ID: 1192352643

View in Genome Browser
Species Human (GRCh38)
Location X:70370309-70370331
Sequence GCTTACTTCTGGAGGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192352643 Original CRISPR GCTTACTTCTGGAGGGGGAC TGG Intronic
900523593 1:3117652-3117674 CCCTACTTCTGGAGGGGGCCCGG + Intronic
900875998 1:5343081-5343103 ACATCCTTCTGGAGGGGAACAGG + Intergenic
902186067 1:14726368-14726390 GCTTCCTTCTGGTGGGGAACAGG - Intronic
902324704 1:15692143-15692165 GCTCATTCCTGGAGAGGGACTGG + Intronic
902527978 1:17071577-17071599 GCTAACTGCTGGACTGGGACTGG + Intronic
902627660 1:17685982-17686004 GCTTACTCCAGGAGCAGGACGGG - Intronic
903373209 1:22850182-22850204 CCTCCCTTCTGGAGGGGGAGGGG + Intronic
903476440 1:23622237-23622259 GTTTACTTCTGGAGGAAGGCAGG - Intronic
907390392 1:54154305-54154327 GCTTACCTGTGGAGGTTGACTGG + Intronic
907425284 1:54375634-54375656 GGAGGCTTCTGGAGGGGGACTGG - Intronic
908561531 1:65310792-65310814 GCTTACTTCTGCAGGGAACCAGG + Intronic
908935045 1:69365013-69365035 GCTTCCTGCTGGAGGTGGAGAGG + Intergenic
909277154 1:73701246-73701268 GGTTACTTCTGAAGGTGAACTGG + Intergenic
909726367 1:78840845-78840867 ACTTACTTCTAGAGGGTCACTGG - Intergenic
914824444 1:151131554-151131576 TCTTACTTAAGGAGCGGGACGGG - Intergenic
918734550 1:188042597-188042619 GTTTACTTTTGGAGGAAGACAGG + Intergenic
918973288 1:191447829-191447851 GCATACCTTTGGAGGGGGAGAGG + Intergenic
920831492 1:209469826-209469848 GCTTATAGCTGGAGGGGGATGGG - Intergenic
920965464 1:210697392-210697414 GCTGCCTCCTGCAGGGGGACTGG + Intronic
921539688 1:216398646-216398668 GCTTACTTCTGTTGGGTGAGAGG - Intronic
1063692690 10:8302352-8302374 GCGGGATTCTGGAGGGGGACCGG + Intergenic
1068734179 10:60393231-60393253 GCTGCCTTCTGGAGGAGGGCTGG - Intronic
1071869049 10:89771635-89771657 GCCTTCTTATGGAGGGGAACAGG + Intronic
1074383181 10:112996627-112996649 GCTGACTTCTGGAGGGCACCTGG + Intronic
1074420870 10:113307950-113307972 GCTTCCTACTAGAGGGGAACAGG - Intergenic
1076615463 10:131751616-131751638 GCAGCCTCCTGGAGGGGGACAGG - Intergenic
1080171462 11:29308006-29308028 GCTAGCTTCTGGATGGGGTCTGG - Intergenic
1084171774 11:67404412-67404434 GCTGAATTCTGGAGGGAGGCCGG + Intronic
1084357691 11:68650954-68650976 GCTGCCTTCGGGAGGGGGACAGG - Intergenic
1084388019 11:68856133-68856155 GCTTACTTCCAGAGGGGGAGTGG - Intergenic
1086075480 11:82846454-82846476 GATTACTTCTGGTGGGGTGCAGG + Intronic
1090376823 11:126295531-126295553 GGTTATTTCTGGTGGGGGAAGGG - Intronic
1090751115 11:129747311-129747333 GCAGACTTCTGGAGGGAAACAGG + Intergenic
1091834797 12:3577948-3577970 GGTTACCTCTGGAGGAGGATGGG - Intronic
1093673055 12:21900402-21900424 GCGTTCTTTTGGAGGGGGAGAGG - Intronic
1094398012 12:30029507-30029529 GCTTGATGGTGGAGGGGGACAGG + Intergenic
1097857559 12:64481292-64481314 GCATATTTCTGGAGGGTAACAGG + Intronic
1098227942 12:68344091-68344113 GCATTCTACTGGAGGGAGACAGG + Intergenic
1098261894 12:68680335-68680357 GCTTTCTTTTGGAGGGGGTCTGG + Intergenic
1102031242 12:109741312-109741334 CCTTGCTTCTGGAGGGCTACAGG - Intronic
1102144186 12:110642320-110642342 GCTTAGCACTGGAGGGGGTCCGG + Exonic
1103892268 12:124248846-124248868 TGTAACTTTTGGAGGGGGACTGG + Intronic
1103982842 12:124747756-124747778 GCTTACTTCTGGGGAGAGTCTGG - Intergenic
1103983612 12:124752754-124752776 CCTGACTTCTGGTGGGGGACGGG - Intergenic
1104672391 12:130689632-130689654 GCTTAGCTGGGGAGGGGGACGGG + Intronic
1105969113 13:25412139-25412161 GCATCCTCCAGGAGGGGGACAGG + Intronic
1110284693 13:73735657-73735679 GCTTACTTCTGGAGGAGTTGAGG + Intronic
1111978105 13:94988681-94988703 GCTTTCTTTTGCAGGGAGACTGG + Intergenic
1116611795 14:47083893-47083915 GCTTTTTTTTGGAGGGGGAAGGG - Intronic
1116995830 14:51323233-51323255 GATCACTTCAGGATGGGGACTGG + Intergenic
1118501660 14:66367912-66367934 GATTACTTTTGTAGGGGGAAAGG + Intergenic
1122825123 14:104367069-104367091 TCTTCCTTCAGGAGGGGGCCTGG - Intergenic
1127057250 15:55144257-55144279 GCGTTCCTTTGGAGGGGGACAGG - Intergenic
1128895751 15:71372328-71372350 GCTTTCCTTTGGAGGGGGAGAGG + Intronic
1129280538 15:74481402-74481424 GTCTTCTTATGGAGGGGGACGGG + Intergenic
1130644827 15:85715052-85715074 GGTTACCTCTGGGGTGGGACAGG - Intronic
1132647811 16:1007157-1007179 GCCTTCTTCTAGATGGGGACAGG + Intergenic
1133026829 16:2992252-2992274 GTTTATTTCTGGGGGAGGACAGG + Intergenic
1133124572 16:3637702-3637724 TCATACTTCTGGCGGGGGAGGGG - Intronic
1133456258 16:5945041-5945063 GGCTTCTTCTGGAGGGAGACTGG + Intergenic
1133972368 16:10577488-10577510 GCTAACTTCTGCAGGGAGCCAGG + Intronic
1134188030 16:12099611-12099633 GCTTCCTTCTGGAGGCCGACAGG - Intronic
1136096526 16:27960982-27961004 GATACCTTCTGGAGGGGCACAGG + Intronic
1137808633 16:51330887-51330909 GCATTCCTCTGGAGGGGGAGAGG - Intergenic
1139651284 16:68363490-68363512 GCTTACTTCTGCAGGTTGTCGGG + Exonic
1140506765 16:75478504-75478526 GCCTACTTGGGGAGGGGGAGGGG + Exonic
1141253312 16:82378591-82378613 GGTTACCTCTGGAGGGTGATTGG + Intergenic
1141809917 16:86368958-86368980 TCTTACGTGTGGAGGGGGAGGGG - Intergenic
1142545925 17:702761-702783 GCTTTCTGCTGGAGGGGAAAGGG + Intronic
1143019340 17:3908701-3908723 GGTTATTTCTGGAAGGGGAGAGG - Intronic
1144708598 17:17385981-17386003 GCTGACTGCTGGAGGGGGGCTGG - Intergenic
1144820688 17:18071528-18071550 GGTTATTTCTGCAGGGGGAGGGG + Intergenic
1149990527 17:61380710-61380732 GGTCTCTTCTGGAAGGGGACTGG + Intronic
1151277344 17:73045423-73045445 GCTTAGTTTTGGAGCAGGACTGG - Intronic
1156315662 18:35966650-35966672 GGTTCATTCTGGAGGGGAACAGG + Intergenic
1157790590 18:50527788-50527810 GCTTGTTTCTGGAGGGGGAAAGG + Intergenic
1160786248 19:901324-901346 GGGTGCTTCTGGCGGGGGACGGG + Intronic
1161052298 19:2170889-2170911 GGAGACTCCTGGAGGGGGACAGG - Intronic
1162854000 19:13454261-13454283 GGTAGCTTCAGGAGGGGGACTGG - Intronic
1162891346 19:13735478-13735500 AATAACTTCTGGTGGGGGACGGG - Intronic
1165481136 19:36064973-36064995 GCGTATTTCAGGAGGGGAACTGG + Intronic
925010791 2:484437-484459 GCTCATTCCTGGTGGGGGACCGG - Intergenic
926382739 2:12306656-12306678 GTGGACTACTGGAGGGGGACAGG + Intergenic
928598297 2:32878195-32878217 GCTTTTTTCTGGTGGGGGAAAGG + Intergenic
930828748 2:55720301-55720323 GCTTTCTTCTGGAGAAGGACTGG - Intergenic
931797536 2:65725496-65725518 CCTGACTTCTGGAGAGGGAGAGG + Intergenic
932883633 2:75527527-75527549 CCTTACTGCTGGATGGGGATGGG - Intronic
932978349 2:76631751-76631773 TCTTACTTCTGGAATGGGAGGGG - Intergenic
934767099 2:96885697-96885719 GCTTCCTGCTGGTGGGGGTCAGG + Intronic
936698274 2:114977610-114977632 GCTTTCTTGAGGTGGGGGACAGG - Intronic
937238799 2:120447057-120447079 GCATAGTTCTGGAAGGGGCCTGG + Intergenic
938693698 2:133815795-133815817 CCCTGCTGCTGGAGGGGGACAGG - Intergenic
946907308 2:224429452-224429474 ACTTAGTTCTGGAGGGGTAAGGG - Intergenic
1169965215 20:11210019-11210041 CCTTACCTCTGGAAGGGTACAGG - Intergenic
1171180796 20:23089024-23089046 GCCTACATGTGGAAGGGGACTGG + Intergenic
1175916430 20:62428131-62428153 GCCTTCTGCTTGAGGGGGACTGG + Intergenic
1178101245 21:29270972-29270994 GCATACTTCTGGAGGGAGGATGG + Intronic
1178421203 21:32444765-32444787 GCTAGCTTCAGGATGGGGACTGG - Intronic
1181632883 22:24160629-24160651 GCTTACTCCTGGAGGGGCAGGGG - Intronic
950466278 3:13156772-13156794 GCTGACATCTGAAGGGGGATTGG + Intergenic
950865192 3:16183133-16183155 GCTCACTTCTGGAGGGGTTCAGG - Intronic
951383390 3:22013836-22013858 GCTTATTTTGGGAGGGGGAGGGG - Intronic
951808158 3:26669878-26669900 GCTTCCTTGAGGATGGGGACTGG + Intronic
951957988 3:28278586-28278608 GGTTTCTTCTGGAGGGAGAGTGG - Intronic
953986032 3:47443752-47443774 GTTAACTTATGGAAGGGGACGGG - Intronic
955352962 3:58207446-58207468 GGTTACTTCTGGTGGGGGGGGGG - Intronic
957678572 3:83403592-83403614 GCTGACTGCTGCAGGGAGACAGG + Intergenic
958054365 3:88390044-88390066 GCTTAGCTCTGAAGGTGGACGGG + Intergenic
958904988 3:99932183-99932205 GGTTACTTCTGGAGTGGGAAGGG - Intronic
960480457 3:118181788-118181810 ACTTATTACTGGAGGGGGAGGGG - Intergenic
960612474 3:119568220-119568242 GCATACCTTTGGAGGGGGAGAGG + Intergenic
961792174 3:129384144-129384166 TCTGAATTGTGGAGGGGGACAGG + Intergenic
961806196 3:129491056-129491078 TCTGAATTGTGGAGGGGGACAGG + Intronic
963387839 3:144619673-144619695 GCATTCTTTTGGAGGGGGAGAGG + Intergenic
964435238 3:156644207-156644229 GCTCACTGATGGAGGGGGATGGG - Intergenic
966415227 3:179682415-179682437 GGTTACTTCTGGCGAGGGAGAGG - Intronic
966464206 3:180211839-180211861 GCTTTTTTTTGGAGGGGGGCAGG - Intergenic
966876499 3:184325123-184325145 CCTTGCATCTGGAGGGGGATGGG + Intronic
966975826 3:185082447-185082469 GCTTACTTCTGGGAGGTCACTGG - Exonic
971643910 4:29171613-29171635 GGATACTTCTGGAAGGGAACAGG - Intergenic
973219644 4:47710984-47711006 GGTGACTTCTGCAGGGGCACAGG - Intronic
974074674 4:57157644-57157666 GCTTCCTGCTGCAGTGGGACTGG - Intergenic
977843889 4:101743943-101743965 GCTTTCCTTTGGAGGGGGAGAGG + Intronic
978012852 4:103708598-103708620 GCTTTCCTTTGGAGGGGGAGAGG - Intronic
980969641 4:139556511-139556533 CCTTACTTCTGGAAAGGGACAGG - Exonic
981149757 4:141367758-141367780 GCTTTCCTTTGGAGGGGGAGAGG + Intergenic
988450174 5:31334133-31334155 GATTATTTCTGGAGTTGGACTGG - Intergenic
990778949 5:59336334-59336356 GGTTACTGATGGATGGGGACAGG - Intronic
991185428 5:63801074-63801096 CCTTACATCTGGAGGGGGCTGGG - Intergenic
992325580 5:75656477-75656499 GCTTCCTTCTTGTGGGGGAAAGG - Intronic
995716800 5:115088380-115088402 GGTTACTTTTTGAGGGTGACTGG - Intergenic
997578554 5:135003002-135003024 GCGTTCCTTTGGAGGGGGACAGG + Intronic
998112982 5:139516361-139516383 GGTGACAGCTGGAGGGGGACTGG + Intergenic
1002782527 6:378533-378555 GCTTCCTTCTGGAGAGCGATGGG - Intergenic
1003604716 6:7548743-7548765 GCTCACTGCTGGAGTGGGAATGG + Intronic
1003731417 6:8828859-8828881 GCTTACTTCTGTAGGAAGAAGGG + Intergenic
1004700627 6:18076009-18076031 GCTTAGTTCTGGAGGGGTTTAGG + Intergenic
1006835962 6:36999029-36999051 GCTTTCTTCTGGAAGGGTGCTGG - Intergenic
1007624526 6:43236755-43236777 GGTTACTTTTGGAGGGAGAAAGG - Intergenic
1008715367 6:54282897-54282919 GGTTACTCCTGGAGGGAGAGAGG + Intergenic
1010363962 6:75028306-75028328 GCTTAGCAGTGGAGGGGGACAGG + Intergenic
1011785964 6:90845365-90845387 GCTTACTTCTTCAGGTGGATTGG + Intergenic
1013127286 6:107196713-107196735 CCTGACTTCAGGATGGGGACTGG + Intronic
1013536273 6:111065999-111066021 GCATCCTTATGGAGGGAGACAGG - Intergenic
1014981049 6:127946824-127946846 GGTTCCTTTTGGAGAGGGACCGG - Intergenic
1015142651 6:129952960-129952982 GCTTACCTCTCGTGGGGGAGTGG + Intergenic
1015892265 6:137980643-137980665 GCTGACTTCTGGAGGTGGGAGGG + Intergenic
1016688068 6:146903679-146903701 GCTTCCTTCTGGAGAGGAAGAGG - Intergenic
1018432280 6:163731507-163731529 GCATCCTTCAGGAGGGGGCCTGG - Intergenic
1018647426 6:165961367-165961389 GCTTCCTTCTGAAGTAGGACAGG - Intronic
1020257516 7:6510393-6510415 GCTGACATCTGGAGGGAGACGGG + Exonic
1021906900 7:25343441-25343463 GCTTCCTTTTGGAGGCTGACAGG + Intergenic
1022096646 7:27145376-27145398 GCATCCTTGTGGAGCGGGACTGG + Exonic
1022157014 7:27670949-27670971 AATTACTTTTGGATGGGGACTGG - Intergenic
1024613474 7:51086954-51086976 GCTTACTGCTGGAGAGGGGGTGG - Intronic
1028723925 7:94065435-94065457 GCCTACTACTGGTGGGTGACTGG + Intergenic
1030078343 7:105755956-105755978 GCTTACTTTTGGAGGGAGGTGGG - Intronic
1031892812 7:127314698-127314720 GGTTACTTCTGGAGGGAGGGAGG - Intergenic
1034958302 7:155349668-155349690 GCTTCCTGCGGGAGGGGGGCGGG - Intergenic
1035406409 7:158601184-158601206 TCTTACTTCTGGGAGAGGACTGG - Intergenic
1035529883 8:342826-342848 TCTTACTTCTTAAGGGGGACAGG + Intergenic
1039599176 8:38819947-38819969 GCTTTCTTCCTCAGGGGGACAGG - Exonic
1041525577 8:58801665-58801687 ACTTACTTCTGGTGGGGGTAGGG - Intergenic
1042506068 8:69562309-69562331 CCTTAATTCTGGAAGGTGACAGG - Intronic
1042731355 8:71938895-71938917 GCGTTCTTTTGGAGGGGGAGAGG + Intronic
1045909449 8:107389412-107389434 GGATAATTCTGCAGGGGGACGGG + Intronic
1048259596 8:132934481-132934503 GCTTTCCACTGGAGGAGGACAGG - Intronic
1049213037 8:141395513-141395535 CCTTCCTCCTGGAGGGGAACTGG + Intronic
1049263075 8:141650111-141650133 GCTGTCTTCTGGTGGGGGTCAGG + Intergenic
1051090378 9:13400167-13400189 GCTTTCTTTTGGTGGGGGAAGGG + Intergenic
1051292651 9:15560785-15560807 GCGTTCTTTTGGAGGGGGAGAGG + Intronic
1051312530 9:15791916-15791938 GCGTTCCTCTGGAGGGGGAGAGG - Intronic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1056606456 9:88089746-88089768 TCTTGTTTCTGGATGGGGACTGG + Intergenic
1057713249 9:97466279-97466301 GCTTACTTCTGGAGAGGGTCAGG - Intronic
1058384945 9:104424733-104424755 GCATACTTCAGGAGCGGGAAAGG - Intergenic
1059324715 9:113497228-113497250 GGCTACTTTTGGAGGGGGATTGG + Intronic
1059372430 9:113853401-113853423 GCTTTCTTTTGGAAGAGGACTGG + Intergenic
1061921132 9:133783218-133783240 GCTTCCTCCTGGAGTGGGGCAGG + Intronic
1187924238 X:24235813-24235835 AGTTGCTTCTGGATGGGGACAGG - Intergenic
1192352643 X:70370309-70370331 GCTTACTTCTGGAGGGGGACTGG + Intronic
1192666992 X:73098984-73099006 GCTTTCTTTTGGAGGAGGAGAGG + Intergenic
1193051272 X:77102459-77102481 GCATTCCTTTGGAGGGGGACAGG + Intergenic
1193849957 X:86524785-86524807 GCTTATTTCTGGAGGTGGAGGGG + Intronic
1193932242 X:87567794-87567816 GGGGACTTCTGGAGGGGGAAGGG + Intronic
1194147558 X:90281757-90281779 GCTAACTGCTGCAAGGGGACTGG + Intergenic
1200493953 Y:3858518-3858540 GCTAACTGCTGCAAGGGGACTGG + Intergenic