ID: 1192343736

View in Genome Browser
Species Human (GRCh38)
Location X:70284259-70284281
Sequence CACACAGCTGTTCCGGCGTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 93}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192343732_1192343736 -8 Left 1192343732 X:70284244-70284266 CCCCATTCACACACACACACAGC 0: 4
1: 5
2: 79
3: 963
4: 8392
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343733_1192343736 -9 Left 1192343733 X:70284245-70284267 CCCATTCACACACACACACAGCT 0: 1
1: 1
2: 17
3: 227
4: 2025
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343729_1192343736 12 Left 1192343729 X:70284224-70284246 CCCCTTTTTTTTTTTTTGGTCCC 0: 1
1: 1
2: 48
3: 538
4: 3894
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343726_1192343736 29 Left 1192343726 X:70284207-70284229 CCTGACCTTTTTTTTTTCCCCTT 0: 1
1: 3
2: 21
3: 195
4: 1950
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343727_1192343736 24 Left 1192343727 X:70284212-70284234 CCTTTTTTTTTTCCCCTTTTTTT 0: 1
1: 13
2: 158
3: 1989
4: 33171
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343730_1192343736 11 Left 1192343730 X:70284225-70284247 CCCTTTTTTTTTTTTTGGTCCCC 0: 1
1: 4
2: 64
3: 467
4: 3105
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343731_1192343736 10 Left 1192343731 X:70284226-70284248 CCTTTTTTTTTTTTTGGTCCCCA 0: 1
1: 2
2: 22
3: 231
4: 1760
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93
1192343734_1192343736 -10 Left 1192343734 X:70284246-70284268 CCATTCACACACACACACAGCTG 0: 1
1: 0
2: 19
3: 182
4: 1356
Right 1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192343736 Original CRISPR CACACAGCTGTTCCGGCGTG TGG Exonic
902167763 1:14586008-14586030 GACACAGCTGTTCCCTAGTGGGG + Intergenic
903450248 1:23448881-23448903 CACACAGCTGTTAAGTGGTGGGG + Intronic
904381211 1:30112277-30112299 CAGACAGATGTTCCTGCCTGGGG + Intergenic
923689178 1:236176316-236176338 CACACAGCTCTTGGGGGGTGGGG + Intronic
924611548 1:245577786-245577808 CACAAAGCTCTTCCGGTGAGGGG - Intronic
924611564 1:245577868-245577890 CACAAAGCTCTTCCGGTGAGGGG - Intronic
1067775412 10:49161442-49161464 CTCACAGCTGTCCTGGCATGAGG + Intronic
1070841444 10:79490656-79490678 CACGCAGCTGTTCCTGAGTTGGG - Intergenic
1073061334 10:100735538-100735560 CACACAGCCGTGGCGGCGGGCGG + Intergenic
1075795796 10:125118623-125118645 CACACACCTGTACCTGAGTGGGG + Intronic
1078660730 11:13283509-13283531 CACTCAGCTGTTATGGCTTGGGG + Intronic
1081437680 11:43044959-43044981 CACACAGGTTTTCTGGGGTGCGG + Intergenic
1087163794 11:94977455-94977477 CACACAGCTGCTCCTGCTTTAGG + Intronic
1089276239 11:117337907-117337929 CAGACAGGTGTTCCAGAGTGGGG - Intronic
1090363417 11:126188333-126188355 CACAGAGCTGTTGCGGAGTCAGG - Intergenic
1105884225 13:24628247-24628269 CTCACAGCTGTTCCGGAATAGGG - Intergenic
1109214496 13:59572528-59572550 AACAAAGCTCTTCCAGCGTGCGG - Intergenic
1114713614 14:24803077-24803099 CACACAGCTGTGACTGTGTGAGG - Intergenic
1116493792 14:45536726-45536748 CACTCAGCTGTTCTAGCCTGTGG - Intergenic
1117400450 14:55354534-55354556 CACAAAGCTGTGACTGCGTGAGG + Intronic
1124600690 15:31130711-31130733 CACACTGCAGTTCCTGGGTGGGG - Intronic
1127626684 15:60786816-60786838 CGCACAGCTGTTGCTGAGTGAGG - Intronic
1129457592 15:75683921-75683943 CACACAGCCGTCCTGGCCTGTGG + Intronic
1129726196 15:77903024-77903046 CACACAGCCGTCCTGGCCTGTGG - Intergenic
1140959062 16:79895344-79895366 CACAGAGCTGTTCATGCCTGGGG - Intergenic
1142146149 16:88493620-88493642 CAGAGAGCTGTCCCGGGGTGCGG + Intronic
1142781902 17:2187781-2187803 CACAAAGCTGGTGCGGCATGGGG + Intronic
1148755790 17:49972326-49972348 CACAGAGCGGTTCCGGCGGCAGG - Intronic
1151445848 17:74163303-74163325 CACACACATGTTCCAGGGTGGGG - Intergenic
1152379748 17:79936262-79936284 CACACAGCTGGGTGGGCGTGTGG + Exonic
1153725206 18:7947185-7947207 CACTCAGGTGTTCCGGCGCTTGG + Intronic
1155676836 18:28440305-28440327 CACAAAGGTGTTCCTGGGTGTGG + Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160802616 19:977287-977309 CACACAGCTGTTCCACCGCCGGG + Intergenic
1166282432 19:41803204-41803226 CACCCATCTGTTCCTGCATGGGG - Intronic
1168307625 19:55443906-55443928 CACACCACTGTTACGGCGTCGGG + Intergenic
925856917 2:8138009-8138031 CACTCAGCGGTTTCTGCGTGGGG - Intergenic
928118234 2:28563402-28563424 CACACAGCTGGTCAGCGGTGGGG + Intronic
930542995 2:52730861-52730883 CACACACCTGTTGTGGGGTGGGG - Intergenic
934534431 2:95121581-95121603 CACACAGCGGCTCCGGCGGAAGG + Intronic
935188454 2:100755937-100755959 CATACGGCTGTTCCTGCATGGGG - Intergenic
938698504 2:133855747-133855769 CACACAGGTGTTCTGGCCCGAGG + Intergenic
940614992 2:156038645-156038667 GATTCAGCTGTTCCGGCCTGTGG + Intergenic
1171933801 20:31254423-31254445 CACACAGCTGGTAAGGCATGGGG - Intergenic
1172955178 20:38751772-38751794 GACACAGCTGCTCTGGGGTGGGG - Intronic
1174404042 20:50292438-50292460 CACACAGCAGGTCCGGGGCGCGG - Intergenic
1175327688 20:58141192-58141214 CTCACAGCAGTCCCGGGGTGGGG - Intergenic
1180755303 22:18156936-18156958 CACACAGCTGTGCTGGGTTGGGG + Intronic
1184050292 22:41999034-41999056 CTCACTGGTGTTCCGGCATGTGG + Intronic
950362870 3:12462242-12462264 CACACAGCTGGTGTGGCATGGGG + Intergenic
950427582 3:12932808-12932830 CACACAGCTGATCTGGCTGGCGG - Intronic
954436022 3:50496775-50496797 CACACAGCTGTTGAGAGGTGTGG + Intronic
954675051 3:52311087-52311109 CACACAGCTGGTGGGGCCTGAGG + Intergenic
957161076 3:76610399-76610421 CCCACAGCTGGAACGGCGTGGGG + Intronic
960965229 3:123099936-123099958 CACACTGCAGTTCCTGCCTGGGG - Intronic
962964229 3:140338713-140338735 CACAAGGCTTTTCCTGCGTGAGG + Intronic
969252008 4:5974114-5974136 CACAGAGCTGGTCCGTGGTGGGG - Intronic
969340814 4:6539855-6539877 CACACAGCTGCACGGGCTTGGGG - Intronic
975977452 4:80115611-80115633 AACTCAGCTGTTCCAGCCTGTGG + Intronic
985374603 4:189321955-189321977 CATCCAGCTGCTCAGGCGTGGGG - Intergenic
985775868 5:1841401-1841423 CACCCAGCTGTGCCGGCCTGGGG + Intergenic
989252471 5:39333486-39333508 CACCCAGCTGTTGCAGCTTGAGG + Intronic
993147826 5:84118696-84118718 CACACAGCTGTTAAGTAGTGGGG - Intronic
994041526 5:95264763-95264785 CTCACAGCTGTGCCTGCCTGTGG - Intronic
998761766 5:145440037-145440059 CACACAGCTGTTTCGGAGACTGG - Intergenic
1001843969 5:174904440-174904462 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1010311834 6:74396147-74396169 CACACAGCTGTTTCGTGGCGGGG - Intergenic
1011416275 6:87122839-87122861 CGCACCTCTGTTCCGGCGCGGGG - Intergenic
1018614893 6:165677344-165677366 CACACAACTGTGCTGGCATGTGG - Intronic
1034276302 7:149825332-149825354 CACACAGCTGTGCCGACCTCTGG + Intergenic
1034870109 7:154676237-154676259 TACACAGGTGTTCCGGGCTGCGG + Intronic
1034870127 7:154676311-154676333 TACACAGGTGTTCCGGGCTGCGG + Intronic
1038942911 8:32325284-32325306 AAAACAGCTGTTACGGGGTGGGG + Intronic
1040641769 8:49343021-49343043 CACACAGCTGTGCTGGCTGGGGG - Intergenic
1040721772 8:50333159-50333181 CACACAGCTGTTCTGTGATGGGG - Intronic
1041231383 8:55756677-55756699 CACACAGGTGGTGCGGAGTGGGG + Intronic
1041623374 8:59999097-59999119 GACTCAGCTGTTCCAGCCTGTGG + Intergenic
1041890048 8:62858704-62858726 GACTCAGCTGTTCCAGCCTGTGG - Intronic
1041972627 8:63760928-63760950 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1042489513 8:69381491-69381513 AACTCAGCTGTTCCAGCCTGCGG + Intergenic
1049182541 8:141230456-141230478 CAAACAGCTGTGCCGGAGAGGGG + Intronic
1049200332 8:141336960-141336982 CACACAGCTGGGCCGCCGTGTGG - Intergenic
1051569132 9:18535664-18535686 CTCACAGCTCTTCAGGGGTGGGG + Intronic
1053001216 9:34578142-34578164 CCCACAGCGGTCCCGGCGGGCGG + Intronic
1056050589 9:82764403-82764425 AACACAGCTGTTTCCGCATGTGG + Intergenic
1056104607 9:83334467-83334489 CAGACAACTGTCCCGGTGTGAGG - Intronic
1058710392 9:107674122-107674144 CACACAGCTAGACTGGCGTGGGG - Intergenic
1059920565 9:119155980-119156002 CACACAGCTGCTACAGTGTGTGG + Intronic
1060766543 9:126298333-126298355 CAGACAGCTGTTAGAGCGTGCGG + Intergenic
1061623001 9:131823922-131823944 CAGACAGCTCTTTCTGCGTGGGG + Intergenic
1062547416 9:137069974-137069996 CGCACAGCTGCTCCGGGCTGCGG + Exonic
1190803569 X:53814159-53814181 GACTCAGCTGTTCCAGCCTGTGG - Intergenic
1192020335 X:67384480-67384502 CACACAGCTAATGCGGAGTGGGG - Intergenic
1192343736 X:70284259-70284281 CACACAGCTGTTCCGGCGTGTGG + Exonic
1195411031 X:104567679-104567701 CCCACTGCTGCTCAGGCGTGAGG + Intronic
1200747726 Y:6917106-6917128 AACAGACCTGTTCCGGCCTGAGG - Intronic