ID: 1192334585 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:70206865-70206887 |
| Sequence | CTTATAACTCAACAACTGAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192334584_1192334585 | -4 | Left | 1192334584 | X:70206846-70206868 | CCAGAATAGATAAATAATTCTTA | No data | ||
| Right | 1192334585 | X:70206865-70206887 | CTTATAACTCAACAACTGAAAGG | No data | ||||
| 1192334582_1192334585 | 30 | Left | 1192334582 | X:70206812-70206834 | CCTACAAATCATGTATCTCATAA | No data | ||
| Right | 1192334585 | X:70206865-70206887 | CTTATAACTCAACAACTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192334585 | Original CRISPR | CTTATAACTCAACAACTGAA AGG | Intergenic | ||