ID: 1192316400

View in Genome Browser
Species Human (GRCh38)
Location X:70055128-70055150
Sequence TACATGGACCATTGCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192316397_1192316400 20 Left 1192316397 X:70055085-70055107 CCTTCAGCAGATGTGGAAAGGGA No data
Right 1192316400 X:70055128-70055150 TACATGGACCATTGCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192316400 Original CRISPR TACATGGACCATTGCTGAGG AGG Intergenic
No off target data available for this crispr