ID: 1192351679

View in Genome Browser
Species Human (GRCh38)
Location X:70361142-70361164
Sequence TGCCCCCAATAGGCTCGAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192351679_1192351681 -4 Left 1192351679 X:70361142-70361164 CCGCTTCGAGCCTATTGGGGGCA No data
Right 1192351681 X:70361161-70361183 GGCAGACTTCCTGCTGTGTCTGG No data
1192351679_1192351683 25 Left 1192351679 X:70361142-70361164 CCGCTTCGAGCCTATTGGGGGCA No data
Right 1192351683 X:70361190-70361212 ACCTCTGCCCACACCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192351679 Original CRISPR TGCCCCCAATAGGCTCGAAG CGG (reversed) Intronic