ID: 1192320306

View in Genome Browser
Species Human (GRCh38)
Location X:70085445-70085467
Sequence AAAGGGCGCCGCCCACCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192320298_1192320306 30 Left 1192320298 X:70085392-70085414 CCTTGGCATTTTCTTCAGATTTC No data
Right 1192320306 X:70085445-70085467 AAAGGGCGCCGCCCACCACCAGG No data
1192320302_1192320306 5 Left 1192320302 X:70085417-70085439 CCTTCAAAACAAAGGGCTTGGAA No data
Right 1192320306 X:70085445-70085467 AAAGGGCGCCGCCCACCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192320306 Original CRISPR AAAGGGCGCCGCCCACCACC AGG Intergenic