ID: 1192351832

View in Genome Browser
Species Human (GRCh38)
Location X:70362293-70362315
Sequence AACTCAGCTCTTTCTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192351825_1192351832 13 Left 1192351825 X:70362257-70362279 CCACCACATCCAGAGATGTGTGC 0: 1
1: 1
2: 0
3: 14
4: 204
Right 1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 135
1192351827_1192351832 4 Left 1192351827 X:70362266-70362288 CCAGAGATGTGTGCACCATGTAC 0: 1
1: 1
2: 0
3: 5
4: 85
Right 1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 135
1192351826_1192351832 10 Left 1192351826 X:70362260-70362282 CCACATCCAGAGATGTGTGCACC 0: 1
1: 1
2: 0
3: 18
4: 145
Right 1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG 0: 1
1: 0
2: 2
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192351832 Original CRISPR AACTCAGCTCTTTCTCCGTG GGG Intronic
903478719 1:23637982-23638004 CACCCAGCTCTGTCTCTGTGGGG + Intronic
904434209 1:30483788-30483810 AACTCAGCTCTTTCCAGGAGAGG + Intergenic
906705905 1:47895156-47895178 AACTCAGGTCTTCCTCCCTGTGG - Intronic
907518576 1:55008583-55008605 AACCCAGCTCCTTGTCCGGGAGG - Exonic
908709679 1:67001211-67001233 AACTCCACTGTTTCTCCGTGAGG + Exonic
910448452 1:87323294-87323316 AATTAAGCTTTTTCTCTGTGTGG - Intergenic
912961488 1:114199508-114199530 TACTCAGCCCTTTTTCCATGTGG - Intergenic
914422760 1:147544287-147544309 AACTGTTCTCTTTCTCTGTGTGG + Intronic
915844658 1:159251425-159251447 AACTCAGCTCCTTCTTAGAGAGG - Intergenic
919850259 1:201667705-201667727 AACTCACCTCTCCCTCCCTGTGG + Intronic
919949906 1:202353491-202353513 AATTCAGCTTTTTGTCTGTGTGG + Intronic
920730845 1:208482757-208482779 AAGTCACCTCTTTATCCCTGAGG - Intergenic
921162490 1:212483156-212483178 AACTCTGCCCTTTGTCCTTGAGG + Intergenic
923446394 1:234075566-234075588 ACCTCAGTTGTTTCTCAGTGCGG - Intronic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
1067748569 10:48955448-48955470 AACTCAGCTCTTTCTGAGAGGGG - Intronic
1071256312 10:83875036-83875058 CACTTAGCTCTTCTTCCGTGTGG + Intergenic
1074708966 10:116161224-116161246 AACTCTAGACTTTCTCCGTGTGG + Intronic
1075361924 10:121846039-121846061 GAATCAGCTATTTCTCCTTGGGG - Intronic
1076372454 10:129964249-129964271 AACTCAGCCCTCTCTCCCCGAGG + Intergenic
1077064904 11:636831-636853 AGCTCAGGTCTTTCTGCGTCTGG + Intergenic
1078524854 11:12092491-12092513 AAATCAGTTGTTTCTCCCTGGGG + Intergenic
1081705039 11:45177851-45177873 AACACCCCTCTTTCTCCATGAGG + Intronic
1083796726 11:65021272-65021294 AACCCTGCTCTTTCTCACTGTGG - Intronic
1083986316 11:66217905-66217927 AAGTCACCTCTTCCTACGTGGGG + Intronic
1091404324 12:199536-199558 AACTCAGCTCCTTCCCTGGGCGG + Intronic
1092158100 12:6297867-6297889 AACTAAGCTGTTTCTACATGTGG - Intergenic
1094331527 12:29299367-29299389 AAATCAGCTCTTCCTCTGGGAGG - Intronic
1094454995 12:30622054-30622076 AACTTTGGTCTTTCTCCTTGAGG + Intergenic
1096326229 12:50664524-50664546 ACCTCAGCTCTTTCTTTGTAGGG + Intronic
1097805649 12:63961761-63961783 GAATCAGCTCTTTCTCCTTCTGG - Intronic
1098367032 12:69714530-69714552 TACTCAGGTCATCCTCCGTGAGG + Intergenic
1098803446 12:74990928-74990950 TACTCAGCTCTTATTCTGTGTGG - Intergenic
1100775237 12:97966142-97966164 ATCTCAGCTCTCTCTCTGTGAGG + Intergenic
1101598162 12:106185661-106185683 AACTAAGCTCTGTCTACGTGTGG - Intergenic
1101677205 12:106927939-106927961 AATTAAGCTCTATCTCCTTGAGG + Intergenic
1105251482 13:18702504-18702526 AAATGAGCTCTTTCTACATGAGG + Intergenic
1105391959 13:19987991-19988013 CACACAGCTCTTTCTCTGAGAGG + Intronic
1107052615 13:36067693-36067715 ACCTCAGCTCTACCTCCTTGAGG + Intronic
1107631571 13:42348489-42348511 AGCTCAGCTGTGTCTCAGTGAGG - Intergenic
1122150765 14:99725007-99725029 AACTCAGATCTGACTCTGTGAGG - Intronic
1122419376 14:101565461-101565483 AACCCAACTCTTCCTGCGTGTGG + Intergenic
1124162885 15:27289990-27290012 GAATCAGCTCTTTCTCCAAGGGG - Intronic
1125004223 15:34799627-34799649 ATCTCAGCTGTTCCTCCGTTCGG + Intergenic
1125335244 15:38620216-38620238 GTCTCAGTTCTTTCTCCATGGGG - Intergenic
1127453959 15:59141271-59141293 AACTCATCCCTATCTCCCTGGGG + Intronic
1129266415 15:74395801-74395823 GACTCAGCTCTGCCTCTGTGAGG - Intergenic
1134334143 16:13279728-13279750 AAATCACTTCTTTCTCCCTGTGG + Intergenic
1136535397 16:30896464-30896486 AGCTCAGCTCCTCGTCCGTGGGG - Intergenic
1137856405 16:51798677-51798699 AGATCAGCTCTTTCTCTGTGTGG - Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1139745716 16:69072833-69072855 TATTCTGCTCTTTCTCCGTGTGG - Intronic
1140567470 16:76060906-76060928 AAATCAGATCTTTATCCTTGAGG - Intergenic
1142221789 16:88858645-88858667 ACTTCAGCTCGTTCTCCGTAGGG - Exonic
1144092578 17:11871342-11871364 GACTCTGCTCTTTCTGTGTGTGG - Intronic
1146566355 17:33916353-33916375 AGCCCAGCTCTCTCTCCTTGTGG - Intronic
1147944713 17:44074398-44074420 AACTCAGCTTGGTCTCCCTGGGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150335345 17:64326627-64326649 ACCTCCGCTCTCTCTCTGTGGGG + Intronic
1155614444 18:27704825-27704847 AAGTAAGCTGTTTTTCCGTGGGG + Intergenic
1157308467 18:46534328-46534350 AACTCACGTCTTTATCCGGGAGG + Exonic
1160253955 18:77231207-77231229 ACCTCAGCTCTTTCTCCCCCAGG - Intergenic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1161106927 19:2448350-2448372 CAGTCAGCTCTCTCTCTGTGGGG - Intronic
1165378730 19:35462556-35462578 CACTAAGCTCCTTCTCCTTGTGG + Intergenic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
925856917 2:8138009-8138031 CACTCAGCGGTTTCTGCGTGGGG - Intergenic
930211109 2:48638117-48638139 AACTCAGCTGTTTATCCATCAGG - Intronic
936481000 2:112884663-112884685 AAATCAGCGATTTCTCCCTGTGG + Intergenic
936841288 2:116773029-116773051 AACACATCACTTTCTCAGTGAGG + Intergenic
936849832 2:116882311-116882333 ATCTCAGCTCTTACACCCTGGGG + Intergenic
938613109 2:132969512-132969534 ACCTCAGCTCTCTCACCCTGGGG - Intronic
938914327 2:135920016-135920038 AGCTCTGCTCCTTCTCTGTGTGG - Intronic
939105374 2:137942706-137942728 AAATGAGCTCTTTCTTCATGAGG + Intergenic
940856600 2:158733404-158733426 AACTCAGCTTTATCTACTTGTGG - Intergenic
941617295 2:167735176-167735198 ACCTAAGCTATTTCTCTGTGTGG - Intergenic
947875542 2:233465131-233465153 AACTCAGCAGCTTCTCAGTGAGG + Intronic
948618903 2:239221025-239221047 GACTCAGCTCATTCTGCGGGCGG + Intronic
1169970520 20:11265151-11265173 AACTTAGCTCTTTTTTCTTGTGG - Intergenic
1170591653 20:17776156-17776178 ACCTCAGCTCACTCTCCTTGGGG + Intergenic
1171442125 20:25173569-25173591 TACTCAGCTCTTTGTACGTTTGG - Intergenic
1172852714 20:37978129-37978151 ACCTCAACTCTTTCTCCATATGG + Intergenic
1176837009 21:13802391-13802413 AAATGAGCTCTTTCTACATGAGG + Intergenic
1181493189 22:23273608-23273630 AACTCAAGTCTTTCTTCCTGGGG + Intronic
949276284 3:2286418-2286440 AACTAAGCCCTTTCTGCTTGGGG - Intronic
953548207 3:43880191-43880213 AACTCAGCTCTATCTACCTTAGG + Intergenic
955114788 3:55987120-55987142 AAATCAACACTTTCCCCGTGTGG - Intronic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
964543059 3:157801125-157801147 AATTCAGCTGTTACTCCGTCTGG + Intergenic
968500246 4:946573-946595 ACCTCAGTTCTGTCTCCGTGAGG + Intronic
971826575 4:31631050-31631072 CACTCAGCTGTTACTCCATGTGG - Intergenic
972399612 4:38688716-38688738 AACTCCGCTTGTTCACCGTGAGG - Exonic
973202715 4:47522458-47522480 TTCTCAGCTCTTTCTTCCTGTGG - Intronic
974499423 4:62680421-62680443 AACTCATATCTTTCTTCGAGAGG - Intergenic
979267114 4:118716497-118716519 CACTGAGCTCTTTCCCCATGAGG - Intergenic
982500295 4:156145997-156146019 TACTGAGCTCTTTCTCTGTTAGG - Intergenic
984880409 4:184405563-184405585 AACTCAGCTCCTTCTCTTAGGGG + Intronic
985213753 4:187626169-187626191 ATCTCATCTCCATCTCCGTGTGG - Intergenic
985577663 5:681242-681264 GGCTCTGCTCTTTCACCGTGAGG + Intronic
985592589 5:773340-773362 GGCTCTGCTCTTTCACCGTGAGG + Intergenic
985932027 5:3066226-3066248 ACCTCAGCTGATTCTCAGTGGGG + Intergenic
985940557 5:3132445-3132467 GACTGAGGTCTTTCTCAGTGAGG - Intergenic
987416250 5:17664480-17664502 AACTCAGCTGTTTTTCATTGTGG + Intergenic
988568815 5:32343903-32343925 TACTCAGCTCTTTGTACGTTTGG + Intergenic
990070779 5:51780518-51780540 TACTCAGCTCTTTGCCCGTTAGG - Intergenic
996189911 5:120527280-120527302 AACTGAGTTCTTTATTCGTGTGG + Intronic
997277120 5:132603625-132603647 AACTAAGCAGTTTCTCCCTGAGG - Intronic
1003042359 6:2700127-2700149 GACTCAGCGTTTTCTCTGTGGGG - Intronic
1006644466 6:35506267-35506289 AACTCACCGCTTTCTGTGTGCGG + Exonic
1007507103 6:42344078-42344100 AACGCAGCTCCTTCTCCTTCAGG - Intronic
1009238008 6:61148320-61148342 AACACATCTTTTTCTCCCTGTGG - Intergenic
1011920995 6:92577253-92577275 AACTCAGCCATTTCTACCTGTGG + Intergenic
1024537943 7:50453744-50453766 AATCCAGTTCTTTCTCTGTGTGG + Intronic
1028475615 7:91250029-91250051 GACTCACCTCATTCTTCGTGGGG + Intergenic
1033028000 7:137795443-137795465 AAGTCAGCTATTACTCAGTGAGG + Intronic
1034384979 7:150733414-150733436 ACCTCAGGGCTTTCTCCTTGGGG + Intronic
1034502904 7:151462493-151462515 CACCCAGCACTTTCTCCCTGGGG + Intergenic
1036982534 8:13486505-13486527 AACTCAGCATTTTCTCTGTGGGG + Intronic
1037516687 8:19638772-19638794 AGTTCAGCTCTTTCTTGGTGGGG - Intronic
1037940066 8:22944587-22944609 AACTAACCCATTTCTCCGTGTGG + Intronic
1040457210 8:47610658-47610680 AGCTCAGCTCTTTCTCCACAGGG + Intronic
1044802514 8:95971859-95971881 AACTTGGCTGTTTCTCCGTTAGG + Intergenic
1045385595 8:101668411-101668433 AGCTCAGCTGTTTCTCCTTGAGG + Exonic
1046520879 8:115324117-115324139 AATTCAGCTCTTTCTCTCTTAGG - Intergenic
1046924142 8:119768227-119768249 AACTCAGCTGTTACTGCCTGAGG + Intronic
1047429365 8:124777228-124777250 AAATCAGCTATTTCTCCAAGAGG - Intergenic
1047465413 8:125108157-125108179 AACTCAGTTTGTTCTCAGTGTGG - Intronic
1051193292 9:14536591-14536613 AACTCAGTTCATCCTCCCTGTGG - Intergenic
1052684741 9:31740743-31740765 AATTCAGCTTCTTCTCCCTGAGG - Intergenic
1055573505 9:77640777-77640799 AAATCAGCTGTTTCTCAGAGGGG - Intronic
1056503350 9:87232544-87232566 ATCTCAGCTCCTTCCCTGTGGGG - Intergenic
1058062419 9:100511763-100511785 AAATCAGTGCTTTCTCAGTGGGG + Intronic
1060695774 9:125707534-125707556 AACCCAGGTCTTTCTCAGAGAGG - Intergenic
1061623001 9:131823922-131823944 CAGACAGCTCTTTCTGCGTGGGG + Intergenic
1062011530 9:134269596-134269618 AACTCAGCTCTTCCCCAGTCAGG - Intergenic
1191108148 X:56785008-56785030 AACTCTGCTCATTCCCAGTGCGG - Intergenic
1191590169 X:62874066-62874088 GACTGAGCTCTTTCTACCTGAGG + Intergenic
1192094525 X:68196715-68196737 AACTCAGCTTATTCTCTTTGAGG - Intronic
1192351832 X:70362293-70362315 AACTCAGCTCTTTCTCCGTGGGG + Intronic
1193108309 X:77703424-77703446 GCATCAGCTCTTTCTCTGTGAGG + Intronic
1193693812 X:84681326-84681348 AGGTCAGCTCTTTCTCTGCGGGG + Intergenic
1195879897 X:109581636-109581658 AACTGCGGTCTTTCTCCCTGAGG - Intergenic
1200871933 Y:8111128-8111150 AACAAAACTCTTTCTCCCTGAGG + Intergenic
1200888518 Y:8297348-8297370 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1202100753 Y:21305200-21305222 AACAAAACTCTTTCTCCCTGGGG + Intergenic
1202244037 Y:22797926-22797948 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1202397025 Y:24431676-24431698 AACAAAACTCTTTCTCCCTGAGG - Intergenic
1202473758 Y:25238416-25238438 AACAAAACTCTTTCTCCCTGAGG + Intergenic