
1032642726 7:133787754-133787776 TTTATATAAGATTATGAGGATGG - Intronic
1032726922 7:134598602-134598624 TTCCAAAAAAATGAGGAGGAAGG - Intergenic
1032775307 7:135106748-135106770 TTTCAAAAAGCTGAGGAGGAGGG - Intronic
1032828868 7:135601811-135601833 TTTTAAAAATATTATGAGGTGGG - Intronic
1032965876 7:137096833-137096855 TTCCAAAAAAATGAGGAGGAAGG + Intergenic
1033120980 7:138666143-138666165 TTTTAAAGACAAAATGAGGAAGG - Intronic
1033166480 7:139042835-139042857 ATTAAAAAAGATAATGAGGCCGG + Intergenic
1033612688 7:142980779-142980801 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1033819149 7:145112580-145112602 TCCAAAAAAACTGATGAGGAGGG - Intergenic
1035007021 7:155672199-155672221 TTTAAAAACCTTAATGAAGAAGG - Intronic
1035086938 7:156268221-156268243 ATTGAAAAACATGAAGATGATGG - Intergenic
1035223443 7:157420286-157420308 ACAAAAAAACATGATGGGGAGGG - Intergenic
1035310752 7:157966909-157966931 TTTAAAAATGATGATGAGAGTGG - Intronic
1035987234 8:4447929-4447951 TTTAAAAAATATGGTGAGTGTGG - Intronic
1036035629 8:5015483-5015505 TTTCAAAAACATGACGTGAAAGG - Intergenic
1037119826 8:15269442-15269464 TTCCAAAAAAATGAAGAGGAAGG + Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037862100 8:22412646-22412668 TTTAAAAAACATCATCAGCCGGG + Intronic
1037956221 8:23062064-23062086 TTTCAAAAACTTGAAGAGAAGGG - Intronic
1038913868 8:31997896-31997918 TTTAAATAACTTGCTCAGGAAGG + Intronic
1038996875 8:32933148-32933170 TTAAAAAAACATGATTGAGACGG - Intergenic
1039557854 8:38489556-38489578 TTTAAAAAACATCCTGAAGTTGG + Intergenic
1039627543 8:39069561-39069583 CTTAAAAAACCTTATGAGGAAGG + Intronic
1040961855 8:53042736-53042758 TTCCAAAAACTTGAGGAGGAGGG - Intergenic
1041180003 8:55237218-55237240 TTTAAAAAACATGAGGGTTAGGG + Intronic
1041372407 8:57176022-57176044 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1042253518 8:66780444-66780466 AATAAACAACATGATGAGGGAGG + Intronic
1042319874 8:67463520-67463542 TTTAAAATAAATGTTGGGGAAGG - Intronic
1042390287 8:68226603-68226625 TTTTTAAAACATCAAGAGGATGG - Intronic
1042789379 8:72586813-72586835 TTTAAAAAATGTGATGTGGTTGG - Intronic
1043240245 8:77924474-77924496 TTTCAAAAAAATGAGGAGGAGGG + Intergenic
1043293679 8:78637305-78637327 TCTAAAAAAAATGATGGTGAAGG - Intergenic
1043320073 8:78973453-78973475 TTTAAAAAATATGATGCTTATGG + Intergenic
1043351226 8:79363078-79363100 TTTAAAAAACTTGCTGGGCATGG - Intergenic
1043497535 8:80818971-80818993 TTTAAAAAAAATGATGATGAGGG - Intronic
1043587576 8:81786855-81786877 TTTAAAAAATCTGTTGAGGCTGG - Intergenic
1043587578 8:81786871-81786893 TTTTAAAAAGATGTTGAGCAAGG + Intergenic
1044196389 8:89381430-89381452 TTTTAAAAAAATGAGAAGGAAGG - Intergenic
1045124586 8:99075020-99075042 TTCCAAAAAAATGATGAGAAGGG - Intronic
1045249253 8:100469427-100469449 TTTAAAAAAAAAGAAGAAGAAGG - Intergenic
1045622852 8:104002979-104003001 TTGAACAAACATGTTTAGGATGG + Intronic
1045673084 8:104578493-104578515 TTCAAAAAAATTGAAGAGGAAGG + Intronic
1045791242 8:105987289-105987311 CTTAAAAGACAGGATGATGAGGG + Intergenic
1045821513 8:106343841-106343863 TTAAAACAACATCATGAGGAAGG + Intronic
1045878789 8:107014216-107014238 TATAAAAAATATAATCAGGAGGG + Intergenic
1045909762 8:107393506-107393528 TTTAAAAAAAATTAGGGGGATGG + Intronic
1045961748 8:107976791-107976813 TTTAAAAGAAAGGAAGAGGAGGG - Intronic
1046243000 8:111523346-111523368 TTTTAAAAAATTGAAGAGGAAGG - Intergenic
1046301509 8:112298571-112298593 TATAAAACACATAATGATGAAGG + Intronic
1046450013 8:114376693-114376715 TTCAAAAAAATAGATGAGGAGGG + Intergenic
1046479973 8:114803010-114803032 TTTAAAAAAAAGGATTTGGATGG - Intergenic
1046656073 8:116896392-116896414 TTCAAAAAAACTGAAGAGGAAGG + Intergenic
1047160433 8:122371720-122371742 TTTGTAGAACAAGATGAGGAGGG + Intergenic
1047536628 8:125726149-125726171 TTGAATAAACATGAAAAGGAAGG - Intergenic
1048108151 8:131435194-131435216 TTTAAAAAACATTATTTGAATGG + Intergenic
1048203641 8:132398098-132398120 TTTAAAAAAATTGCTGTGGATGG - Intronic
1048449750 8:134523106-134523128 TTTAAAAAACTTCAGGATGATGG - Intronic
1048695833 8:137026728-137026750 TATAAATAACATTATGAGAAAGG + Intergenic
1048760959 8:137794744-137794766 TTTAACAAACATGGTGAGTCAGG - Intergenic
1048891326 8:138951029-138951051 GCTCAAAAACATGATAAGGATGG + Intergenic
1049568851 8:143358951-143358973 TTTAAAAAACATGAACATGATGG - Intronic
1049854801 8:144854562-144854584 TCTAAAAACCATGCTGAGGGAGG + Intergenic
1050164765 9:2753430-2753452 TTTCAAAAAATTGAGGAGGAAGG + Intronic
1050661771 9:7890910-7890932 TTTAAAAAATCTGTTGAGGCTGG - Intergenic
1050675662 9:8049968-8049990 TTTGAAAAAACTGAGGAGGAGGG - Intergenic
1050782911 9:9361457-9361479 TTTAAAAAACACTATGAACAAGG - Intronic
1050916112 9:11135869-11135891 TTTAAAACACATTTTGAGGTTGG - Intergenic
1051036426 9:12751884-12751906 TTTAAAAAACAGGCTGAGCATGG - Intergenic
1051189032 9:14491841-14491863 TATCAAAATCATGATGATGAAGG + Intergenic
1051317287 9:15854137-15854159 TTGAAAAAAAATGAAGAGAAGGG - Intronic
1051643086 9:19241725-19241747 TTTAAAAAACATAAGTAGAACGG + Intronic
1052385154 9:27813899-27813921 TTCTAAAAACTTGAAGAGGAAGG + Intergenic
1052437924 9:28453863-28453885 TTTAAAAAAAATCATTTGGATGG + Intronic
1052584633 9:30410933-30410955 TGTCAAAAACTTGAAGAGGAAGG - Intergenic
1052836525 9:33254293-33254315 TTTAAAAACAATGATGGGGTGGG + Exonic
1053388276 9:37713171-37713193 TTTAAAAAGGATAATGAGGATGG + Intronic
1053580592 9:39400027-39400049 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1053724262 9:40981567-40981589 TTTCAAAAAAATGAAAAGGAGGG + Intergenic
1053845087 9:42228074-42228096 TTCAAAAAAATTGAGGAGGAGGG + Intergenic
1054102179 9:60958832-60958854 TTCAAAAAAGTTGAGGAGGAGGG + Intergenic
1054341707 9:63870434-63870456 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1054584180 9:66948031-66948053 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1055131623 9:72781918-72781940 TTTCAAAAACTTGAGGAGGAGGG + Intronic
1055229760 9:74048558-74048580 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1055692944 9:78853283-78853305 ATTAAAAAATATGAAGAAGAAGG - Intergenic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1056340507 9:85626551-85626573 TTTAAAAAATACATTGAGGATGG - Intronic
1056885858 9:90443116-90443138 TTTAAAAAAGATGATGAGCCGGG + Intergenic
1057113749 9:92500868-92500890 TTTAACAAACTTGCTGATGATGG - Exonic
1057301209 9:93884541-93884563 ATCAAAAAACATTATGAAGAGGG + Intergenic
1057446392 9:95118312-95118334 TTTAAAAACCATGCTGAGCCAGG - Intronic
1057449118 9:95141011-95141033 TTAAAAAAACAGGATGTGGCTGG + Intronic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057615399 9:96585180-96585202 TTTAAAGAAAATGGTGTGGAAGG + Intronic
1058101553 9:100922936-100922958 TTTGAAAAAATTGAGGAGGAGGG + Intergenic
1058302623 9:103395151-103395173 TTCAAAAAAATTGAGGAGGAGGG - Intergenic
1058316711 9:103576993-103577015 TTCAAAAAATTTGAAGAGGAGGG + Intergenic
1058467039 9:105239217-105239239 TTTACAAAACAGGATTATGATGG - Intergenic
1058570608 9:106338610-106338632 TTTAAAATACATGAACAGGTAGG - Intergenic
1060106544 9:120876659-120876681 TTTAAAAAGGATGTTCAGGAGGG + Intronic
1060164721 9:121401627-121401649 TTCAAAAAATTTGAGGAGGAAGG + Intergenic
1060761393 9:126252895-126252917 TTCAAAAAACGTGATGCTGAAGG - Intergenic
1060774494 9:126362832-126362854 TTTAAAAAATAAAATGAGGTGGG - Intronic
1061684093 9:132260333-132260355 TTTAAAAAAAATTCTGAGGTCGG - Intergenic
1062317020 9:135972303-135972325 TTTAAATAAAAAGATGTGGATGG - Intergenic
1062542377 9:137047311-137047333 TTAAAAAAAAATGGTGAAGAGGG + Intergenic
1062720424 9:138039344-138039366 TTTAAAAAACAGAATAAGCAAGG - Intronic
1203450538 Un_GL000219v1:110452-110474 TTTCAAAAAAATGAAAAGGAGGG - Intergenic
1186392567 X:9175492-9175514 ATTAAAAAACCTGAGTAGGATGG - Intergenic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1187109600 X:16283114-16283136 TTTAAACACCATGATGGGGCTGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187297292 X:18014098-18014120 TTTAAAAAACATTCTTAGAAGGG - Intergenic
1187519722 X:20002881-20002903 TTTAAAATACATATTGAGGCCGG - Intergenic
1187567865 X:20470245-20470267 TTTAAAAAATATGATAACAATGG + Intergenic
1187620600 X:21049160-21049182 TTCTAAAAAAATGAGGAGGAGGG + Intergenic
1187624651 X:21097038-21097060 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1187641988 X:21301707-21301729 TTTAAAGAAAATGATCAGTATGG - Intergenic
1187649660 X:21388509-21388531 TTCAAAAAACACAATGATGAGGG + Intronic
1187696310 X:21924583-21924605 TTTAAAAATGATGATGATGAGGG - Intergenic
1187852876 X:23608447-23608469 TCTAGAAAACATGTTGAGAAAGG + Intergenic
1187886749 X:23895873-23895895 TTTAAAAAAAAAAAAGAGGAAGG + Intronic
1188739631 X:33762535-33762557 TTCTAAAAACATGAAGAGTAAGG - Intergenic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189283363 X:39834727-39834749 TTTAAAGGACTTGATGAGAAAGG - Intergenic
1189613331 X:42761070-42761092 TTTGAAAAATATGATGAAGAAGG - Intergenic
1190255593 X:48760104-48760126 TTTGAAAAACAGGCTGAGGGTGG - Intergenic
1190886205 X:54532411-54532433 GTTAAAGAACATTATGAGGAAGG - Intronic
1191744532 X:64471710-64471732 TTCCAAAAACCTGAAGAGGAGGG - Intergenic
1192116755 X:68418972-68418994 TTTAAAAAAAAAGAAGTGGAGGG - Intronic
1192296829 X:69858766-69858788 TTTCAAAAAAATGATGAGGAGGG - Intronic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192752011 X:74002948-74002970 TTTATAAAAGTTGAAGAGGAGGG + Intergenic
1193012703 X:76695661-76695683 TTTCAAAAACTTGAAGAGGAGGG + Intergenic
1193032965 X:76919778-76919800 GTTAACAAAGATGATGATGATGG + Intergenic
1193427694 X:81359428-81359450 TTCAAAAACAATGATGGGGATGG - Intergenic
1193493481 X:82180648-82180670 TTTCAAAAAATTGAAGAGGAGGG - Intergenic
1194040490 X:88936239-88936261 TTTCAAAAAATTGAGGAGGAGGG - Intergenic
1194082342 X:89484637-89484659 ATTAAAAAACATAATGAGAGGGG - Intergenic
1194106833 X:89780000-89780022 TTTAAAAAACATGTGGAAGCAGG + Intergenic
1194501121 X:94682444-94682466 TTTAAAAAAAATGTTTAGGCTGG + Intergenic
1194550892 X:95297680-95297702 TTTAATAAAATTGATGAGGAGGG + Intergenic
1194553235 X:95326947-95326969 TTTAAAAAAATTGAGGAGAAGGG - Intergenic
1194810501 X:98382041-98382063 TTTTAAAAACAGGCTGAGTAAGG - Intergenic
1194820072 X:98495043-98495065 TTTAAAATATATGATGAGAGAGG + Intergenic
1195382700 X:104285801-104285823 TTTAAAAAGCAAGATGAAGAAGG + Intergenic
1195567540 X:106360071-106360093 TTCAAAAAATTTGAGGAGGAGGG - Intergenic
1195597462 X:106708757-106708779 TTTAAAAAACTTTAAGAGGAAGG + Intronic
1195636809 X:107126735-107126757 TTTAAAAAACAACAAGAGGCTGG + Intronic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1196144432 X:112301348-112301370 TTTAAACAACCTGATGAGGAAGG - Intergenic
1196349645 X:114711654-114711676 TTTAAAAAACACATTTAGGAAGG - Intronic
1196461069 X:115931720-115931742 TTCAAAAAAAAAAATGAGGAGGG - Intergenic
1196468507 X:115997168-115997190 TTCAAAAAAAATTAGGAGGAGGG - Intergenic
1196666389 X:118321588-118321610 TTTAAAAAAGAAGATGGGGTGGG + Intergenic
1197063139 X:122206345-122206367 TTTAAAAAACATGTGTAGGTAGG + Intergenic
1197518583 X:127469272-127469294 TTTAATAAACATAATGGAGATGG + Intergenic
1197621459 X:128754936-128754958 TTTAGGAAACATCATGAGGTAGG - Intergenic
1197740973 X:129893663-129893685 TTTAAAAAACAGCTTGAGGCTGG - Intergenic
1197815944 X:130498660-130498682 TTTAAAAAATTAAATGAGGAAGG - Intergenic
1198001275 X:132440053-132440075 TTTAAATAACAAGATTGGGAAGG + Intronic
1198230384 X:134683588-134683610 TTGAAAACAGATGATGGGGATGG + Intronic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198629775 X:138623337-138623359 TTCCAAAAAAATGAAGAGGAAGG - Intergenic
1198767525 X:140094280-140094302 CTGAAAAAATATGAGGAGGAGGG + Intergenic
1198825887 X:140697417-140697439 TTTAGAAAAGTTGAGGAGGAAGG - Intergenic
1199324367 X:146479264-146479286 TTTGAAAAATTTGCTGAGGATGG - Intergenic
1199393078 X:147304660-147304682 TTTTAAAAACATTATGAGATTGG + Intergenic
1199605715 X:149577925-149577947 TTTAAAAAAATTCTTGAGGAAGG + Intergenic
1199633406 X:149791443-149791465 TTTAAAAAAATTCTTGAGGAAGG - Intergenic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200435009 Y:3140823-3140845 ATTAAAAAACATAATGAGAGGGG - Intergenic
1200890030 Y:8313448-8313470 TTTAAAAGTCATGATTAGGCTGG - Intergenic
1201384984 Y:13430246-13430268 TTGCAAAAAAATGAGGAGGAGGG - Intronic
1201851220 Y:18483053-18483075 TTTCAAAATCATAATTAGGAGGG - Intergenic
1201882099 Y:18837325-18837347 TTTCAAAATCATAATTAGGAGGG + Intergenic
1202579014 Y:26359496-26359518 TTTACAAAACCTTATGAGGTAGG - Intergenic
1202599137 Y:26574766-26574788 CTGATAAAACATGATGAGCAGGG + Intergenic