ID: 1192312760

View in Genome Browser
Species Human (GRCh38)
Location X:70030077-70030099
Sequence GTGGCCACACAGCTGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192312760_1192312762 13 Left 1192312760 X:70030077-70030099 CCTTGCTACAGCTGTGTGGCCAC 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1192312762 X:70030113-70030135 CACAGCTGCACAGTGCTTGACGG 0: 1
1: 0
2: 0
3: 18
4: 188
1192312760_1192312763 21 Left 1192312760 X:70030077-70030099 CCTTGCTACAGCTGTGTGGCCAC 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1192312763 X:70030121-70030143 CACAGTGCTTGACGGCTTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 80
1192312760_1192312764 22 Left 1192312760 X:70030077-70030099 CCTTGCTACAGCTGTGTGGCCAC 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1192312764 X:70030122-70030144 ACAGTGCTTGACGGCTTGCAGGG 0: 1
1: 0
2: 1
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192312760 Original CRISPR GTGGCCACACAGCTGTAGCA AGG (reversed) Intronic
900000920 1:14518-14540 GAGGCCACACAGCTGGGGCGGGG - Intergenic
900020634 1:185039-185061 GAGGCCACACAGCTGGGGCGGGG - Intergenic
902466943 1:16624267-16624289 GAGGCCACACACCTGCAGTAAGG - Intergenic
902858759 1:19229079-19229101 GTGTCCACACAGCTGTTGATAGG + Intronic
905800484 1:40839275-40839297 GTGGCCACCCAGCAGGAGGAGGG - Exonic
907331577 1:53675359-53675381 GAGGTCACACAGCTCAAGCAGGG + Intronic
907424798 1:54372836-54372858 AGGGCCACACAGCTGGAGAACGG + Intronic
908606367 1:65801222-65801244 GTGGCAAAACAGATGTAGCTTGG + Intronic
909715625 1:78702886-78702908 GTGGCCAAACAGATGCAGCTGGG - Intergenic
910297682 1:85667182-85667204 GTGGTCATACAGCTGTAGACGGG + Intronic
911199838 1:95033251-95033273 GTGGCCACATAACCCTAGCAGGG + Intronic
914676995 1:149913358-149913380 GTGGCCACACTCCCGTAGGATGG + Exonic
914876067 1:151513328-151513350 CTGGCCAAGCAGCTGTAGCCTGG + Intronic
915141549 1:153771432-153771454 GTTGGCCCACAGCTTTAGCAGGG + Intronic
915906427 1:159881415-159881437 GTGGCGACACACCTCTTGCAAGG + Intronic
916205137 1:162308935-162308957 ATGGTCACACAGCTGCTGCATGG + Intronic
920054764 1:203183889-203183911 GAGGCCACACAGCTCTGGGAGGG + Intronic
1066200381 10:33138269-33138291 GAGGCCACAGAGCCCTAGCAAGG + Intergenic
1069788833 10:71006479-71006501 GAGGCCACACAGCTTGGGCAGGG + Intergenic
1071512241 10:86269378-86269400 GAGGCCACACAGCAGGAGCTGGG - Intronic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1076275190 10:129192558-129192580 GTGACAGCACAGCAGTAGCACGG + Intergenic
1079119639 11:17672642-17672664 GTGTGCAGACAGCTGTAGTACGG - Intergenic
1080193247 11:29576696-29576718 GTGGCCACAGAACTTGAGCAGGG + Intergenic
1084791903 11:71480504-71480526 TTTGCCACACAGCTGCACCATGG + Intronic
1086577313 11:88353988-88354010 GTGGCCACACTGCAGTTTCAGGG - Intergenic
1086622753 11:88907273-88907295 GTGGCCTCCCAGCTGTTGGAAGG - Intronic
1086937614 11:92762272-92762294 GAAGCCACACAGCTGTGGAAGGG + Intronic
1087055100 11:93927002-93927024 GTGGCCACAGAGCTGTTGATAGG - Intergenic
1089465126 11:118679936-118679958 GAGGCCACACACCTGTAACCTGG + Intergenic
1089677496 11:120099566-120099588 GTGGGCACACGGTTGGAGCAGGG + Intergenic
1089910832 11:122099302-122099324 GTGTCCACACATGTGTATCATGG - Intergenic
1089927256 11:122271438-122271460 GTGGCCACTCAACCATAGCAGGG + Intergenic
1090358754 11:126158352-126158374 GAGACCACACTGCTGGAGCAGGG - Intergenic
1091374008 12:14633-14655 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1091641810 12:2242804-2242826 CAAGCCACACAGCTGTACCATGG - Intronic
1092290356 12:7156621-7156643 GTGGGCACACAGCTGCACAAAGG - Intronic
1092431698 12:8414944-8414966 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1092434649 12:8437567-8437589 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1094224157 12:28026764-28026786 GAGGTCACACAGCTTTAGAAAGG + Intergenic
1096054628 12:48641149-48641171 CTGGACACAAAGCTGAAGCATGG - Intergenic
1097725470 12:63070860-63070882 GTGGCCATCAAGCTGTAGCTGGG - Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1101012141 12:100461854-100461876 CTGGCCACAGTGCTGAAGCAGGG + Intergenic
1102784448 12:115592826-115592848 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1104256681 12:127145930-127145952 ATGGCCACGCACCTGCAGCAGGG + Intergenic
1106376248 13:29191032-29191054 GCTGCCACACAGCTGTATGAGGG + Intronic
1106447771 13:29851610-29851632 GAGGTCACACAGCTGTAGGTTGG - Intergenic
1106868548 13:33994290-33994312 GTGTCCACTCAGCTGGAGGAAGG + Intergenic
1110391322 13:74978087-74978109 CTATTCACACAGCTGTAGCAAGG + Intergenic
1111986049 13:95068104-95068126 GTGTCCACACAGCAGAAACAGGG - Intronic
1113381735 13:109811374-109811396 GGGGACACACAGCTGGTGCAAGG - Intergenic
1113880408 13:113622367-113622389 GCGGCCACACAGAGGCAGCAAGG - Intronic
1113913266 13:113854771-113854793 GAAGCCACACAGCTGTTGGATGG + Intronic
1115663608 14:35522918-35522940 ATGGCCATAGAGCTGGAGCAGGG + Intergenic
1120044006 14:79786046-79786068 GTGGCCACAGTGCTGGAGCTGGG - Intronic
1121413894 14:93765596-93765618 GAGGCCACACAGCTACAGCATGG + Intronic
1122024543 14:98866163-98866185 GTGGCTACAGAGCGGCAGCAGGG + Intergenic
1122302214 14:100737665-100737687 GTGGACACACAGCTGTCCCCAGG + Exonic
1123118647 14:105906767-105906789 GTGCCCACACTGCTGCATCATGG - Intergenic
1123403586 15:20007966-20007988 GTGCCCACACTGCTGCATCATGG - Intergenic
1123512922 15:21014611-21014633 GTGCCCACACTGCTGCATCATGG - Intergenic
1126782585 15:52151205-52151227 GGGGCCACACACCTGTATCGTGG + Intronic
1128220438 15:65964813-65964835 GTGGCCCCCCACCTCTAGCATGG - Intronic
1128721192 15:69949770-69949792 GTGGGCAATCAGCTGTAGCCTGG + Intergenic
1129310912 15:74708391-74708413 GGGGCCACACACCTGAGGCAGGG - Intergenic
1129878159 15:78990444-78990466 GGGGCCACACAGCTGCGACAAGG - Intronic
1130386276 15:83415047-83415069 ATCGGCACACAGCTGTAGCCAGG + Intergenic
1130894972 15:88162915-88162937 GTGGCCACAGTGCTGGACCAAGG - Intronic
1132452590 15:101976422-101976444 GAGGCCACACAGCTGGGGCGGGG + Intergenic
1132454310 16:14204-14226 GAGGCCACACAGCTGGGGCGGGG - Exonic
1138427829 16:56948007-56948029 GTGTCCACACAGCTGGACCCAGG - Intergenic
1138501870 16:57451077-57451099 TTAGCCCCACAGCTGAAGCATGG - Exonic
1141148255 16:81547069-81547091 GTGGGCACACAGATGTGGGATGG + Intronic
1144954442 17:19011980-19012002 GTTGCAACACAGCAGCAGCAGGG - Intronic
1146893383 17:36523298-36523320 GCTGCCACACAGCTGTTGCATGG - Intronic
1147960182 17:44162524-44162546 GTGGCCACACAGCACTGGCAGGG - Intergenic
1149527474 17:57367848-57367870 GATGCCACACAGCTGTAAGAGGG - Intronic
1149531772 17:57401551-57401573 TTGAGGACACAGCTGTAGCAGGG - Intronic
1150005009 17:61463895-61463917 GTGGGCCAACAGCTGAAGCAGGG - Intronic
1151205710 17:72505116-72505138 ATGGACACACAGCTGTGGGACGG + Intergenic
1152591792 17:81217183-81217205 GTGGGCACACAGCTGGGGCAAGG + Intronic
1152938443 17:83153679-83153701 GTCCCCACACAGCTGTAACCCGG - Intergenic
1156796987 18:41058019-41058041 TAGGCCACACAAATGTAGCAAGG - Intergenic
1157405893 18:47422680-47422702 GTGGCCACCCAGCGGCAGCCCGG + Intergenic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1158617556 18:59002031-59002053 GTGGCCACACAGCTGGTGATTGG - Intergenic
1158666942 18:59440825-59440847 GTTGCCCCACAACTCTAGCATGG + Intronic
1160033010 18:75278697-75278719 TTGGCCACTCAGCTGTGACAGGG + Intronic
1160196092 18:76756699-76756721 GTGACGACGCAGCTGTGGCACGG + Intergenic
1160517703 18:79487585-79487607 GTGGCCTCACGTCTGTAGCCAGG + Intronic
1160535036 18:79587098-79587120 GTGGACACACATCTGTGGGAGGG + Intergenic
1165266173 19:34665026-34665048 GTGGCCCCAAGGCTGCAGCACGG + Intronic
1165269343 19:34691596-34691618 CTGGCCACAATGGTGTAGCATGG - Intergenic
1165273800 19:34732084-34732106 GTGGCCCCGAGGCTGTAGCATGG + Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165467557 19:35984022-35984044 GTGGCCACACAGCTTCCCCAAGG + Intergenic
1166325270 19:42046108-42046130 AAGGCCACCCAGCTGAAGCAGGG + Intronic
1167910011 19:52693998-52694020 GTGCCCATACAAGTGTAGCATGG + Intergenic
925119066 2:1403425-1403447 GTGTCCTCACAGCTGAACCACGG - Intronic
925783220 2:7403028-7403050 CTGGCCACACAGCTGTTCCCAGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
928417795 2:31111124-31111146 GGGGCTTCACAGCTGCAGCAGGG - Intronic
930624842 2:53685553-53685575 TGGGCCACAAAACTGTAGCAGGG - Intronic
932420465 2:71598466-71598488 GGGGCCACAAAGCTGGAGCAGGG - Intronic
935736629 2:106111572-106111594 GTGGCCACACAGTGGTAGCCTGG - Intronic
936568803 2:113598896-113598918 GAGGCCACACAGCTGGGGCGGGG + Intergenic
938428184 2:131209629-131209651 GTGTCCACAGAGCGGTAGGAGGG + Intronic
940035901 2:149311688-149311710 ATGGACACAGAGCTGTGGCATGG + Intergenic
941519447 2:166521082-166521104 GTGGCCACAGCTTTGTAGCAAGG - Intergenic
944958414 2:204839483-204839505 GTCGCCACAAAGCTGTGGCCAGG - Intronic
946043656 2:216803592-216803614 GTCGGGACACAGCTGTAGAAAGG - Intergenic
947535975 2:230940666-230940688 GCGGCCACCCAGCAGCAGCATGG - Intronic
948596653 2:239083729-239083751 GTGCCCACACAGCAGCAGGAAGG + Intronic
948841393 2:240651342-240651364 GTGGTGACACACCTGCAGCACGG - Intergenic
1168845069 20:938882-938904 GTGGCCACCCAGCTGCAGGAGGG - Intergenic
1168961350 20:1872048-1872070 GTGACCACAGGGCTGTGGCATGG + Intergenic
1172672545 20:36644313-36644335 GAGGCCACACAGCTCCAGCCAGG - Intronic
1174111913 20:48203028-48203050 GAGGCCACACAGCTGCTGCATGG - Intergenic
1174169222 20:48605793-48605815 GAGGCCACACAGCTGCTGCATGG + Intergenic
1174300835 20:49580988-49581010 ATGGACACAGAGCAGTAGCAGGG - Intergenic
1174348305 20:49948177-49948199 GTGGGCAGGCAGCTGTAGCTGGG - Intronic
1174851990 20:54004688-54004710 GAGGCCACACAGCATTAGCATGG + Intronic
1174972510 20:55292222-55292244 GTGGCCAGACAGCTCTTGCTGGG + Intergenic
1179033815 21:37742929-37742951 GTGGGCACACATCTGCAGGAAGG - Intronic
1182273316 22:29169605-29169627 ATGGCTACCCAGCTGTGGCAGGG - Intergenic
1183188564 22:36306634-36306656 GTGCCCACACAGTTGCAGCTGGG + Intronic
950678469 3:14568894-14568916 GAGGCCACACAGCTGGTGAAGGG - Intergenic
951836464 3:26988678-26988700 GTGTCCAAACAAGTGTAGCAGGG - Intergenic
952719871 3:36521507-36521529 GTGACCACAAAGGTGTATCAGGG - Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954871472 3:53770632-53770654 GTGGCCACACAGGGGGAGCCTGG - Intronic
955060331 3:55487689-55487711 GTGGCCCCAAAGCTGCAGCGGGG - Intronic
960058546 3:113295217-113295239 GTGGCCACACATCTGTATAATGG + Intronic
962379267 3:134884056-134884078 CAGGGCACACAGCTCTAGCACGG - Intronic
964615817 3:158664016-158664038 AAGGCCACACAGCTATTGCATGG - Intronic
964633969 3:158841277-158841299 GAGGCCACACACCAGTAGGATGG + Intergenic
967299139 3:187995201-187995223 GTGGGCACCAAGCTGTAGCCAGG - Intergenic
967866946 3:194198125-194198147 GAGGCCACACAGCAGGAGCTTGG - Intergenic
969369865 4:6724734-6724756 GTGGCCACTCTGCCCTAGCAGGG + Intergenic
970134057 4:12902920-12902942 GTGGCCACACACATGTATGATGG + Intergenic
970475001 4:16413036-16413058 GTGGCCACACAGCAGGAGGATGG - Intergenic
970620117 4:17809831-17809853 GTGGCCACAAAGTTGTGGAAAGG + Intronic
971139330 4:23906639-23906661 ATGGAAACACAGTTGTAGCATGG - Intergenic
981938592 4:150258388-150258410 CTAGGCCCACAGCTGTAGCAGGG + Intergenic
985943174 5:3155277-3155299 GTGGCCACCCAGGGGGAGCAGGG - Intergenic
986002636 5:3642344-3642366 GTGGCCACTCACCTCTAGCCTGG - Intergenic
987181793 5:15375371-15375393 TTAACCACACAGCTGGAGCAGGG - Intergenic
992861699 5:80917774-80917796 GTTGCCACACAGATGTTTCAAGG - Intergenic
1001523450 5:172412224-172412246 GTGGCCCCGTGGCTGTAGCAGGG + Intronic
1001889358 5:175326403-175326425 ATGGCCACACACCTGTGGCCAGG - Intergenic
1001962845 5:175890647-175890669 GTGGCCGCACAGGTGCAGGAGGG - Intergenic
1003295751 6:4825921-4825943 GTGGTCTCACAGCTGAAACAAGG - Intronic
1003897891 6:10624706-10624728 GTGTCCACACAGCTCTAAGATGG - Intronic
1006423534 6:33949972-33949994 GAGCCCACTCAGCTGTGGCAGGG + Intergenic
1008469794 6:51871531-51871553 GTGGCTACAAAGATGGAGCAAGG + Intronic
1010550109 6:77211416-77211438 CTGGCCACACAGCAGTAGAATGG + Intergenic
1016203276 6:141439745-141439767 GTGGCCACACAGTGCTAACAAGG - Intergenic
1017320345 6:153084671-153084693 GTGGACAGACAGCTTTAGCTAGG + Intronic
1019906748 7:4070644-4070666 GTGGGCACACCGCTCTATCAGGG - Intronic
1020018841 7:4849485-4849507 GTAGCCTCACAGCTGCAGCCTGG - Intronic
1021942314 7:25689802-25689824 GTGGGCAAACAGCTGGAGGATGG - Intergenic
1022838257 7:34137335-34137357 GTGGCCACAGAGTGGGAGCAAGG + Intronic
1026646712 7:72177209-72177231 GGGGCTACACAGTTGCAGCAGGG - Intronic
1026789894 7:73324689-73324711 GTGGCCACACTGCAGCATCAGGG + Exonic
1028827583 7:95291101-95291123 CTGAACACACAGCAGTAGCAAGG - Exonic
1029172216 7:98639271-98639293 GAGGCCACACAGCCCTACCAGGG + Intergenic
1030534706 7:110751627-110751649 GCTGCCTCACAGCTGTAACACGG + Intronic
1031993071 7:128210466-128210488 GAGGCCACATAGCTGGCGCAGGG - Intergenic
1032478297 7:132227081-132227103 GAGGCCACTGAGCTGGAGCAGGG - Intronic
1032608470 7:133384964-133384986 TTGGCCACGCATCTGCAGCATGG + Intronic
1036832655 8:12033781-12033803 GTGGTGACACAGCTGAAGCCAGG + Intergenic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1040565794 8:48565573-48565595 GTGGCCGCACAGATGCAGGAGGG + Intergenic
1041372326 8:57174953-57174975 TTAGCCACACAGTAGTAGCAGGG + Intergenic
1042751223 8:72160060-72160082 GCGGCCACAAAGCTGTATCTTGG - Intergenic
1042940464 8:74101938-74101960 GTGGCCCCACAGTGGGAGCATGG + Intergenic
1043873990 8:85464310-85464332 GTGGCCTCGCAGCTGGGGCAAGG - Intronic
1048467989 8:134683528-134683550 GTGGCCAGACAGCTGGAGGAAGG + Intronic
1049265958 8:141668050-141668072 GTGGCCAGGAAGCTGCAGCAGGG + Intergenic
1049883726 9:14629-14651 GAGGCCACACAGCTGGGGCGGGG - Intergenic
1050076654 9:1872761-1872783 GAGGTGACACAGCTGTGGCAGGG - Intergenic
1055088127 9:72335126-72335148 GTGGTCACACAGCTGCTTCACGG + Intergenic
1055342489 9:75299176-75299198 GTGTCCACACAGATGAAGCATGG - Intergenic
1056308990 9:85320940-85320962 GTGGACACAGGGCTGTGGCAAGG + Intergenic
1056553499 9:87670807-87670829 GCGGACACTCAGCTGCAGCAAGG + Intronic
1056587706 9:87939088-87939110 GTGGCCACAGACCAGTAGGAGGG - Intergenic
1056609164 9:88113851-88113873 GTGGCCACAGACCAGTAGGAGGG + Intergenic
1057501415 9:95599598-95599620 GTTGCCACAGAGCTGCAGTATGG - Intergenic
1060966140 9:127713274-127713296 AGGGCCACACAGCTGTGGCCTGG - Intronic
1062402283 9:136377967-136377989 GCGGCCACACAGCAGTGGCTGGG - Exonic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1192312760 X:70030077-70030099 GTGGCCACACAGCTGTAGCAAGG - Intronic
1194833154 X:98650257-98650279 GTGGCCAAACAGCTATGGCTAGG + Intergenic
1197127444 X:122964048-122964070 GAGTCCATACAGCTGAAGCAGGG + Intergenic
1199188091 X:144939852-144939874 CTGGATCCACAGCTGTAGCAGGG + Intergenic
1200402088 X:156025530-156025552 GAGGCCACACAGCTGGGGCGGGG + Intergenic