ID: 1192360779 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:70437727-70437749 |
| Sequence | GATGATAAGTGGTTGGATTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192360779_1192360784 | 3 | Left | 1192360779 | X:70437727-70437749 | CCAGAATCCAACCACTTATCATC | No data | ||
| Right | 1192360784 | X:70437753-70437775 | GGTGCTACCACACTGGTCCAAGG | No data | ||||
| 1192360779_1192360787 | 23 | Left | 1192360779 | X:70437727-70437749 | CCAGAATCCAACCACTTATCATC | No data | ||
| Right | 1192360787 | X:70437773-70437795 | AGGCACAACCACCTCTCAGCTGG | No data | ||||
| 1192360779_1192360783 | -4 | Left | 1192360779 | X:70437727-70437749 | CCAGAATCCAACCACTTATCATC | No data | ||
| Right | 1192360783 | X:70437746-70437768 | CATCTCTGGTGCTACCACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192360779 | Original CRISPR | GATGATAAGTGGTTGGATTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||