ID: 1192315803 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:70050374-70050396 |
| Sequence | CAATGGGATTGGAGGGCAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192315795_1192315803 | 3 | Left | 1192315795 | X:70050348-70050370 | CCCAACTGTCTATGGTCTCTCAG | No data | ||
| Right | 1192315803 | X:70050374-70050396 | CAATGGGATTGGAGGGCAGAGGG | No data | ||||
| 1192315796_1192315803 | 2 | Left | 1192315796 | X:70050349-70050371 | CCAACTGTCTATGGTCTCTCAGT | No data | ||
| Right | 1192315803 | X:70050374-70050396 | CAATGGGATTGGAGGGCAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192315803 | Original CRISPR | CAATGGGATTGGAGGGCAGA GGG | Intergenic | ||
| No off target data available for this crispr | |||||