ID: 1192355599

View in Genome Browser
Species Human (GRCh38)
Location X:70400534-70400556
Sequence ATGAATATGCAGATGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192355599 Original CRISPR ATGAATATGCAGATGGGAAA AGG (reversed) Intronic
901716454 1:11158768-11158790 ATGAACAAGCAGAGGGGAGAGGG + Intronic
902729162 1:18357337-18357359 ATGAAGATGGAGATGGGGATGGG + Intronic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903613436 1:24633862-24633884 ATGAATTTGGAGATGGTGAAGGG + Intronic
905717589 1:40165955-40165977 ATAAATAGGTAGATGGGGAAAGG - Intronic
905785072 1:40748908-40748930 AAGAAGCAGCAGATGGGAAATGG - Intronic
906030513 1:42716418-42716440 GTGGATATGTAGATGGGAGATGG + Intergenic
906302121 1:44690500-44690522 AAGAATAAGGAGATAGGAAAGGG - Intronic
906409634 1:45568335-45568357 ATGAAATTGCCGATGGGAAATGG + Intronic
907584513 1:55605101-55605123 ATGAATATGCAGCGCTGAAAGGG + Intergenic
907607579 1:55833830-55833852 ATGAATATGCTGGGGAGAAAGGG - Intergenic
907639082 1:56167470-56167492 CTGAATCTACAGGTGGGAAAGGG + Intergenic
907795432 1:57711397-57711419 TGGGCTATGCAGATGGGAAAAGG + Intronic
908151659 1:61309017-61309039 ATGAGTGTGCAAATGGAAAACGG - Intronic
908363830 1:63396999-63397021 CTGAATTTGCAGATCTGAAAAGG + Intronic
908518341 1:64916353-64916375 ATGAAAACACAGCTGGGAAAGGG + Intronic
908780846 1:67687936-67687958 ATGACTTTGCAGATGGAAAGAGG + Exonic
908847824 1:68342882-68342904 ATGAAGGTGCAGATGGGGAGTGG + Intergenic
909923841 1:81414941-81414963 ATGAATAACCAGATGGGAAACGG - Intronic
910163291 1:84297544-84297566 AGGAAAAGGCAGATGGGATAGGG - Intergenic
910892086 1:92029101-92029123 ATGGATTTTCAGATGTGAAAGGG + Intergenic
911797880 1:102097200-102097222 TGGACTATGAAGATGGGAAAAGG - Intergenic
912313508 1:108646326-108646348 ATAATTAAGCAGATGGGAAGGGG - Intergenic
913070527 1:115294199-115294221 ATAAAAATGCAGATGAGTAATGG + Intronic
914735136 1:150409164-150409186 ATTATTATGCAGAAGGGGAAAGG - Intronic
914774587 1:150724983-150725005 AAGCATATGCTGTTGGGAAACGG + Intergenic
915135534 1:153728635-153728657 ATGGAGTTGCAGAAGGGAAAAGG + Exonic
918098484 1:181353571-181353593 ATGAATATGCTGTTGGGTGACGG + Intergenic
918134240 1:181657266-181657288 CTGAATATGAGGAGGGGAAAGGG + Intronic
918689015 1:187457099-187457121 ATGAATATACATATGGTACAAGG - Intergenic
920727550 1:208450342-208450364 ATGCACAGGCAGATGAGAAAGGG + Intergenic
920797187 1:209150988-209151010 ATGAATATGAAGATGAGTCAAGG + Intergenic
920959110 1:210648571-210648593 CTGAATAAGCAGATTGGATACGG - Intronic
921555328 1:216591856-216591878 ATGAATAAGCTGATGGGGAATGG + Intronic
922223805 1:223628173-223628195 ATGAATAAGCAGATGTGTAAAGG + Intronic
922792944 1:228320398-228320420 ATGAGTATGTAGATGGCAGATGG - Intronic
923703351 1:236321010-236321032 ATTAATTTTCAGATGGGAAAAGG + Intergenic
1063498284 10:6530092-6530114 CTGGATATGCATATGGGACAGGG + Intronic
1064245858 10:13667242-13667264 ATGAATAGGCAGATGGGGGAGGG - Intronic
1065756421 10:28935155-28935177 ATAAATATTCAGACTGGAAATGG + Intergenic
1065784785 10:29203105-29203127 AGGAATTTGTAGGTGGGAAAAGG + Intergenic
1067161020 10:43825433-43825455 ATGAACATTCAGGTAGGAAAGGG - Intergenic
1067536759 10:47116357-47116379 ATAAATATCAAGATTGGAAATGG - Intergenic
1068242520 10:54322319-54322341 ATGCAGATGAAAATGGGAAAGGG - Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070549242 10:77477612-77477634 ATGAATATGGAGTTGGGGAGTGG + Intronic
1071615187 10:87069054-87069076 ATGAACATACATATGGAAAAAGG + Intronic
1073507634 10:104013751-104013773 ATGAAAAGGCACATGTGAAAAGG - Intronic
1074567758 10:114596720-114596742 ACAAATATGAAGGTGGGAAAGGG - Intronic
1074937444 10:118196319-118196341 ATGAATAAGCACATGAAAAAAGG - Intergenic
1075850120 10:125580067-125580089 ATGAACATGCAGCTCTGAAAAGG + Intronic
1075952809 10:126496711-126496733 TTGAATATGGGGATGGGGAAAGG + Intronic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076265605 10:129107624-129107646 ATGAAGATGCAGATGGGGAAGGG + Intergenic
1076272063 10:129162410-129162432 AAGATTATACAGATGGGTAAAGG - Intergenic
1076559101 10:131349588-131349610 ATGCATATGCAGAGGGCACATGG - Intergenic
1077758173 11:5058959-5058981 AAGAATATGCACATAAGAAAGGG + Exonic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079493650 11:21016698-21016720 ATCAATATACAGGTGGGAAAGGG - Intronic
1079623564 11:22585931-22585953 ATAAATATTCAAATGGTAAATGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1080371835 11:31656752-31656774 CTAAATATGCAAAGGGGAAAAGG + Intronic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1082076628 11:47980497-47980519 ATGAATATTCAGAGGGGGAGGGG + Intergenic
1086377276 11:86214207-86214229 ATGGATATATAGATAGGAAATGG - Intergenic
1086941003 11:92798541-92798563 ATGAAAATGGAAATGGGCAATGG - Exonic
1087844020 11:102950916-102950938 ATGAACTTGAAGATGGCAAAGGG - Intronic
1088189369 11:107210619-107210641 ATGAATTTGTAGATTGAAAATGG - Intergenic
1088964666 11:114706616-114706638 ATGAAAATGTTGATGGGAAAGGG - Exonic
1090598598 11:128346150-128346172 ATGCATATGGAGAGGGGGAAAGG + Intergenic
1091038213 11:132252866-132252888 ATGGATCTCCAAATGGGAAATGG - Intronic
1091055391 11:132413451-132413473 ATGAGTATAGAGATGGAAAAAGG + Intergenic
1091501202 12:1019630-1019652 ATGATTCTCCAGATGGGTAAGGG - Intronic
1094629026 12:32154020-32154042 ATAAAGTTGCAGACGGGAAAGGG + Intronic
1095398262 12:41785977-41785999 AGGAATATGCAGCTGAGAAATGG + Intergenic
1095478746 12:42611806-42611828 ATGAAGATACAGAGGGGAAGAGG + Intergenic
1095587804 12:43867426-43867448 AAGAGTATACAGATGGGACAAGG + Intronic
1098453954 12:70651334-70651356 TTGAATCTGGAGATGGGAGATGG - Intronic
1100366068 12:93921952-93921974 AAGAATGTGAAGATGGGAAAAGG + Intergenic
1100543600 12:95580642-95580664 ATGTATATGTAGGTGGGGAAAGG + Intergenic
1101235169 12:102781294-102781316 AAGAAAATGCAGAAGTGAAAGGG - Intergenic
1101801078 12:108022397-108022419 ATGGGTAAGCAGATGGGAAATGG - Intergenic
1102422690 12:112816493-112816515 ATGATTGTCCAGATAGGAAAAGG + Intronic
1104555769 12:129798682-129798704 ATGAATGTGCAGAAGAGAGAAGG + Intronic
1105637777 13:22232053-22232075 ATCAAAAAGCAGATGGGAAAAGG - Intergenic
1105988477 13:25593219-25593241 ATAACAATGCAGATGGGACAGGG + Intronic
1106363463 13:29053580-29053602 ATGAATATTCACCTGGGATAAGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107309957 13:39066122-39066144 ATGAATACACAGTGGGGAAAAGG - Intergenic
1107374476 13:39787016-39787038 AGAAATTTACAGATGGGAAATGG + Intronic
1107451336 13:40512784-40512806 ATGAAACTGAAGAAGGGAAAGGG - Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1110005474 13:70261164-70261186 ATGATTATTCACATGGAAAATGG - Intergenic
1110659512 13:78043098-78043120 ATTAAAATTCTGATGGGAAATGG + Intergenic
1110690220 13:78423929-78423951 ATGAATATGCAAAACAGAAAAGG - Intergenic
1111232393 13:85361140-85361162 ATTAATATGCAGTTGTGACATGG - Intergenic
1112323365 13:98427213-98427235 AAAACTATGGAGATGGGAAAAGG - Intronic
1112418060 13:99221113-99221135 ATGAATATCTAATTGGGAAATGG - Intronic
1113175380 13:107557742-107557764 ATGCATATGGAGATGGGATTTGG - Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116410925 14:44622516-44622538 ATGAATTTGCAGATAGGAATTGG - Intergenic
1116467056 14:45245977-45245999 GTAAATGTGCAGATGGTAAATGG - Intronic
1116778254 14:49206327-49206349 GTTAATATTCAGATAGGAAAAGG + Intergenic
1117199297 14:53372007-53372029 AAGAATATAAAGATGGAAAAAGG + Intergenic
1117838671 14:59834140-59834162 ATGAATATCCAAATGCAAAAAGG + Intronic
1118710970 14:68519040-68519062 ATGATTGTGAAGTTGGGAAAAGG - Intronic
1118953106 14:70452857-70452879 ATGAAGATGCAGTTGAGAATAGG + Intronic
1119176882 14:72574977-72574999 ATGAATATGGGGGTTGGAAAGGG + Intergenic
1120401914 14:84043042-84043064 CTGAAAATGCAGATGGCAAGTGG - Intergenic
1121760284 14:96439225-96439247 ATGAATATGGAGAAGAGATAGGG + Intronic
1122127368 14:99586559-99586581 GTAAATGTGCAGATGGGAAGCGG - Intronic
1122298421 14:100718410-100718432 AGGGACATGGAGATGGGAAATGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1125761262 15:42097134-42097156 ATGAATAGGCAGCTGGGAATAGG + Intergenic
1126748841 15:51854967-51854989 ATGAAAAGGAAGATGGTAAATGG + Intronic
1126961748 15:54004128-54004150 AGGAAGATGCAGATGGTTAATGG - Intergenic
1127202375 15:56669719-56669741 ATTATTCTACAGATGGGAAATGG + Intronic
1127686817 15:61354009-61354031 ATGAAGTTACAGATGGGAAGAGG + Intergenic
1129147063 15:73657894-73657916 AAGAATATGCTGCTGTGAAAAGG - Intergenic
1130263367 15:82377064-82377086 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130277936 15:82492602-82492624 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130470266 15:84219787-84219809 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130477754 15:84334354-84334376 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130494011 15:84453776-84453798 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1130577362 15:85104438-85104460 ATAAATAGGTAAATGGGAAAGGG + Intronic
1130592555 15:85224415-85224437 AAGAAAATTCAGAAGGGAAATGG + Intergenic
1130634693 15:85606447-85606469 ATAAATATGCATATCTGAAAAGG - Intronic
1131439075 15:92444996-92445018 ATGGAAATGCACCTGGGAAAGGG - Intronic
1131557003 15:93408318-93408340 AGGAATATGCAGATAGTAAGAGG - Intergenic
1131938385 15:97533436-97533458 ATGCATATGCAGGAGGGAGATGG + Intergenic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1135284421 16:21181123-21181145 TGGGATATGCAGATGGGACAGGG + Intergenic
1137012517 16:35336879-35336901 TTGAATTTGAACATGGGAAAAGG - Intergenic
1137477234 16:48819272-48819294 ATGAATATGCATATCGGATTTGG + Intergenic
1137991664 16:53163187-53163209 AAAAATATGTATATGGGAAATGG - Intronic
1138005737 16:53335263-53335285 AAAGACATGCAGATGGGAAAAGG + Intergenic
1138235848 16:55381857-55381879 ATGAATATGCAAATTTGAATTGG - Intergenic
1139337962 16:66246355-66246377 ATCAGAATGCAGATGGCAAAGGG + Intergenic
1139771066 16:69277633-69277655 ATAAATATGTAGTTGGAAAAGGG - Intronic
1140024897 16:71278151-71278173 ATAGATATGAAGTTGGGAAAGGG - Intergenic
1141408450 16:83815239-83815261 ATTAATATGGAAATAGGAAAAGG + Exonic
1141902426 16:87000379-87000401 AGCAAAATTCAGATGGGAAAAGG + Intergenic
1146466915 17:33093694-33093716 CTGAATATGCAGAAAGGACATGG + Intronic
1148946144 17:51262968-51262990 ATGAGTCTGCAGATGAAAAAAGG - Intronic
1149828062 17:59847748-59847770 GGGAACATGGAGATGGGAAAGGG - Intergenic
1151244488 17:72783961-72783983 AAGTAGAAGCAGATGGGAAAGGG + Intronic
1153551461 18:6266455-6266477 AAGAAGATGCAGATGGTAAAAGG + Intronic
1153729763 18:7999027-7999049 AGGAATAAGCAGATTGGAAAAGG - Intronic
1154013072 18:10592189-10592211 ATGAAGATGAAGCTGGGAAAAGG + Intergenic
1155524463 18:26702323-26702345 ATGACTACGCAGTTGGAAAAGGG - Intergenic
1155912112 18:31515950-31515972 GTGACCATGCAGATGGGAAAAGG + Intronic
1155958746 18:31976214-31976236 AAGAAAATTCAGAAGGGAAATGG - Intergenic
1156613415 18:38753672-38753694 ATGAGGTTGCAGATGGGAAGAGG - Intergenic
1156749339 18:40431601-40431623 ATTAATTTGCAGAAGGGCAAAGG - Intergenic
1157468957 18:47973135-47973157 AAGAATAAGTAGATGGGAGAAGG + Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158586332 18:58739244-58739266 ATCTATATTCATATGGGAAATGG + Intronic
1158753828 18:60298752-60298774 AAGAATAGAGAGATGGGAAAAGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159047264 18:63381265-63381287 CAGCATATGCAGATAGGAAAGGG - Intergenic
1159420426 18:68212013-68212035 ATGAATATGCATATATGATATGG - Intergenic
1160319147 18:77873980-77874002 ACTAATATGCACGTGGGAAAGGG - Intergenic
1162121117 19:8469507-8469529 ATTTGTATGCAGAGGGGAAAGGG + Intronic
1163197782 19:15735915-15735937 GTTAACAGGCAGATGGGAAATGG - Intergenic
1163224083 19:15943044-15943066 GTTAACAGGCAGATGGGAAATGG - Intergenic
1163809095 19:19419245-19419267 ATGAAAATGAAGATGAGAATTGG + Intronic
1164147853 19:22523422-22523444 ATAAACAGGCAGAAGGGAAATGG + Intronic
1164838517 19:31374729-31374751 ATGATTATCCAGAAGAGAAATGG - Intergenic
1164851511 19:31488250-31488272 TTGAATATGGTGATGGGGAAGGG - Intergenic
1166574605 19:43826054-43826076 ATGAAGTCCCAGATGGGAAACGG + Intronic
1167781746 19:51602829-51602851 TTGAGCAGGCAGATGGGAAAGGG - Intergenic
926498700 2:13624769-13624791 CTCTATCTGCAGATGGGAAAAGG + Intergenic
926644257 2:15271970-15271992 ATTAATATGCAGAAGGAAAAAGG - Intronic
926768859 2:16350283-16350305 ATGAATGTGCGGATTAGAAAAGG - Intergenic
929077621 2:38091554-38091576 AGGAATTTGCAGGTGGGTAACGG - Intronic
929831504 2:45350562-45350584 ATGAATTAGCAGATGTGACAGGG + Intergenic
930347147 2:50198061-50198083 ATAAAGATGCAGATGGATAATGG - Intronic
930547032 2:52781291-52781313 ATGAAATTGCAGATTGAAAATGG - Intergenic
931128305 2:59302389-59302411 ATGAATATGGATTTGGGAAAAGG + Intergenic
931297348 2:60941017-60941039 TTTAATATAGAGATGGGAAATGG + Intronic
932381282 2:71285932-71285954 AGGCATTTGCAGATGGCAAAAGG - Intronic
935733522 2:106086332-106086354 ATGAAAATACATATGGGTAAAGG - Intergenic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
937742605 2:125374263-125374285 ATGATTATGTATTTGGGAAAGGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938603486 2:132867573-132867595 AGGAATATGAAGATGATAAAGGG - Intronic
939602713 2:144212996-144213018 ATGAATATGCATTTTTGAAAAGG - Intronic
940006347 2:149012407-149012429 TTGAACATGCAGATGGGAAGAGG + Intronic
940628450 2:156207112-156207134 ATGAATATGTAGATCACAAATGG + Intergenic
940700941 2:157042007-157042029 ATTAATATGGAGGTGGGGAAGGG - Intergenic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941064227 2:160882871-160882893 GTCAATATGCAGATGGTAGAAGG + Intergenic
941715846 2:168762442-168762464 ATTAATATGCTGATTTGAAAGGG + Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
942206032 2:173620675-173620697 GTGAATCTGCTGATGGGATATGG + Intergenic
942918417 2:181341426-181341448 ATGAATAGGAAGATGGCAGAAGG - Intergenic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
945222363 2:207497827-207497849 ATGAATTTGAAGATGGAACAAGG - Intergenic
945539777 2:211070746-211070768 AAGAAGATGTAGATGAGAAACGG + Intergenic
946684045 2:222249391-222249413 CTGAAGATGAAAATGGGAAAAGG - Intronic
946782736 2:223207731-223207753 ATAAATATACAAATGAGAAAAGG + Intergenic
947078780 2:226372366-226372388 AAGAAGATGCAGATGGGCAGAGG + Intergenic
1170231802 20:14056008-14056030 TTGATTATGCAGATTGTAAATGG + Intronic
1171274476 20:23844304-23844326 ATAAATAGACAGATGAGAAAAGG - Intergenic
1171340775 20:24425925-24425947 ATGCAGATGCAGATGGAAATCGG + Intergenic
1171570494 20:26245707-26245729 ATGAATTTGGAAAAGGGAAAAGG + Intergenic
1173761298 20:45562820-45562842 ATGAAGACACATATGGGAAATGG - Intronic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174093995 20:48073444-48073466 ATAAACAAGCAGATGGGAAAGGG + Intergenic
1175150093 20:56926946-56926968 ATGAATATGCATATGTGATCAGG - Intergenic
1176314175 21:5226541-5226563 TTGAAGATGCAGATGACAAATGG - Intergenic
1177256071 21:18664104-18664126 CTGACTTTGAAGATGGGAAAAGG - Intergenic
1177829285 21:26118980-26119002 GTGAACATGCAGATAGAAAAAGG + Intronic
1177909240 21:27010326-27010348 ATCATCATGCAGGTGGGAAAAGG + Intergenic
1179162215 21:38907937-38907959 AGGATCATGCTGATGGGAAACGG + Intergenic
1180391985 22:12292661-12292683 TTGAAGATGCAGATGACAAATGG - Intergenic
1180407759 22:12572095-12572117 TTGAAGATGCAGATGACAAATGG + Intergenic
1182251287 22:29002924-29002946 ATGAAAAAGAACATGGGAAATGG - Intronic
1182380350 22:29882959-29882981 ATGGCTAGACAGATGGGAAATGG - Intergenic
1182983710 22:34697341-34697363 ATGAATAAAGAGATGAGAAATGG + Intergenic
1184653209 22:45928637-45928659 ATGGAAAGGCAGAAGGGAAATGG - Intronic
949323018 3:2832635-2832657 ATGAGTATGGACATGGGGAAGGG + Intronic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951175720 3:19597198-19597220 AAAAATAAGCAAATGGGAAAAGG - Intergenic
951370172 3:21836379-21836401 TTGAATATGCAGAAGTGTAAAGG - Intronic
952056186 3:29449956-29449978 GTCAACATGCAGATGTGAAATGG - Intronic
952206287 3:31184119-31184141 ATTATTTTGCAGATGGGAAATGG - Intergenic
952772967 3:37018971-37018993 ATTAATATGGAGATGGAACAAGG - Intronic
953175983 3:40552454-40552476 ATGGAGATGGGGATGGGAAAAGG + Intronic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955216874 3:56991265-56991287 ATGAATGAGCAAATGGGGAAAGG - Intronic
955387863 3:58493164-58493186 ACGAATATGTAGCTAGGAAAAGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955875289 3:63482805-63482827 ATGAATATGTACATGGATAATGG - Intronic
956364884 3:68490473-68490495 ATAGATATGCAGCTGGAAAATGG - Intronic
956601039 3:71022808-71022830 AAGGATATGCAGATGGCATAGGG + Intronic
956840663 3:73137015-73137037 ATTAATATGCAGCTGTGAATTGG - Intergenic
956937732 3:74122277-74122299 ATAAATATCCAAATGGGAATTGG + Intergenic
957108905 3:75927652-75927674 ATGAATTTGGAAAAGGGAAAAGG - Intronic
957141893 3:76370309-76370331 TTCAATATGCAGATGGGAATTGG + Intronic
958925298 3:100150657-100150679 ATGATTATTTAGATGTGAAATGG - Intronic
959337936 3:105089691-105089713 ATAACCATGCAAATGGGAAAGGG + Intergenic
959748525 3:109805818-109805840 AGCAATATGAAGATGGGATAAGG + Intergenic
959876757 3:111391762-111391784 AAGAATATTCAAATTGGAAAGGG + Intronic
959921030 3:111868452-111868474 ATGAATAAGCAAATGGCAAGGGG - Intronic
960827408 3:121804730-121804752 ATAAACATGCAGATGCAAAAAGG - Intronic
961969810 3:130949919-130949941 ATTAAAATGCAGATTAGAAATGG - Intronic
962539057 3:136359815-136359837 ATGTATTTTGAGATGGGAAAAGG + Intronic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
963535018 3:146516782-146516804 ATGAATATTCACATGGCAAGAGG - Intronic
964830149 3:160875015-160875037 ATGAATCTGCAGTTTGGAGAAGG - Intronic
965540867 3:169870291-169870313 ATGAATATGCAAAGAGAAAAAGG - Intergenic
966009500 3:175057007-175057029 ATGAAAATGCTGTTGGGAACAGG - Intronic
966669850 3:182514923-182514945 GTTAATATGCTAATGGGAAAAGG - Intergenic
967174823 3:186853500-186853522 ATGAGGGTGAAGATGGGAAAGGG - Intronic
967241888 3:187447569-187447591 ATGAATGTGCAAATGTGAATGGG - Intergenic
970065519 4:12089499-12089521 ATTAATATGCAAATGGAAAAGGG - Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971968190 4:33590534-33590556 ATGAATGTGCAGATGTGATCAGG + Intergenic
972267483 4:37476416-37476438 ATGAAGATGCTGAAGGGATATGG - Intronic
973642156 4:52914075-52914097 ATTCTTATGCAGAAGGGAAAAGG - Intronic
973800888 4:54476607-54476629 ATGAAACGGCAGCTGGGAAATGG + Intergenic
973948363 4:55984420-55984442 ATGAATATTCTGCTAGGAAAAGG - Intronic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974692953 4:65324130-65324152 ATGAAGGTGCAGCTGGTAAACGG - Exonic
974953907 4:68615507-68615529 TTGAATTTGCAGGAGGGAAAAGG + Intronic
976544271 4:86316510-86316532 ATGTATATGCATATGTGACAGGG - Intronic
976692424 4:87883035-87883057 ATGAGTATGCATATGGGAAGTGG + Intergenic
976796169 4:88935504-88935526 ATGAATATAAAGATAGGAAATGG - Intronic
976820139 4:89197021-89197043 ATGAATAAGCAACTTGGAAAAGG - Intergenic
976833398 4:89341548-89341570 AGTAATATGCAAATGGGAATGGG + Intergenic
976992813 4:91389423-91389445 ATGAATAAGCAAATAGGTAATGG - Intronic
977350084 4:95873107-95873129 ATCAATATGAACCTGGGAAATGG + Intergenic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
978311008 4:107385004-107385026 AAGAGAATGCAGAAGGGAAATGG + Intergenic
979009471 4:115349235-115349257 ATAAACATGCAGATGAAAAAGGG + Intergenic
979848545 4:125547104-125547126 ATGCCTAGGCAGATGGGAGAGGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982025471 4:151250017-151250039 GTGAATGAGCACATGGGAAAAGG + Intronic
982162249 4:152581833-152581855 ATGAAGAAGCAGTTAGGAAACGG + Intergenic
982303455 4:153903790-153903812 AGTAGGATGCAGATGGGAAAAGG + Intergenic
982387787 4:154831099-154831121 CTGAATAGGCAGATGACAAATGG + Intergenic
982502452 4:156173741-156173763 ATGAACATGCTGTTGGAAAATGG - Intergenic
982681575 4:158437387-158437409 AAGAATATGCCAATGGGAAAAGG + Intronic
983336505 4:166400374-166400396 ATAAATATGGAGTTGGGAAAAGG - Intergenic
984604404 4:181767997-181768019 ATGTAAATGCAGAAGGCAAATGG + Intergenic
984718174 4:182944794-182944816 TTGAAAGTGAAGATGGGAAAAGG - Intergenic
985786887 5:1900624-1900646 ATGAATATGCAGATGTGGAGAGG - Intergenic
986045976 5:4038437-4038459 ATGAATATGTAGAGTAGAAAAGG - Intergenic
986083420 5:4417665-4417687 AAGAATATGCAGCTTGGAAGGGG + Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986942634 5:12973769-12973791 ATATATATGCACATGGGGAACGG - Intergenic
989485828 5:41990944-41990966 ATGACAATGAAGATGAGAAAAGG - Intergenic
990072268 5:51797825-51797847 ATGAATATTCAGAAGGGTGATGG - Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
991419276 5:66424908-66424930 ATAAATAACCAGATGGGGAAAGG + Intergenic
992029149 5:72703145-72703167 ATTAAGATGCAGAAGGCAAATGG + Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
993518504 5:88867819-88867841 ATGTCGATGCAGATGGAAAAAGG + Intronic
994289405 5:98010634-98010656 ATGACTATGGGGATGGGATATGG - Intergenic
995554921 5:113317780-113317802 ATGAAGATGCAAATGGAAAAAGG + Intronic
996166782 5:120233636-120233658 ATCAATATGCAAATCAGAAATGG - Intergenic
997860488 5:137411105-137411127 ATGAAAATACAGTGGGGAAAAGG + Intronic
998168693 5:139859412-139859434 ATGAACATGGAAATGGGGAATGG + Intronic
1000500755 5:162046358-162046380 TTGAATATGCACATGAGAACTGG - Intergenic
1000972876 5:167734145-167734167 ATGAAAATGCAGATGGAGCAAGG + Intronic
1001092476 5:168751484-168751506 TAGATTATGCAGAAGGGAAATGG + Intronic
1001241959 5:170077960-170077982 GTGAGACTGCAGATGGGAAAAGG - Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1004842210 6:19600020-19600042 AAGAAAATGCAGGTAGGAAATGG - Intergenic
1005582205 6:27246088-27246110 ATGAATATGCAGTGAGCAAAAGG - Intergenic
1005887607 6:30108675-30108697 ATGGAAATGAAGATGGGAGATGG + Intronic
1006136568 6:31899720-31899742 AAGAATCTGGAGCTGGGAAAAGG - Exonic
1006307749 6:33234831-33234853 ATGAAAATACAGAGGGGAAGGGG + Intergenic
1007075072 6:39061027-39061049 AGGCAGATGCAGAAGGGAAAAGG + Intronic
1007150001 6:39680512-39680534 ATGAAACTGTAGAAGGGAAATGG + Intronic
1007942449 6:45794835-45794857 AAGAATCTGCAGATTGGAAGGGG - Intergenic
1008924920 6:56881585-56881607 TTGAGTTTGAAGATGGGAAATGG - Intronic
1009274942 6:61663519-61663541 ATATATATGCAGCTGGGACATGG + Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009962699 6:70543041-70543063 CTGAATATGTATGTGGGAAATGG - Intronic
1010116559 6:72318484-72318506 AAGAATATGCAAATGGGGGAGGG - Intronic
1010484979 6:76399923-76399945 CTTAATATGCAGAAGAGAAACGG + Intergenic
1010773638 6:79861055-79861077 ATGAGTATGGAAAGGGGAAAAGG + Intergenic
1010922215 6:81696795-81696817 ATGAATAAGCAGAGTGTAAAAGG + Intronic
1011736312 6:90313896-90313918 AAGAATATGCAGAAGGGGATGGG - Intergenic
1012942320 6:105428283-105428305 ATGTATTTGCATAAGGGAAATGG - Intergenic
1013388904 6:109663231-109663253 ATTAATATGATGATGGTAAACGG - Intronic
1013435150 6:110097247-110097269 ATGAAAATACAGATGTGAGATGG + Intergenic
1013855164 6:114563787-114563809 GTCAATATGGATATGGGAAAAGG - Intergenic
1014196881 6:118571071-118571093 ATGAATATCTAGGTGGGAAAAGG + Intronic
1014819781 6:125974876-125974898 ATGAAGGTGCAAGTGGGAAATGG - Exonic
1016397982 6:143647407-143647429 ATGAATAAACACATGTGAAATGG - Intronic
1016604716 6:145907186-145907208 GTGAATAAGCAGGTGGGTAATGG - Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017065144 6:150521912-150521934 ATGTATATACAGAGGGGAAAAGG - Intergenic
1018335448 6:162783144-162783166 ATGAATATGTAGAGGGTAAAAGG + Intronic
1018633414 6:165840027-165840049 ATGGAGATGGAGATGGGAATGGG - Intronic
1018633431 6:165840093-165840115 ATGAAGGTGGAGATGGGAATGGG - Intronic
1018661686 6:166093217-166093239 AAGAATAGGATGATGGGAAAAGG + Intergenic
1018983704 6:168619287-168619309 ATGATTATGCAGAAGAGAGATGG + Intronic
1019758722 7:2792773-2792795 AGGAATGTGCAGATGGAAAGGGG + Intronic
1020484776 7:8708030-8708052 ATGAATATGCAAATTTTAAATGG + Intronic
1021254101 7:18368621-18368643 ATAAAGGGGCAGATGGGAAAAGG - Intronic
1021256727 7:18401363-18401385 TTGAAGATGCAGTTGGGAAGAGG + Intronic
1021513580 7:21459779-21459801 ATGGATATGCAGTTGAGAAGTGG - Intronic
1021616031 7:22504223-22504245 ATGAATATGAAGGTAGGAAGAGG - Intronic
1021774199 7:24035904-24035926 GTGAAGATGAAGATGGGACAAGG + Intergenic
1022848596 7:34236450-34236472 ATGAACTTCCAGATGAGAAAAGG - Intergenic
1023259718 7:38346004-38346026 ATGTGTCTGCAGATGCGAAAAGG - Intergenic
1023260187 7:38350329-38350351 ATGAGTCTGCAGATGCGAAAAGG - Intergenic
1023261168 7:38359483-38359505 ATGAGTCTGCAGATGCGAAAAGG - Intergenic
1024602295 7:50994506-50994528 ATGAATAGGAAGGTGAGAAAAGG - Intergenic
1024646640 7:51376472-51376494 ATGAATGTGCAAATGGAAACTGG + Intergenic
1024929588 7:54656150-54656172 ATGAATATGGTGATTGGAAATGG + Intergenic
1025286012 7:57661772-57661794 ATGTATATGTATATGGAAAAGGG - Intergenic
1026312831 7:69202723-69202745 ATGAATTTGCAAAGGGGAATTGG - Intergenic
1026317184 7:69237555-69237577 ATGAACAGCCAGATGGGAGACGG + Intergenic
1027459227 7:78431600-78431622 AAGAAAATGCAGATGGTAAATGG + Intronic
1028021374 7:85779031-85779053 ATAAATATGCATATGGAAATAGG + Intergenic
1028376443 7:90150119-90150141 ATGAATATGAAGGTGGGAAGAGG + Intergenic
1028463568 7:91123550-91123572 ATGAATATCCAAATGAGAAGAGG + Intronic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1029823829 7:103170119-103170141 ATGAATATGAAGGTGGGAAGAGG - Intergenic
1029896940 7:103992737-103992759 ATGAATAGGCTTGTGGGAAAGGG + Intergenic
1029913832 7:104185076-104185098 ATTAATATGCATATGGGCACAGG - Intronic
1030067714 7:105673202-105673224 ATGAATAAGCGTATGGGGAAGGG - Intronic
1031281428 7:119805881-119805903 ATTAATATGCTCATGGGAAATGG + Intergenic
1031668398 7:124514018-124514040 AGGAATTTGCAGATGTAAAAGGG + Intergenic
1031670817 7:124542535-124542557 AGAAATGTGCAGAAGGGAAAAGG - Intergenic
1032179802 7:129665159-129665181 AAGGACTTGCAGATGGGAAATGG + Intronic
1032349853 7:131151300-131151322 AGTAATTTGCAGATGAGAAAAGG - Intronic
1032546087 7:132744168-132744190 CAGAATATGCAAATAGGAAAAGG + Intergenic
1032546679 7:132749552-132749574 ATCAATTTGCAGATGGGCCAAGG - Intergenic
1032722035 7:134558005-134558027 AAGAAAATGCGGATAGGAAATGG + Intronic
1032750889 7:134840247-134840269 ATGAATATCTATATGGAAAAAGG - Intronic
1032981842 7:137293019-137293041 ATGAATATGCATGTGGGTAAAGG - Intronic
1032997917 7:137468923-137468945 ATGAATATACAGAGGTGAGAAGG + Intronic
1033018722 7:137699496-137699518 ATGAATATGGAAATTGGAGAAGG + Intronic
1033668861 7:143470293-143470315 ATGCATAAGGAGATTGGAAAAGG - Intergenic
1034310165 7:150080319-150080341 GTGAAGATGCAGATGAGAGAAGG - Intergenic
1034658796 7:152751130-152751152 ATGAATATATAGCTCGGAAAGGG + Intergenic
1034796680 7:154020301-154020323 GTGAAGATGCAGATGAGAGAAGG + Intronic
1036536071 8:9653930-9653952 ATGCAGATGCAGACAGGAAATGG - Intronic
1038210900 8:25518274-25518296 ATGAGTAGGGAGAAGGGAAAGGG + Intergenic
1038619948 8:29132616-29132638 ATGAATGCTCAGATGGCAAAAGG + Intronic
1038794841 8:30700760-30700782 AAGAATAAGCAGAGAGGAAAGGG - Intronic
1039154002 8:34535105-34535127 ATGAATATGCTGATGAGCACAGG - Intergenic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040647074 8:49411511-49411533 ATGAATGTGGAGAAGGCAAAGGG - Intergenic
1040836959 8:51743036-51743058 ATCAATTTGCAGAAGGGCAAAGG + Intronic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040985386 8:53288403-53288425 AGGAATATGCAGAAGGAGAAAGG - Intergenic
1041945183 8:63432994-63433016 ATGAAAATGCAAAAGAGAAAGGG - Intergenic
1042455023 8:68990882-68990904 ATGAATAAACATATGTGAAATGG + Intergenic
1042467474 8:69144367-69144389 ATGAGGATGGAGATGGGAAGAGG - Intergenic
1042648234 8:71010783-71010805 ATGAAAATGCAGAAAGTAAAAGG - Intergenic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1043487432 8:80711807-80711829 GTAAATATGCATGTGGGAAAAGG + Intronic
1043615429 8:82119204-82119226 ATGATTATGCAGAAGGGAGAAGG + Intergenic
1043851613 8:85222594-85222616 ATCTACATGCATATGGGAAAGGG - Exonic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045002732 8:97892567-97892589 ATGGATATGTAGTTGGAAAAGGG + Intronic
1045235291 8:100347355-100347377 ATGTGAATGCAGAAGGGAAATGG - Intronic
1045235406 8:100348258-100348280 GGGAGTAAGCAGATGGGAAATGG - Intronic
1045796055 8:106045602-106045624 AAGAATATGCAGAAGAGATATGG + Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1047988844 8:130264709-130264731 ATGAATATGAACATGAGAAAGGG + Intronic
1048177402 8:132165035-132165057 ATAAATGTGCATATGGGAGAAGG - Intronic
1048472960 8:134719737-134719759 GTGAATGTGCAGAGGGGAAGAGG + Intergenic
1048940307 8:139394875-139394897 AGCACTATGCAGATGGGAAATGG + Intergenic
1050320578 9:4448220-4448242 ATGAATAGGCAAATGGGAATGGG - Intergenic
1051570113 9:18546522-18546544 ATGAATATGCTGCTTGGGAAAGG - Intronic
1051738523 9:20228496-20228518 ACAAATATGAAGATGGAAAATGG + Intergenic
1051961780 9:22774072-22774094 ATGAATATGCAATCGGCAAATGG - Intergenic
1053288373 9:36864464-36864486 GTGGATGTGCAGGTGGGAAAAGG + Intronic
1053391258 9:37738185-37738207 ATGAATGTGGAGATGGGAAGAGG + Intronic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1053722094 9:40956844-40956866 ATGAAGATGCAGATGACAAATGG + Intergenic
1054343877 9:63895129-63895151 TTGAAGATGCAGATGACAAATGG - Intergenic
1054837278 9:69690396-69690418 ATGATTCTACAGATGGGAACTGG - Intergenic
1055192979 9:73549813-73549835 GTGACTATGCAGAAAGGAAAAGG - Intergenic
1057713260 9:97466321-97466343 ATGCCTCTGCAAATGGGAAAGGG - Intronic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1058991470 9:110257859-110257881 ATGAATATGGATATAGGCAAGGG + Intergenic
1060130928 9:121098667-121098689 ATTAAAATGTACATGGGAAATGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1203453079 Un_GL000219v1:139113-139135 TTGAAGATGCAGATGACAAATGG - Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186070857 X:5818308-5818330 ATAAATTTGCAGATTGGGAAGGG + Intergenic
1187745034 X:22400101-22400123 ATGAATTTGCAGTTTGGGAAGGG - Intergenic
1187833402 X:23405969-23405991 TTGAATATGCAGTTACGAAATGG - Intergenic
1188837441 X:34976483-34976505 AAGACTTTACAGATGGGAAAGGG - Intergenic
1189733907 X:44049693-44049715 ATGAAGAGGCAGATTGGCAAGGG - Intergenic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1190397325 X:49998305-49998327 AGGAATATGCAAACAGGAAATGG - Intronic
1191572398 X:62645244-62645266 TTGATTACGCAGTTGGGAAACGG + Intergenic
1191708774 X:64124465-64124487 AAGAATATACATATAGGAAAAGG + Intergenic
1192106820 X:68325845-68325867 ATGGATATGGAGACGGGAGATGG - Intronic
1192252656 X:69425630-69425652 ATGAAGATACAGATTGGAGAGGG - Intergenic
1192355599 X:70400534-70400556 ATGAATATGCAGATGGGAAAAGG - Intronic
1192868055 X:75156694-75156716 AAGAATATGCATAGGGAAAATGG - Intronic
1193220789 X:78923921-78923943 ATGAATCAGCAGCTGGGAAATGG - Intergenic
1193655582 X:84193150-84193172 ACAAATATGCAGATGGATAAAGG - Intergenic
1194818883 X:98480828-98480850 CTGAGTAAGCAGATGGGAATTGG + Intergenic
1195230689 X:102843954-102843976 ATGAATATGCTATTGGGACAAGG + Intergenic
1196185887 X:112744399-112744421 ATGGCTATGCAGATGGAAGAAGG - Intergenic
1196631634 X:117947437-117947459 ATGAAACTGCAGATGTAAAAGGG + Intronic
1197647440 X:129033242-129033264 ATCAATTTGCAGGTGGGTAAAGG - Intergenic
1197689171 X:129478450-129478472 ATGAATAGGGAGAGGGGAGATGG - Intronic
1198425209 X:136511688-136511710 AAGAATATGCAGATGAAAAGGGG + Exonic
1198440626 X:136659798-136659820 GTGAAGATGCAGAAGGGAAATGG + Exonic
1198789613 X:140329787-140329809 ATGAATAGGCAGATGATAAATGG - Intergenic
1198946230 X:142018030-142018052 ATAAATATGCATATTGGGAATGG + Intergenic