ID: 1192316221

View in Genome Browser
Species Human (GRCh38)
Location X:70053772-70053794
Sequence CCATGGCAGTGTGAACGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192316214_1192316221 30 Left 1192316214 X:70053719-70053741 CCCTCCAACAGCGTCGCTGTGGA No data
Right 1192316221 X:70053772-70053794 CCATGGCAGTGTGAACGTTTTGG No data
1192316216_1192316221 26 Left 1192316216 X:70053723-70053745 CCAACAGCGTCGCTGTGGAGAAA No data
Right 1192316221 X:70053772-70053794 CCATGGCAGTGTGAACGTTTTGG No data
1192316215_1192316221 29 Left 1192316215 X:70053720-70053742 CCTCCAACAGCGTCGCTGTGGAG No data
Right 1192316221 X:70053772-70053794 CCATGGCAGTGTGAACGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192316221 Original CRISPR CCATGGCAGTGTGAACGTTT TGG Intergenic
No off target data available for this crispr