ID: 1192357832

View in Genome Browser
Species Human (GRCh38)
Location X:70420442-70420464
Sequence GAGAACATAGAGTAGTAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192357832 Original CRISPR GAGAACATAGAGTAGTAGTC TGG (reversed) Exonic
907649901 1:56285261-56285283 GAGAACATAGGAAAGTTGTCAGG - Intergenic
911245230 1:95509513-95509535 GTTAACAAAGAGTAATAGTCTGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
916821641 1:168404474-168404496 GAGAAGATAGATTTGTAGTGGGG + Intergenic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
924658162 1:245992416-245992438 AAGAACATGGTGTGGTAGTCAGG - Intronic
1066055002 10:31672629-31672651 GATAATATACAGTAGTAGGCAGG + Intergenic
1067656511 10:48196191-48196213 GAGACCAGAGAGGAGGAGTCAGG + Intronic
1072238042 10:93469930-93469952 GAGAAAATAAAGGAGTAGGCCGG + Intronic
1072505464 10:96062137-96062159 GAGGAAACAGAGTGGTAGTCAGG - Intergenic
1073374560 10:103021760-103021782 GAAACCATAGAGTTGTATTCTGG - Intronic
1075719420 10:124576286-124576308 CAGAACATAAAGTACTAGTGTGG + Intronic
1077299755 11:1841489-1841511 AAGAACATCGAGGAGAAGTCTGG + Exonic
1077894437 11:6443196-6443218 GGGACCATAAAGTAGTATTCTGG - Intergenic
1081308293 11:41540339-41540361 TCCAACAGAGAGTAGTAGTCAGG + Intergenic
1084124964 11:67093451-67093473 CAGAAATTACAGTAGTAGTCAGG + Intergenic
1086607436 11:88712668-88712690 CAGAAAATAGACTAGGAGTCAGG + Intronic
1088503243 11:110505574-110505596 GAGACCATAGACTCGAAGTCAGG - Intergenic
1091515040 12:1170900-1170922 GATAAAATATAGTAGTATTCTGG + Intronic
1093674846 12:21926631-21926653 GAGAACATAGAGTGCACGTCTGG + Intronic
1094519546 12:31170536-31170558 AACAACATAGACTAGCAGTCTGG + Intergenic
1094798732 12:34004851-34004873 AAGAACACAGAGTAGCAGGCTGG + Intergenic
1095111481 12:38298926-38298948 AAGAACATAGAGTAGCAGGCTGG + Intergenic
1096017667 12:48293248-48293270 GGGAAGATAGAATAGTAGTGAGG - Intergenic
1096620372 12:52860896-52860918 TAGAACATAGAGGTTTAGTCTGG + Intergenic
1099876523 12:88413863-88413885 GTGAACTTAGAGTAGTTATCTGG + Intergenic
1101517015 12:105446220-105446242 CAGAAAATAGAGTATTAATCAGG + Intergenic
1103021738 12:117539895-117539917 GAGAAAACAGGGTAGGAGTCAGG + Intronic
1103117369 12:118347842-118347864 GAGAACTTGGACTAGTAGTGAGG - Intronic
1106773768 13:32988724-32988746 GAGAACACAGAGTATCAGTGTGG - Intergenic
1107332406 13:39315599-39315621 GAGATCATACAGTATTTGTCTGG + Intergenic
1108596908 13:51957207-51957229 GAGAACATAGAGTATGAATTAGG - Intronic
1108909962 13:55536200-55536222 GAGAACTTAAAGCAGCAGTCAGG + Intergenic
1111111008 13:83709422-83709444 AAGAATATAAAATAGTAGTCAGG + Intergenic
1111968383 13:94884198-94884220 GAGCCCATAGTGTAGTAGTGGGG - Intergenic
1115447038 14:33502453-33502475 GTGAACAGAGAGCAGAAGTCGGG - Intronic
1117010375 14:51464716-51464738 CAGAACGTAGAGTGGTAGTGAGG + Intergenic
1120268451 14:82280076-82280098 GGGAAGATAAAGTAGTAATCTGG - Intergenic
1120579057 14:86223587-86223609 GAGAACATGGACCAGTAGGCTGG + Intergenic
1121013656 14:90535601-90535623 GAGAACACAGGTTAGGAGTCCGG - Exonic
1124547104 15:30640039-30640061 GATAACCCAGAGTAGTAGTTTGG + Intronic
1124780703 15:32630001-32630023 GATAACCCAGAGTAGTAGTTTGG + Intronic
1137011041 16:35320424-35320446 GAGAACAAACAGGAGTTGTCCGG + Intergenic
1139447558 16:67007214-67007236 GAGAGCATAGAGGAGGTGTCTGG + Intronic
1143441423 17:6977434-6977456 AAGAACATATTCTAGTAGTCAGG + Intronic
1143484913 17:7248789-7248811 GTGCACATGGAGTAGGAGTCGGG + Intronic
1146040575 17:29449951-29449973 GAAAGCATAGAGTAATACTCTGG - Intronic
1146554124 17:33808842-33808864 GAGAAGATAGAATAGGGGTCAGG - Intronic
1151837205 17:76589867-76589889 GAGAACAAAGAGTTGCAGGCTGG - Intergenic
1156310158 18:35914771-35914793 GAGAACATAGAGTGATTGCCAGG - Intergenic
1157427625 18:47597511-47597533 TAGAACAGAGATTAGAAGTCAGG + Intergenic
1158166067 18:54541576-54541598 GAGTACATAGAGTAGAAATGTGG - Intergenic
925945782 2:8862110-8862132 CAGAACATAGAGTAATATTTTGG - Intronic
929681024 2:43994014-43994036 GAGAACATAGTTTAGTAGAAAGG - Intronic
930483093 2:51973960-51973982 AAGAACACAGAGCAGTAGTGTGG + Intergenic
931216692 2:60251493-60251515 GATAATATAGAGTATTAGTCAGG + Intergenic
933178472 2:79203049-79203071 GAGAGAAGAGAGTAGTAGTGAGG - Intronic
933317909 2:80737235-80737257 GGGAACTTAGAGAAGAAGTCAGG - Intergenic
934168228 2:89316311-89316333 GAGAAAATCCATTAGTAGTCAGG - Intergenic
934199058 2:89866270-89866292 GAGAAAATCCATTAGTAGTCAGG + Intergenic
935285499 2:101560647-101560669 GAGATCATACAGGAGTAGTATGG + Intergenic
935426315 2:102921808-102921830 GAGAACACAAAGGAGTTGTCAGG - Intergenic
937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG + Intergenic
945915817 2:215702880-215702902 GAAAACATACAGTAGTAAACTGG - Intergenic
946720600 2:222602197-222602219 GAGAACAGATAGTAGTTGTCTGG + Intronic
1169573832 20:6936370-6936392 GAGAATTTAGGGTAGTAGTGGGG + Intergenic
1172860700 20:38048689-38048711 GAGAACAGAGAGCAAAAGTCAGG - Intronic
1173281318 20:41630933-41630955 GAGAACAGAGAGTAGAGGTGAGG - Intergenic
1174436924 20:50514959-50514981 GAGAACCTAGACTACTAGTGTGG - Intronic
1180281095 22:10696828-10696850 GACAAGATAGAGTTGTAGACCGG - Intergenic
949635134 3:5974332-5974354 GAGAAAACAGAGTAGTACCCTGG + Intergenic
950173867 3:10857926-10857948 GAAAACATAATGAAGTAGTCAGG + Intronic
951420407 3:22477121-22477143 GAGAACATAGAATAATTGGCAGG - Intergenic
951799696 3:26582088-26582110 CAGAACACAGAGTTGCAGTCTGG - Intergenic
957949733 3:87109005-87109027 GAGAACATAGAGTAGCAAAAAGG + Intergenic
959487810 3:106948423-106948445 GAGAACATAGAGAGGTAAGCAGG + Intergenic
961800459 3:129444471-129444493 GAAAACATAATGTAGTAGACAGG - Intronic
963480938 3:145873882-145873904 GGGGACATAGAGTTGGAGTCTGG + Intergenic
964727083 3:159824567-159824589 GAGTACATAGAGTACAGGTCTGG - Intronic
965406445 3:168275090-168275112 GAGAGCATAGAGCAGCAGACAGG + Intergenic
966554250 3:181241376-181241398 GAGAACATAGTTTAGTGGTCAGG + Intergenic
968767157 4:2478567-2478589 GCCAACATAGAGTAGAACTCAGG + Intronic
970632897 4:17972195-17972217 GAAAATATTGAGTAGAAGTCAGG - Intronic
970858315 4:20673812-20673834 GAGAAGATACTGTATTAGTCTGG - Intergenic
971073295 4:23119690-23119712 AAGATCATAGAGTCGTAGGCTGG + Intergenic
976579026 4:86712890-86712912 TAAAACATAGGGTAGTAGTAAGG + Intronic
979490922 4:121326809-121326831 GAGAACAAAAGGCAGTAGTCAGG + Intergenic
982025723 4:151252442-151252464 GAGAACTGAGAGTAGTATCCTGG - Intronic
982743974 4:159087151-159087173 GAGAAAAGAGAATTGTAGTCAGG + Intergenic
986416505 5:7534179-7534201 GAGAACACAGATTAGAAGGCAGG - Intronic
988504506 5:31810148-31810170 GAAAAGATAAAGTAGAAGTCAGG - Intronic
990657928 5:57978343-57978365 GAGAACATACAGTAGTAGACAGG + Intergenic
993007224 5:82441639-82441661 GAGGACATAGGGTAGGAGTAGGG + Intergenic
995295418 5:110515506-110515528 AAGAAGGTAGAGTAGCAGTCAGG + Intronic
995654008 5:114403870-114403892 CAGAAAATAGAGTAGTCGTGGGG + Intronic
996905513 5:128595412-128595434 GAGAACATATAGGAGAAGGCAGG + Intronic
997086343 5:130804797-130804819 GAGAACAGAGAGTGGTAGCAGGG + Intergenic
999799220 5:155017743-155017765 GAGAGCAGAGAGCAGTAGTCTGG - Exonic
1000269975 5:159675039-159675061 TAGAACATAGAGTTGTAATGAGG + Intergenic
1003764750 6:9222370-9222392 GAGAACATAGAGGAATATACAGG + Intergenic
1006414704 6:33896540-33896562 GGGAAGATAGATTAGTAGTGAGG + Intergenic
1007879475 6:45147213-45147235 GACAATATAATGTAGTAGTCAGG - Intronic
1008416553 6:51247533-51247555 GAGAATACAGAATATTAGTCAGG - Intergenic
1010949292 6:82016087-82016109 AAGAACATTCAGTAGTAGGCAGG + Intergenic
1011850539 6:91622569-91622591 GAAAAAATAGAGGAGGAGTCAGG - Intergenic
1012801134 6:103829888-103829910 GAGGACATAGAGAAGTAATTTGG + Intergenic
1015508996 6:134018889-134018911 GAGAAGATAGAGAAGTGGTAGGG - Intronic
1016345125 6:143105128-143105150 GAGATCATAGCATAGTAGTGAGG + Intronic
1019843388 7:3472856-3472878 GAGAACATGGGGTAACAGTCAGG + Intronic
1024878532 7:54056434-54056456 GAGAACATAGGGTGGTTGGCAGG + Intergenic
1027377501 7:77567066-77567088 GAGACAATAGAATAGTGGTCGGG + Intronic
1027676454 7:81164241-81164263 AAGAACACAGATTAGGAGTCAGG - Intergenic
1029012792 7:97280140-97280162 GAGAATATAGAGTGTTAGTGAGG + Intergenic
1030898275 7:115088815-115088837 GAGTACAAAGAGCAGTATTCTGG + Intergenic
1031957472 7:127957057-127957079 CAGAACATTGAATAGTAGACTGG - Intronic
1034351482 7:150417664-150417686 GAAACCACAGAGTAGTAGCCAGG - Intergenic
1037258262 8:16979524-16979546 AAGAATATAGAGAAGCAGTCTGG + Intergenic
1038972028 8:32647016-32647038 AAGGACAAAGAGGAGTAGTCGGG + Intronic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1042692258 8:71513768-71513790 GACATCATAGAGTAGAAGGCTGG - Intronic
1043058797 8:75473979-75474001 GAGAACAAAAAGTAGGAGTTAGG + Intronic
1044172868 8:89078270-89078292 GAAAACATAGCATAGTACTCAGG + Intergenic
1046634285 8:116655707-116655729 TATAACATGGAGTAATAGTCTGG - Intronic
1051229233 9:14937046-14937068 AAGAACAAAGAATAGAAGTCAGG + Intergenic
1058746604 9:107997611-107997633 GAGAATATAGCTTAGTAGTTAGG + Intergenic
1188370927 X:29368769-29368791 GAAAACATAAAGTAGGACTCAGG + Intronic
1189893317 X:45628286-45628308 CAGAACATAGAATGGTGGTCAGG + Intergenic
1190229854 X:48573937-48573959 GAGGAGAAAGAGTAGGAGTCAGG + Intergenic
1191613506 X:63142257-63142279 TAGTACAGAGAGAAGTAGTCTGG - Intergenic
1191622791 X:63236670-63236692 TAGTACAGAGAGAAGTAGTCTGG + Intergenic
1191781107 X:64866763-64866785 GTGAACATAGAGAGGTGGTCTGG + Intergenic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1193349192 X:80438833-80438855 GGGAACATAGAGTTGTAATAGGG + Intronic
1194568475 X:95522785-95522807 GGGAACATTGGCTAGTAGTCTGG + Intergenic
1194788759 X:98119240-98119262 GGGAACATTGGCTAGTAGTCTGG + Intergenic
1195116739 X:101706955-101706977 TTGAAGATAGAGTAGTAGCCAGG + Intergenic
1197592216 X:128422204-128422226 GATAACATACTGTATTAGTCAGG - Intergenic
1199929118 X:152500572-152500594 GAGAACTTTGGGTAGTAGTCGGG - Intergenic