ID: 1192360787

View in Genome Browser
Species Human (GRCh38)
Location X:70437773-70437795
Sequence AGGCACAACCACCTCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192360785_1192360787 -10 Left 1192360785 X:70437760-70437782 CCACACTGGTCCAAGGCACAACC No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data
1192360779_1192360787 23 Left 1192360779 X:70437727-70437749 CCAGAATCCAACCACTTATCATC No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data
1192360781_1192360787 16 Left 1192360781 X:70437734-70437756 CCAACCACTTATCATCTCTGGTG No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data
1192360778_1192360787 24 Left 1192360778 X:70437726-70437748 CCCAGAATCCAACCACTTATCAT No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data
1192360782_1192360787 12 Left 1192360782 X:70437738-70437760 CCACTTATCATCTCTGGTGCTAC No data
Right 1192360787 X:70437773-70437795 AGGCACAACCACCTCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192360787 Original CRISPR AGGCACAACCACCTCTCAGC TGG Intergenic
No off target data available for this crispr