ID: 1192360509

View in Genome Browser
Species Human (GRCh38)
Location X:70435812-70435834
Sequence CCATCCTTATGAAGGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192360509_1192360516 5 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360516 X:70435840-70435862 TTCAGCATGGTCCTAACACAGGG No data
1192360509_1192360517 6 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360517 X:70435841-70435863 TCAGCATGGTCCTAACACAGGGG No data
1192360509_1192360521 19 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360521 X:70435854-70435876 AACACAGGGGGCACAGAGCTGGG No data
1192360509_1192360514 -8 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360514 X:70435827-70435849 AAGGATGGAGTGCTTCAGCATGG No data
1192360509_1192360518 7 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360518 X:70435842-70435864 CAGCATGGTCCTAACACAGGGGG No data
1192360509_1192360515 4 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360515 X:70435839-70435861 CTTCAGCATGGTCCTAACACAGG No data
1192360509_1192360520 18 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360520 X:70435853-70435875 TAACACAGGGGGCACAGAGCTGG No data
1192360509_1192360522 20 Left 1192360509 X:70435812-70435834 CCCCACAGCCTTCATAAGGATGG No data
Right 1192360522 X:70435855-70435877 ACACAGGGGGCACAGAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192360509 Original CRISPR CCATCCTTATGAAGGCTGTG GGG (reversed) Intergenic
No off target data available for this crispr