ID: 1192360779

View in Genome Browser
Species Human (GRCh38)
Location X:70437727-70437749
Sequence GATGATAAGTGGTTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192360779_1192360784 3 Left 1192360779 X:70437727-70437749 CCAGAATCCAACCACTTATCATC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360779_1192360787 23 Left 1192360779 X:70437727-70437749 CCAGAATCCAACCACTTATCATC No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data
1192360779_1192360783 -4 Left 1192360779 X:70437727-70437749 CCAGAATCCAACCACTTATCATC No data
Right 1192360783 X:70437746-70437768 CATCTCTGGTGCTACCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192360779 Original CRISPR GATGATAAGTGGTTGGATTC TGG (reversed) Intergenic
No off target data available for this crispr