ID: 1192316219

View in Genome Browser
Species Human (GRCh38)
Location X:70053755-70053777
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192316216_1192316219 9 Left 1192316216 X:70053723-70053745 CCAACAGCGTCGCTGTGGAGAAA No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data
1192316212_1192316219 26 Left 1192316212 X:70053706-70053728 CCAGAATGGGCTTCCCTCCAACA No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data
1192316211_1192316219 27 Left 1192316211 X:70053705-70053727 CCCAGAATGGGCTTCCCTCCAAC No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data
1192316215_1192316219 12 Left 1192316215 X:70053720-70053742 CCTCCAACAGCGTCGCTGTGGAG No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data
1192316214_1192316219 13 Left 1192316214 X:70053719-70053741 CCCTCCAACAGCGTCGCTGTGGA No data
Right 1192316219 X:70053755-70053777 AAATTCTGGAGCAGAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192316219 Original CRISPR AAATTCTGGAGCAGAAGCCA TGG Intergenic
No off target data available for this crispr