ID: 1192339350

View in Genome Browser
Species Human (GRCh38)
Location X:70250019-70250041
Sequence AGGGCCCTGACAGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192339345_1192339350 9 Left 1192339345 X:70249987-70250009 CCTACTTGGGGCTAGATCTTCCT No data
Right 1192339350 X:70250019-70250041 AGGGCCCTGACAGGTCTTCCTGG No data
1192339340_1192339350 28 Left 1192339340 X:70249968-70249990 CCTGACAGGCTGGTCCTTTCCTA No data
Right 1192339350 X:70250019-70250041 AGGGCCCTGACAGGTCTTCCTGG No data
1192339344_1192339350 14 Left 1192339344 X:70249982-70250004 CCTTTCCTACTTGGGGCTAGATC No data
Right 1192339350 X:70250019-70250041 AGGGCCCTGACAGGTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192339350 Original CRISPR AGGGCCCTGACAGGTCTTCC TGG Intergenic
No off target data available for this crispr