ID: 1192334585

View in Genome Browser
Species Human (GRCh38)
Location X:70206865-70206887
Sequence CTTATAACTCAACAACTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192334584_1192334585 -4 Left 1192334584 X:70206846-70206868 CCAGAATAGATAAATAATTCTTA No data
Right 1192334585 X:70206865-70206887 CTTATAACTCAACAACTGAAAGG No data
1192334582_1192334585 30 Left 1192334582 X:70206812-70206834 CCTACAAATCATGTATCTCATAA No data
Right 1192334585 X:70206865-70206887 CTTATAACTCAACAACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192334585 Original CRISPR CTTATAACTCAACAACTGAA AGG Intergenic