ID: 1192324278

View in Genome Browser
Species Human (GRCh38)
Location X:70119006-70119028
Sequence CAAATTATGAGACTTGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192324273_1192324278 12 Left 1192324273 X:70118971-70118993 CCTATTTCATTACATACATATGT No data
Right 1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192324278 Original CRISPR CAAATTATGAGACTTGTAGA AGG Intergenic
No off target data available for this crispr