ID: 1192358565

View in Genome Browser
Species Human (GRCh38)
Location X:70424737-70424759
Sequence TCTCCAGGTAACAAGATTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192358556_1192358565 19 Left 1192358556 X:70424695-70424717 CCTGCCCGAAAAGAGGCTGGACC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1192358558_1192358565 14 Left 1192358558 X:70424700-70424722 CCGAAAAGAGGCTGGACCTCTTG 0: 1
1: 1
2: 0
3: 17
4: 128
Right 1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1192358561_1192358565 -2 Left 1192358561 X:70424716-70424738 CCTCTTGGGTGTCCCACTGACTC 0: 1
1: 0
2: 0
3: 18
4: 150
Right 1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1192358557_1192358565 15 Left 1192358557 X:70424699-70424721 CCCGAAAAGAGGCTGGACCTCTT 0: 1
1: 0
2: 1
3: 21
4: 149
Right 1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG 0: 1
1: 0
2: 0
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192358565 Original CRISPR TCTCCAGGTAACAAGATTAA AGG Intronic
902449208 1:16485898-16485920 TGTCCAGGTAGCAGGAGTAAGGG + Intergenic
908200468 1:61789860-61789882 GCTCCAGGGAACTAGAGTAATGG - Intronic
908988137 1:70050938-70050960 TCACTAGGTAGCAAAATTAAAGG - Intronic
910586900 1:88890721-88890743 TTTTCAGGTCACAAGATTAAAGG + Intronic
912262824 1:108126192-108126214 TATTCAGGTAACAACATTAAGGG + Intergenic
916148530 1:161763241-161763263 TCTCCAGGTAAGAAGACCACTGG - Intergenic
917164058 1:172091606-172091628 TCTTCAGGGAACAAGGTGAAGGG + Intronic
920547883 1:206833756-206833778 CCTCCAGGGGACAAGATGAAGGG + Intronic
922616990 1:226966525-226966547 TCTCCAGGTGATATAATTAATGG + Intronic
923638878 1:235731177-235731199 TCTGCAAGTAAAAAGATTAAAGG + Exonic
1065436554 10:25708871-25708893 TCTCCAGCTAACATGTTTCATGG - Intergenic
1068860143 10:61839621-61839643 TCTTCAGGTAATTATATTAATGG + Intergenic
1069466516 10:68644201-68644223 TCTCCAAGAAACAAAATCAAAGG - Intronic
1071334322 10:84588976-84588998 TCTGCAGGGAACAAGATGTAGGG + Intergenic
1071719872 10:88132160-88132182 TCTCCAGGAAACCAGCTTCAAGG + Intergenic
1076791958 10:132781589-132781611 TTTCCAGGTAAAAAAATTAATGG - Intronic
1078323197 11:10355428-10355450 TCAGCACGTCACAAGATTAATGG - Intronic
1078709963 11:13781720-13781742 TCTCAAGGTCCCAAGATAAAAGG + Intergenic
1080168417 11:29269130-29269152 TTTACAAGTCACAAGATTAAAGG + Intergenic
1085002546 11:73053812-73053834 TCTTCAAGTAACAACATTTATGG + Intronic
1085233232 11:74990710-74990732 TCTCCAGGTGATAAGAAGAATGG - Intronic
1085250841 11:75142802-75142824 TCTCCAGCAAACAAGCTGAATGG - Intronic
1085537043 11:77228068-77228090 TCTACAGATAAAAAGATTATGGG + Intronic
1088381792 11:109201198-109201220 TCTCCAAGTAACATCATTCATGG - Intergenic
1088547857 11:110979689-110979711 AATTCAGGTATCAAGATTAAGGG - Intergenic
1088592010 11:111411614-111411636 TCTGCAGGTAACAAGATCCTTGG - Intronic
1089988650 11:122837431-122837453 TGTACAGGTGACAAGATGAATGG + Intergenic
1094229261 12:28084119-28084141 TCTCCAGGAAAAAATATCAAAGG + Intergenic
1095520903 12:43064460-43064482 CCTCCAGGGAAAAATATTAATGG - Intergenic
1098045843 12:66399602-66399624 GCTCTAGTTAACAAAATTAATGG + Intronic
1099174568 12:79405919-79405941 TCTCCAGTTAATAAGATCTAAGG - Intronic
1101328350 12:103736670-103736692 TCACCAGGTAAATAGAGTAAAGG - Intronic
1111471472 13:88688759-88688781 TCTACTGGTAGCAAGATGAAAGG - Intergenic
1112146417 13:96705409-96705431 TCTCCAGGTGATAATATTCATGG + Intronic
1112626961 13:101116025-101116047 CCTCCAGGGAACAGGAATAAAGG - Intronic
1113237522 13:108296445-108296467 TTTCAAGGTTTCAAGATTAAAGG - Intronic
1115361703 14:32510515-32510537 TCTCCAGGGAATAAGATTGTAGG - Intronic
1115724573 14:36199029-36199051 TCTCCAGGGAAGAAGACAAAAGG - Intergenic
1116289407 14:43013806-43013828 TGACCAGGTAAGAGGATTAATGG - Intergenic
1119460341 14:74797504-74797526 TCTCCATGTAAGAATATTTAAGG - Intronic
1124814239 15:32972762-32972784 TCTCAAGGTACCAAGTTTGAAGG - Intronic
1125712357 15:41797298-41797320 TCTCCTGGTAATCTGATTAAAGG - Intronic
1127078837 15:55354898-55354920 TCTCTATGTAACCAGTTTAAGGG - Exonic
1127666988 15:61157566-61157588 TCTCCAGGAGCCAAGATTTAAGG + Intronic
1128027923 15:64454456-64454478 TCACCAGCTAAGAAGGTTAAAGG - Intronic
1128047813 15:64634444-64634466 TTTCCATGAAAGAAGATTAATGG - Intronic
1130317895 15:82811862-82811884 TATCCAGGTAATAATATTATGGG - Intronic
1131861366 15:96657020-96657042 TCTCCAGGTAAGAATGATAAAGG + Intergenic
1132426927 15:101725191-101725213 TCTCCTGTTATGAAGATTAAAGG - Intergenic
1136055338 16:27684077-27684099 TATTCAAGTAACAAAATTAAGGG + Intronic
1142390528 16:89796715-89796737 TCCCCAGGTAAGAAAATCAAGGG + Intronic
1144543636 17:16171260-16171282 TCTCCAAGTTACAGGATTACAGG + Intronic
1145866474 17:28245239-28245261 TCTCAAGGTAAGGAGAATAAAGG - Intergenic
1147511383 17:41071833-41071855 TCACCAAGCAACAAGATAAATGG - Intergenic
1148658053 17:49303200-49303222 TCTCTAGGTAATAAGATCATGGG + Intronic
1149324253 17:55513659-55513681 CCTCCATGTAACAATATTTAGGG + Intergenic
1150116900 17:62559966-62559988 GCTCCAAGGAAGAAGATTAATGG - Intronic
1151412199 17:73938377-73938399 CCTCAAGGTAAGAAGATTCATGG + Intergenic
1153246902 18:3081211-3081233 TCTCTGGGTAACATGAATAAGGG + Intronic
1153758252 18:8305117-8305139 TTTCCAGGTAAATAAATTAAAGG + Intronic
1157381625 18:47223751-47223773 TCTCTAGGTGGCAAGATTATGGG + Intronic
1158562618 18:58527964-58527986 TCTACTGGTGACAAAATTAAGGG + Intronic
1158829541 18:61262610-61262632 ACCCCAGGAAACAAGAATAAGGG + Intergenic
1159158580 18:64614637-64614659 TTGCCAGGAAACAAAATTAAGGG + Intergenic
1160043064 18:75362815-75362837 ACCCCAGGTAACAAAAGTAAGGG + Intergenic
1162256479 19:9494212-9494234 TTTCCACTTAACAAGATTGAAGG - Intronic
927561112 2:24074619-24074641 TCTCCAAGAAACAAGAATCAGGG - Intronic
932738138 2:74270210-74270232 GTTCCAGGTAGCAAGCTTAATGG - Intronic
933780886 2:85800100-85800122 TCTCCAGGTGATTAGATTATTGG - Intergenic
934592921 2:95573920-95573942 TCTCCAGGACACTAGCTTAATGG - Intergenic
936634964 2:114245411-114245433 TTTCCAGGCAATAAGATTTAAGG + Intergenic
938001135 2:127739240-127739262 TCTTCAGGAAAATAGATTAAGGG + Intronic
938027220 2:127960263-127960285 GCTCCAGGTGACAAGGTGAAGGG + Intronic
939389669 2:141550159-141550181 TCTCCAAGTAGCGAGATTACAGG + Intronic
941328516 2:164146765-164146787 TCTCCAGGTAAGATGATCAGTGG - Intergenic
941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG + Intronic
942370201 2:175275768-175275790 TCTCCAGGTTACAGGAAGAAAGG - Intergenic
944785903 2:203069916-203069938 TCTCCAGGTATTGAGATTACAGG + Intronic
948391348 2:237613668-237613690 ACTCAAGGTAACTAGAGTAAAGG + Intergenic
1169215493 20:3791867-3791889 TCTCCAAGTAAGAAGAAGAAAGG + Intronic
1169731576 20:8791830-8791852 TATCCAGGGAAGAAGTTTAAGGG - Intronic
1169843171 20:9961805-9961827 TTTCCAGGTAGCAAGATGAGGGG + Intergenic
1170706972 20:18752792-18752814 CCTCCAGGTAAGAAGAAGAATGG - Intronic
1171485088 20:25480542-25480564 TCTTCAGGGAACAGGATTTAGGG - Intronic
1171822499 20:29866287-29866309 TATCCAGGTTCCAAGATTTAAGG - Intergenic
1173724183 20:45285773-45285795 TCTCTAGGGAATAGGATTAACGG + Intergenic
1183807768 22:40226609-40226631 TATCCAGTTAACAAGATTGGAGG - Intronic
1184283534 22:43452882-43452904 TCCCCAAGTGCCAAGATTAAGGG + Intronic
950277565 3:11675829-11675851 TGTTCAGTTAACTAGATTAATGG + Intronic
952019926 3:29006211-29006233 ACTCTAAGAAACAAGATTAAAGG + Intergenic
955665328 3:61343927-61343949 GCTCCAGGTAACAAGACTGGTGG + Intergenic
956365391 3:68496484-68496506 TCTCCAGTTAACAGACTTAATGG + Intronic
961061269 3:123831273-123831295 TAGCCAGGAAACAAGATTAAGGG - Intronic
965964020 3:174464822-174464844 TCTTCAGGTAAAAATGTTAATGG + Intronic
966077230 3:175952064-175952086 TCTCCAGGCAAAAAGAATCAGGG - Intergenic
967996934 3:195173891-195173913 TCCCCAGGTCACGAGACTAAGGG + Intronic
968011241 3:195279041-195279063 TCTCTAGGTTACAAGATGATAGG - Exonic
973163922 4:47053394-47053416 TCTCAAGGCAAAAAGATTCAGGG + Intronic
974709113 4:65565188-65565210 TTTCCAGGAAATAAGATTCAAGG + Intronic
978719058 4:111884323-111884345 TTTCCAGGTTTCTAGATTAAAGG - Intergenic
979447332 4:120829764-120829786 TATCCAGCTAACATGACTAATGG + Intronic
981701409 4:147610900-147610922 TCCCCAGGGAAGAAGATTTAAGG - Intergenic
981833901 4:149032281-149032303 ACTCCATGTAACTAGATGAAAGG - Intergenic
982773123 4:159416282-159416304 TCTAGAGAGAACAAGATTAAAGG + Intergenic
983617842 4:169727435-169727457 TCACCAAGTGACAAAATTAAAGG + Intergenic
984488598 4:180403092-180403114 TCTCCTGGAAAAAAGCTTAATGG + Intergenic
985004315 4:185518325-185518347 TCTCCAAGTAAGAAGTTGAAAGG - Intronic
988080207 5:26404665-26404687 TCTAGAGGAAACAATATTAAGGG - Intergenic
988677771 5:33451110-33451132 TCTCCAGGGAAAAAAATAAAAGG + Intronic
995984370 5:118151446-118151468 CCTCCAGGTAGGAAGATGAAAGG - Intergenic
996505443 5:124263113-124263135 GCTCCAGGTAATAAAATTATAGG - Intergenic
998497110 5:142600630-142600652 ACTCCATGTAACAAGATTTCTGG + Intronic
1006081696 6:31571716-31571738 TGTCCAGGTGAAAATATTAATGG - Intergenic
1006397417 6:33796394-33796416 TCTCCAGACAACAAGAGGAAAGG - Intronic
1008001487 6:46364949-46364971 TCTCCAAGTACCAACATAAATGG + Intronic
1008251724 6:49248103-49248125 ATACCAGGTAACAAGATTACTGG - Intergenic
1009603481 6:65834999-65835021 TCTCCAGGTAACAAGTCTGATGG - Intergenic
1009621451 6:66083399-66083421 TAACCAGCTAACAAGATAAAAGG - Intergenic
1010898695 6:81399318-81399340 TCTTCAGGCAATAAGATTAAAGG - Intergenic
1013533788 6:111044550-111044572 TCGCCAGGTAAGAAGAGTACAGG + Intergenic
1015526846 6:134182192-134182214 TATACAGCTGACAAGATTAAGGG - Intronic
1016703246 6:147077533-147077555 TATCCAGGAAACCAGATTGATGG + Intergenic
1017379054 6:153806208-153806230 TCTCCTGGTACCAAGAAAAATGG + Intergenic
1021587707 7:22227579-22227601 TCCCCAGGTACCGAGATTACAGG - Intronic
1025067360 7:55868797-55868819 CCTCCAAGTAGCAAGATTCAGGG + Intergenic
1026890067 7:73976753-73976775 TCTCCAGGAAACAAAGTCAAAGG + Intergenic
1027546649 7:79535434-79535456 TTCCCAAGTCACAAGATTAAAGG + Intergenic
1027898863 7:84082047-84082069 ACTACAGGGAACAAGGTTAAGGG + Intronic
1030657811 7:112187000-112187022 TCTCTAGGTATCAGTATTAATGG - Intronic
1031309631 7:120179713-120179735 GCCCCAGGTAAAAAAATTAATGG - Intergenic
1031389369 7:121194496-121194518 TCTCCACATATCAAGACTAACGG + Intronic
1032046642 7:128615810-128615832 GCTCCAAGGAAGAAGATTAATGG - Intergenic
1032279238 7:130487450-130487472 TCTCCAGGTGACAGTATTAGTGG - Intronic
1032661317 7:133987047-133987069 TGTCCAGGCAACAACATCAAAGG + Intronic
1032693492 7:134313183-134313205 GCTCAAGAAAACAAGATTAAGGG - Intronic
1035887145 8:3303676-3303698 TCTTCAGCTAGCAACATTAAAGG - Intronic
1036573916 8:10006863-10006885 TCCCCACGTTACAAAATTAAAGG - Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1039149487 8:34487957-34487979 TCTGCAGTTAACAAGATGCATGG - Intergenic
1040783322 8:51137519-51137541 GCTCCAGGTAACAGCATCAAAGG + Intergenic
1050100557 9:2114803-2114825 TCTCCAGGTGATAAGATTATAGG - Intronic
1050527510 9:6558886-6558908 TCTTCAGGGAACAATATTTAGGG - Intronic
1052766719 9:32649024-32649046 TCATCAGGTCACAGGATTAAGGG - Intergenic
1053251366 9:36576865-36576887 TCTCCAAGTAAAATGATTCATGG + Intronic
1055201703 9:73671006-73671028 TCTACATGTAACAAGAATAGTGG + Intergenic
1055239998 9:74172264-74172286 TGTCCAGGTAACTATATGAATGG + Intergenic
1056122330 9:83501688-83501710 CCTCTAGGTAACAAGATGATTGG + Intronic
1056391209 9:86143153-86143175 TGACCAGTTAACAAGATTGATGG - Intergenic
1057039704 9:91839134-91839156 TCACCAATTAACAAGATGAAGGG + Intronic
1186347992 X:8714082-8714104 ACTCAAGGTAACAACATTCAGGG + Intronic
1187546870 X:20263905-20263927 TCTCCAGGTTAAAAGATTTCAGG - Intronic
1189534060 X:41918352-41918374 TCTCCAGCTAACAGCATTACTGG + Intronic
1192358565 X:70424737-70424759 TCTCCAGGTAACAAGATTAAAGG + Intronic
1192698408 X:73443055-73443077 TCTCCAGATGACAATAATAATGG + Intergenic
1198776362 X:140183649-140183671 TCTCCAGGTCACAATTTTCAAGG + Intergenic
1198806817 X:140502043-140502065 TAGCGAGGTAACAGGATTAAAGG + Intergenic
1198860999 X:141070353-141070375 TCTACAGGGAAGAAGACTAAAGG - Intergenic
1198901693 X:141517030-141517052 TCTACAGGGAAGAAGACTAAAGG + Intergenic
1199220783 X:145313842-145313864 TCTCCTGGTAAAAATATAAATGG - Intergenic
1199221737 X:145324186-145324208 TCTGCAGTTAAAAAAATTAATGG - Intergenic
1201587645 Y:15578765-15578787 TTTCCAGGTAAGGAGATTCAAGG + Intergenic
1201652452 Y:16304778-16304800 TCTCCAGATAGCAACAATAAAGG + Intergenic
1202142357 Y:21738565-21738587 TGTTCAGTTTACAAGATTAAGGG - Intergenic
1202144508 Y:21765237-21765259 TGTTCAGTTTACAAGATTAAGGG + Intergenic