ID: 1192351679 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:70361142-70361164 |
| Sequence | TGCCCCCAATAGGCTCGAAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192351679_1192351681 | -4 | Left | 1192351679 | X:70361142-70361164 | CCGCTTCGAGCCTATTGGGGGCA | No data | ||
| Right | 1192351681 | X:70361161-70361183 | GGCAGACTTCCTGCTGTGTCTGG | No data | ||||
| 1192351679_1192351683 | 25 | Left | 1192351679 | X:70361142-70361164 | CCGCTTCGAGCCTATTGGGGGCA | No data | ||
| Right | 1192351683 | X:70361190-70361212 | ACCTCTGCCCACACCACTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192351679 | Original CRISPR | TGCCCCCAATAGGCTCGAAG CGG (reversed) | Intronic | ||