ID: 1192316214

View in Genome Browser
Species Human (GRCh38)
Location X:70053719-70053741
Sequence TCCACAGCGACGCTGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192316214_1192316221 30 Left 1192316214 X:70053719-70053741 CCCTCCAACAGCGTCGCTGTGGA No data
Right 1192316221 X:70053772-70053794 CCATGGCAGTGTGAACGTTTTGG No data
1192316214_1192316218 -1 Left 1192316214 X:70053719-70053741 CCCTCCAACAGCGTCGCTGTGGA No data
Right 1192316218 X:70053741-70053763 AGAAAGAATGGCAGAAATTCTGG No data
1192316214_1192316219 13 Left 1192316214 X:70053719-70053741 CCCTCCAACAGCGTCGCTGTGGA No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192316214 Original CRISPR TCCACAGCGACGCTGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr