ID: 1192343022

View in Genome Browser
Species Human (GRCh38)
Location X:70279869-70279891
Sequence GTCTGCTTAGGTTGTATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192343017_1192343022 12 Left 1192343017 X:70279834-70279856 CCACATGGCATGTTCTGATCACG 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1192343022 X:70279869-70279891 GTCTGCTTAGGTTGTATCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192343022 Original CRISPR GTCTGCTTAGGTTGTATCCC AGG Intronic
900726993 1:4223072-4223094 GCCTCCTGAGGTTGTATCACTGG - Intergenic
902522922 1:17031788-17031810 CTCTGCTTTTGTTTTATCCCAGG + Intronic
906451163 1:45949125-45949147 TACTGCTTAGGTTGTCTTCCAGG - Intronic
916507515 1:165441441-165441463 GTCTGCCTGGGTTCAATCCCTGG + Intronic
920066246 1:203272090-203272112 GTCTTCTTAGGTTGCCTGCCTGG - Intronic
920870987 1:209794855-209794877 CTCTGCCTAGGCTGTATCACGGG - Intronic
1065002902 10:21353266-21353288 GTGTGCTTATGATGTATCCCAGG + Intergenic
1066799841 10:39173723-39173745 GTCTGCCTAGATTTTATCCTGGG - Intergenic
1068339046 10:55677179-55677201 GGCTGCTTTTGCTGTATCCCAGG + Intergenic
1070641136 10:78170868-78170890 GTCAACTTAGGCTCTATCCCAGG + Intergenic
1085711558 11:78833586-78833608 GTCTGGTCAGGTTGTTTTCCAGG + Intronic
1087464247 11:98485224-98485246 GTCTGTTTAGTTGGTATTCCTGG - Intergenic
1089126322 11:116178996-116179018 TCCTGCTTTGGTTGAATCCCAGG - Intergenic
1092751997 12:11727684-11727706 GTCTGTATAGGTTGCATCACAGG + Intronic
1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG + Exonic
1102227566 12:111239825-111239847 GTCTGTCTGGGTTCTATCCCTGG + Intronic
1103900709 12:124302457-124302479 GTCTGCTTGGGGGGGATCCCAGG - Intronic
1109168861 13:59071413-59071435 GTCTGCTTACCTTGTCCCCCAGG - Intergenic
1110907744 13:80914172-80914194 TTCTGTTCAGGTTGTTTCCCAGG + Intergenic
1125307243 15:38332745-38332767 CTCTGCCTAAGTTTTATCCCTGG - Intronic
1125474096 15:40033234-40033256 GTCTGCTTAGGTTCAAATCCTGG - Intronic
1132009790 15:98266028-98266050 CTCTGTCTGGGTTGTATCCCTGG - Intergenic
1137625082 16:49902630-49902652 GTCAGATTACGTGGTATCCCTGG - Intergenic
1141944406 16:87299381-87299403 GTCTTCTTATGCTGTCTCCCTGG + Intronic
1142700917 17:1660209-1660231 GTCAGCTTAGGTGGAATCGCGGG - Intronic
1143356220 17:6330840-6330862 CTCTGATTATGGTGTATCCCTGG + Intergenic
1143467136 17:7144861-7144883 GTCTGCATAGGTTGTACCTCTGG + Intergenic
1144031723 17:11329169-11329191 GTCTGCCTAGCTAGTAGCCCTGG + Intronic
1149039544 17:52171558-52171580 ATCTGTTTATGTTGTCTCCCTGG - Intergenic
1149130719 17:53297612-53297634 GTTTGATTATGTTGTATCTCAGG - Intergenic
1150359891 17:64522531-64522553 GTGTGCTGAGGCTATATCCCTGG + Intronic
1155937431 18:31768128-31768150 GGCTGCTTAGGTTGTCTTGCAGG + Intergenic
1157140584 18:45102022-45102044 TTCTGCTAAGGGTGTTTCCCTGG + Intergenic
1159417304 18:68169498-68169520 TTTTGCTTAGGTTGTCTTCCAGG + Intergenic
1164751255 19:30656666-30656688 GTCTACTTTGGCTGTGTCCCTGG + Intronic
925485643 2:4326676-4326698 GTCTGCTGAGGTTGAACTCCTGG - Intergenic
925896144 2:8473768-8473790 GTCTGCTTAGGCTCTTTCCAAGG - Intergenic
932082791 2:68730908-68730930 CTCTGCTTGGGTGGCATCCCAGG - Intronic
932309029 2:70725048-70725070 GTCTGCCTAGTTTATATCCTGGG + Intronic
932595824 2:73092922-73092944 GTCTGCTCTGGTTGAGTCCCTGG - Intronic
932950783 2:76290389-76290411 CTCTGCTTATGTTCTATGCCTGG + Intergenic
932986352 2:76730406-76730428 GTATGCTTAGGTTTTAGCTCTGG + Intergenic
935684499 2:105671598-105671620 CTATGCTGAAGTTGTATCCCTGG + Intergenic
938812571 2:134867146-134867168 GACTGCTGAGATTGTATCCTTGG - Intronic
942200826 2:173569415-173569437 GTCTCCTAAGGTTCCATCCCTGG - Intergenic
945825807 2:214718407-214718429 TTCTTCTTAGTTTGGATCCCTGG - Intergenic
1172038772 20:32029203-32029225 TTCTGCTTAGGTTATGTCCAGGG - Intronic
1173396381 20:42684001-42684023 ATCTACTTAGGTTGTGTCCAAGG - Intronic
1180501727 22:15935841-15935863 GTCTGCTTTGGTTGTTGCTCTGG + Intergenic
1181404551 22:22673414-22673436 GGCTTCTTAGGTTTTCTCCCTGG - Intergenic
1181413136 22:22738969-22738991 GGCTTCTTAGGTTTTCTCCCTGG - Intronic
1182256080 22:29039548-29039570 TTCCGCTTAGGTGGTATCCTAGG - Intronic
952112865 3:30144723-30144745 GAGTGCTTTGGTTGTTTCCCTGG + Intergenic
955426456 3:58796097-58796119 GTTTGCTCAAATTGTATCCCTGG - Intronic
959405793 3:105960522-105960544 GTCAGCTTAGGGTTTATCCCAGG + Intergenic
961340813 3:126216259-126216281 GACTGCTTGGGTTCTAACCCCGG + Intergenic
961570786 3:127797208-127797230 CTCTGCAGAGGGTGTATCCCAGG + Intronic
963940271 3:151090153-151090175 GTCTGCTTGGGTTGGGACCCTGG + Intronic
967255059 3:187582742-187582764 TTTTGCTTAGGTTGTCTTCCAGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
968916483 4:3499126-3499148 GTCTGCTGAGGATGCATCCCTGG + Intronic
969185910 4:5474150-5474172 ATCTGCTTAGGTGGCCTCCCTGG + Intronic
970806658 4:20044098-20044120 GTCTGCTCATCTTGTTTCCCAGG - Intergenic
975820882 4:78269166-78269188 TTCGGCTTAGCTTGTATCCCTGG + Intronic
978596533 4:110383226-110383248 TACTGCTTAGGTTGTCTTCCAGG - Intronic
979684590 4:123497286-123497308 ATCTTCTTAGCTTGTATCCTAGG + Intergenic
980114728 4:128668260-128668282 GTCTAGTTTAGTTGTATCCCAGG - Intergenic
980903399 4:138926363-138926385 GACTGTGTAGGTTGTAGCCCGGG - Intergenic
981980998 4:150791143-150791165 GTCTGCTCATGTTGTTGCCCAGG + Intronic
983899462 4:173118250-173118272 GTATGCCTAGGTTGTCTTCCAGG - Intergenic
985621536 5:958728-958750 GTCTGTTTGGTTTGTTTCCCAGG - Intergenic
991422890 5:66459436-66459458 GTCAACTTAGGTTCTATTCCTGG - Intergenic
997431642 5:133844966-133844988 GTCAGCTTAGGTCGTGTCCTGGG + Intergenic
1007494447 6:42250041-42250063 GTCACCTTAGGTTGTAAACCTGG + Intronic
1009372246 6:62920324-62920346 GTCTGCCTAGCATGGATCCCTGG - Intergenic
1014421253 6:121248298-121248320 CACTGCTTTTGTTGTATCCCAGG - Intronic
1015926165 6:138312318-138312340 GTCTTCTCAGGTGGTGTCCCTGG + Intronic
1017465681 6:154691604-154691626 GTCAGCTTAGGTTTAATTCCTGG + Intergenic
1017966594 6:159272168-159272190 GTGTGCATAGTATGTATCCCTGG - Intergenic
1018399594 6:163409703-163409725 GTCTCCCTAGGTTGTTGCCCAGG - Intergenic
1018997211 6:168719103-168719125 GTCTGCTTTGGTGGCAGCCCTGG + Intergenic
1019208863 6:170388089-170388111 GTCAGCTGAGGTTGTTTCCAAGG + Intronic
1026568293 7:71508157-71508179 CTCTGCTTAGTTTCTTTCCCTGG + Intronic
1026905974 7:74063073-74063095 GTCTGCTTGCCTTGTGTCCCTGG + Intronic
1027525283 7:79261307-79261329 GTATGCCAAGGTTGTAGCCCAGG - Intronic
1027695802 7:81408763-81408785 GTTTGCTTAGGTAGGAACCCAGG - Intergenic
1029453111 7:100653614-100653636 GTCTGCTCAGTTTGTCACCCAGG - Intronic
1031242847 7:119268033-119268055 GTCTGCTTTTGCTGTATCCCAGG + Intergenic
1032480085 7:132239255-132239277 GTCTGCTTACCTTGCAGCCCTGG + Intronic
1033760210 7:144429292-144429314 GTTGGCTTAGTTTGTATCTCAGG + Intergenic
1043681318 8:83029028-83029050 TACTGCCTAGGTTGTATTCCAGG - Intergenic
1044798258 8:95926292-95926314 GTCTGATTAAGTTGTTTCCATGG + Intergenic
1050398393 9:5224703-5224725 GACTGCTTTGGCTGCATCCCAGG - Intergenic
1050823285 9:9911064-9911086 GTCTGCTTGGCTTGTAATCCTGG + Intronic
1051268968 9:15336396-15336418 GTCCAGTTAGATTGTATCCCAGG - Intergenic
1054891585 9:70258118-70258140 GCCTGCCAAGGTTGCATCCCTGG - Intergenic
1058730075 9:107841395-107841417 GCCTGCTGACCTTGTATCCCTGG + Intergenic
1059608028 9:115857790-115857812 GTCTGTCTAGGTTTTAGCCCTGG + Intergenic
1190385707 X:49880453-49880475 TTCTGGTTTGGTTGTTTCCCAGG - Exonic
1192343022 X:70279869-70279891 GTCTGCTTAGGTTGTATCCCAGG + Intronic
1194317803 X:92402676-92402698 GGATGCTTAGGCTGTATTCCAGG - Intronic
1194543222 X:95200949-95200971 GACTGCTTTTGCTGTATCCCAGG + Intergenic
1199454731 X:148015477-148015499 TACTGCTTATGTTGTATCCCAGG + Intronic
1200625979 Y:5515963-5515985 GGATGCTTAGGCTGTATTCCAGG - Intronic