ID: 1192315803

View in Genome Browser
Species Human (GRCh38)
Location X:70050374-70050396
Sequence CAATGGGATTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192315795_1192315803 3 Left 1192315795 X:70050348-70050370 CCCAACTGTCTATGGTCTCTCAG No data
Right 1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG No data
1192315796_1192315803 2 Left 1192315796 X:70050349-70050371 CCAACTGTCTATGGTCTCTCAGT No data
Right 1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192315803 Original CRISPR CAATGGGATTGGAGGGCAGA GGG Intergenic
No off target data available for this crispr