ID: 1192360784

View in Genome Browser
Species Human (GRCh38)
Location X:70437753-70437775
Sequence GGTGCTACCACACTGGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192360774_1192360784 30 Left 1192360774 X:70437700-70437722 CCTGTCAGCTCTCCCTTCCAAAT No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360777_1192360784 13 Left 1192360777 X:70437717-70437739 CCAAATACACCCAGAATCCAACC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360781_1192360784 -4 Left 1192360781 X:70437734-70437756 CCAACCACTTATCATCTCTGGTG No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360778_1192360784 4 Left 1192360778 X:70437726-70437748 CCCAGAATCCAACCACTTATCAT No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360782_1192360784 -8 Left 1192360782 X:70437738-70437760 CCACTTATCATCTCTGGTGCTAC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360776_1192360784 17 Left 1192360776 X:70437713-70437735 CCTTCCAAATACACCCAGAATCC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360775_1192360784 18 Left 1192360775 X:70437712-70437734 CCCTTCCAAATACACCCAGAATC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data
1192360779_1192360784 3 Left 1192360779 X:70437727-70437749 CCAGAATCCAACCACTTATCATC No data
Right 1192360784 X:70437753-70437775 GGTGCTACCACACTGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192360784 Original CRISPR GGTGCTACCACACTGGTCCA AGG Intergenic
No off target data available for this crispr