ID: 1192362252

View in Genome Browser
Species Human (GRCh38)
Location X:70447236-70447258
Sequence GAAGCCTCTGGGTACCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192362241_1192362252 21 Left 1192362241 X:70447192-70447214 CCTTGAGTAGGGGTGGGGGCTAG 0: 1
1: 0
2: 2
3: 28
4: 242
Right 1192362252 X:70447236-70447258 GAAGCCTCTGGGTACCACTGGGG 0: 1
1: 0
2: 1
3: 26
4: 161
1192362247_1192362252 -10 Left 1192362247 X:70447223-70447245 CCACTGGGAACGGGAAGCCTCTG 0: 1
1: 0
2: 0
3: 14
4: 224
Right 1192362252 X:70447236-70447258 GAAGCCTCTGGGTACCACTGGGG 0: 1
1: 0
2: 1
3: 26
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192362252 Original CRISPR GAAGCCTCTGGGTACCACTG GGG Intronic
904331315 1:29759310-29759332 TAAGCCTCTGGGTCCCAATGTGG + Intergenic
904708909 1:32413715-32413737 GAAGCCTTTGGATAACACCGGGG - Intergenic
908076808 1:60528817-60528839 TATGACTCTGAGTACCACTGAGG - Intergenic
911739678 1:101373732-101373754 TGATCCTCTGGCTACCACTGTGG - Intergenic
915590435 1:156867328-156867350 AAAGCCTCTGGGTCACTCTGGGG + Intronic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
915971817 1:160360502-160360524 GAAGTGGCTGGGTACCAGTGAGG + Intergenic
923383390 1:233443608-233443630 AAAGCCTCTGGGAGCCAATGAGG + Intergenic
923393118 1:233533340-233533362 AAAGACTCTGGTTACCAGTGGGG - Intergenic
1063607358 10:7534429-7534451 GAAGCTTCTGGGAACAGCTGTGG - Intergenic
1064347224 10:14543388-14543410 GAAGCCTTTGGAGACCACTCAGG + Intronic
1064417884 10:15166778-15166800 GATGCCTCTGGGTGCTACTCTGG + Intronic
1065096630 10:22287257-22287279 AAAACCTCTGGATAACACTGGGG - Intergenic
1065654706 10:27936499-27936521 CAAGCCTCTTAGTGCCACTGAGG + Intronic
1066239302 10:33517881-33517903 GCAACCTCTGAGTACCTCTGTGG - Intergenic
1066618651 10:37321782-37321804 GAAGCCTTCAGGTAACACTGGGG - Intronic
1067744230 10:48923201-48923223 GTAGCATCTGGGCACCACTGTGG + Intronic
1069897712 10:71689281-71689303 AGAACCTCTGGGTACCACTCTGG + Intronic
1070834629 10:79440505-79440527 TCAGCCTCTGGGTCCCAGTGAGG - Intronic
1070937726 10:80314318-80314340 GAGGCCTCTAGGTAGCACTGTGG - Intergenic
1071258112 10:83892820-83892842 GAAGCCTTTGCTAACCACTGAGG - Intergenic
1071462505 10:85912324-85912346 TAGGCCTCTGGGCACTACTGTGG - Intronic
1074121431 10:110496956-110496978 GAAGCCCCTGGGGACCGGTGGGG + Intergenic
1074390107 10:113049973-113049995 GAAGCATCTGGGTCCCACTCAGG - Intronic
1077243707 11:1525424-1525446 GAAGTCTCTGAGGACAACTGTGG + Intergenic
1077369193 11:2173680-2173702 GAGGCCTTTGGGGAACACTGTGG - Intergenic
1081377228 11:42374223-42374245 GAGGCCACTGGGGACCACAGTGG + Intergenic
1083229774 11:61309136-61309158 GAATCCTCTGGTTGCCCCTGTGG + Intronic
1085329369 11:75635134-75635156 GCAGCCTCTGGGTTCCCCTGGGG + Intronic
1090253304 11:125265699-125265721 CAACCCTCTGGGGACCATTGGGG - Intronic
1090292105 11:125554607-125554629 GAAGCCTTTAGATAACACTGAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1093272543 12:17082218-17082240 CAAGACACTGGGGACCACTGTGG + Intergenic
1094019800 12:25902233-25902255 TAACCATCTGTGTACCACTGAGG + Intergenic
1096891244 12:54774041-54774063 TATGACACTGGGTACCACTGGGG + Intergenic
1097206154 12:57322883-57322905 GAGGCCTCTGAGTACCAGTGGGG + Intronic
1102953611 12:117045853-117045875 TAAGCCTCTGGGGACCACTCAGG - Intronic
1103047416 12:117748920-117748942 AATGCCTCTGGGGACAACTGGGG + Intronic
1104881595 12:132075147-132075169 GCAGCCTTTGGGTACCTTTGTGG + Intronic
1105344550 13:19560984-19561006 GTGGCCTCCGGCTACCACTGCGG - Intergenic
1110333715 13:74302090-74302112 GCAGCCCCTGGGTAGCACTGGGG + Intergenic
1111456462 13:88490963-88490985 TAAGGCTCTGGTTAACACTGTGG + Intergenic
1114268907 14:21089726-21089748 GGAACCTCTGGGAGCCACTGTGG - Exonic
1114418427 14:22559434-22559456 GAATACTCTGTCTACCACTGGGG - Intergenic
1116104043 14:40476615-40476637 GAAGCCTTTGGATAACACTGAGG + Intergenic
1121720980 14:96108531-96108553 GAACACTGTGGGTACCACAGTGG - Intergenic
1122652766 14:103234645-103234667 GAAGCATCAGGGTAACAATGGGG + Intergenic
1123984914 15:25636706-25636728 GAAGCATCAGGGTAACAATGGGG + Intergenic
1124160256 15:27261902-27261924 TAAGCCTCTGGGTTCCATTTTGG + Intronic
1128315353 15:66656197-66656219 ACAGCCACTGGATACCACTGTGG - Intronic
1128562921 15:68680274-68680296 GAAGCATGTCTGTACCACTGAGG + Intronic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1132809530 16:1790900-1790922 ACAGCCTCTTGGCACCACTGGGG - Exonic
1133137590 16:3722537-3722559 GAAGCCACTGCCTTCCACTGGGG + Intergenic
1135131336 16:19856083-19856105 GAAAACTCAGGGTATCACTGGGG - Intronic
1136982949 16:35074843-35074865 GAAGCATCAGGGTAACAATGGGG - Intergenic
1137253568 16:46757685-46757707 GAAGCCTCTGGATGCCGCTGGGG - Intronic
1138878387 16:60979968-60979990 CAAGCTTCTGGGCACCACTGGGG + Intergenic
1141724711 16:85780180-85780202 AAGACCTGTGGGTACCACTGAGG + Intronic
1143781812 17:9233115-9233137 GAAGCTGCTGGGAGCCACTGGGG + Intronic
1143801885 17:9390041-9390063 GGAGCCTCTGGGAACCACCCAGG + Intronic
1144774435 17:17777998-17778020 GAAGACTCTGGGTTCTGCTGAGG - Intronic
1145208742 17:20997888-20997910 GAAGCCTCCGGGTACCATGTTGG - Intergenic
1145971652 17:28959803-28959825 CTACCCTGTGGGTACCACTGTGG - Exonic
1146000147 17:29126039-29126061 GAAGCCACTGGGACCCACTAGGG + Intronic
1147899840 17:43776851-43776873 GAAGCCTTTGGCTGACACTGTGG + Intronic
1148668315 17:49391055-49391077 TAAGACTCTGGGCACAACTGTGG + Intronic
1150329578 17:64284108-64284130 GAAGCATCTGAGTACCACAGCGG - Intergenic
1150851855 17:68711179-68711201 AAAGCCTCTGGTCATCACTGTGG + Intergenic
1152314955 17:79574830-79574852 GAGGGCTCTGGGTACCACCTGGG - Intergenic
1152375305 17:79915762-79915784 GAAGGCTCTGGGTATAGCTGGGG + Intergenic
1152392188 17:80009639-80009661 GAAGCCTCCGGGGACCACAGGGG + Intronic
1152660785 17:81540997-81541019 GATGTCACTGGGTACCTCTGGGG + Intronic
1156244337 18:35283677-35283699 CAAGCTTCTGGGCACCACTGTGG - Intronic
1156492304 18:37503402-37503424 GCAGGCTCTGGGCACCACTTGGG - Intronic
1158016758 18:52792452-52792474 TAAGCCTTTGGGTAACACTCAGG + Intronic
1159174261 18:64813673-64813695 GAAGCCTTTGGATAACACTGAGG - Intergenic
1159890756 18:73951147-73951169 GAAGCCTCTGGGTAGGACCCCGG - Intergenic
1161246801 19:3257258-3257280 GAAGCATGTGAGGACCACTGAGG + Intronic
1162405879 19:10473420-10473442 GTAGCTTCTGGCCACCACTGTGG - Intergenic
1162840081 19:13349894-13349916 GAAGGCTCTGGGTAGCCTTGTGG - Intronic
1163235314 19:16026254-16026276 GAAGCCTCTGGGCAGCACATTGG - Intergenic
1165227061 19:34362376-34362398 GAAGCTTCTGGGAATCACAGAGG + Intronic
1165653653 19:37513589-37513611 GAAACATCTGGGTTCCACTCTGG + Intronic
1165791038 19:38492695-38492717 GGAGCCTCTGGGTCCCAAAGAGG + Intronic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1167221911 19:48204827-48204849 GCAGCCTCTAGGAAGCACTGAGG + Intronic
1168179486 19:54651078-54651100 GTAGACGCTGGGGACCACTGAGG - Intronic
926645283 2:15284018-15284040 TCAGCCTCTTGGTTCCACTGGGG - Intronic
927250691 2:20992731-20992753 GATGCAACAGGGTACCACTGAGG + Intergenic
928301564 2:30129866-30129888 GAAGCCTCTGGGAAGGACAGAGG - Intergenic
935696028 2:105771882-105771904 GAAGCTTCTGGGAACAGCTGCGG - Intronic
936153537 2:110034197-110034219 GAACCCTCTGGGAAACACTCAGG + Intergenic
936191144 2:110337218-110337240 GAACCCTCTGGGAAACACTCAGG - Intergenic
938009678 2:127819057-127819079 GAAGCCTTTGGGTAACACCAGGG - Intergenic
938245055 2:129769852-129769874 AAAGCCTCTGGCTACCTCTCAGG + Intergenic
938383052 2:130847362-130847384 GATGCCTCTGGGTGCCCATGAGG - Intronic
938578862 2:132628227-132628249 GGAGCCTCAGGGCACCAGTGGGG - Intronic
942499004 2:176568585-176568607 TAGACCCCTGGGTACCACTGAGG - Intergenic
944900547 2:204209805-204209827 GTAGACTCTGGGCACTACTGGGG + Intergenic
946475676 2:220004516-220004538 GAAGCCCTTGGCTTCCACTGAGG + Intergenic
948214017 2:236215507-236215529 GAAGCTCCTGGAGACCACTGGGG - Intronic
948904414 2:240971549-240971571 GAGGCCTCTGGCTGCCACTCTGG - Intronic
948927230 2:241107151-241107173 GAGGCCTCTGGACACCACTGGGG - Intronic
1169479085 20:5961310-5961332 GATGACTCTGGGTACCACCGAGG - Intronic
1171150857 20:22825450-22825472 GAAGCCTGAGGCTAGCACTGGGG - Intergenic
1174472509 20:50771152-50771174 GAAGCCTCTTGAGGCCACTGTGG - Intergenic
1175900477 20:62358072-62358094 GAAGCCTTTGGGGACCACCAGGG + Intronic
1179967010 21:44813211-44813233 GCAGCCTCTAGGTCCCACTCAGG + Intronic
1181273272 22:21673246-21673268 GAAGCCCCTGGGATCCAATGTGG - Intronic
1182445699 22:30387943-30387965 CCAGCCTCTCGGTCCCACTGAGG - Intronic
1182531974 22:30967795-30967817 GTATCCTCTAGGTGCCACTGAGG - Exonic
1182625389 22:31642117-31642139 GAAGTCTCTGGTTGCCACTGAGG - Intronic
1183345844 22:37307280-37307302 GAAGCTGCTGGGTCCCCCTGTGG + Intronic
1184946763 22:47809251-47809273 GAGGCCTCTGGGAACCACCCAGG + Intergenic
949928042 3:9057584-9057606 CCAGCCTCTGGGTCCCAGTGAGG - Intronic
950970017 3:17176965-17176987 GCAGCCACTGGGGGCCACTGTGG + Intronic
952694343 3:36248459-36248481 GAAGCCGCCTGGTACCAGTGTGG - Intergenic
953090767 3:39723760-39723782 GAGTCCCCTGGGTACCACTCGGG + Intergenic
957615192 3:82517752-82517774 GTAGCCTCTGGGTATTCCTGTGG + Intergenic
958056214 3:88415745-88415767 GGAGGCTCTGTGCACCACTGTGG - Intergenic
960047596 3:113212349-113212371 GAAGCTTCTGGGAACCGCTGAGG - Intronic
961171346 3:124799889-124799911 GATGCCTCTGGCCACCACTTTGG - Intronic
961682655 3:128609149-128609171 ATAGCCACTGGGTTCCACTGTGG + Intergenic
963084902 3:141427702-141427724 GAAGCTTCAGGGGAGCACTGGGG - Intronic
963113577 3:141706939-141706961 AAGCCCTCTGGGTACCTCTGAGG - Intergenic
963173988 3:142279803-142279825 GAAGCCTCTGGATAACACCAGGG - Intergenic
967415251 3:189209853-189209875 GAAGACTCTGGGAACCAATAGGG + Intronic
982403454 4:154994604-154994626 GAAACCTCTAGATAACACTGTGG - Intergenic
990559007 5:56965249-56965271 GAAGCCTATGTGTACCCCTAGGG - Intronic
991165685 5:63563723-63563745 GCGGCCTTTGGGTAACACTGGGG - Intergenic
992551666 5:77865686-77865708 GGAGCCTCTGGGTTCTTCTGTGG + Intronic
994443216 5:99836681-99836703 CATTCCCCTGGGTACCACTGTGG + Intergenic
995442387 5:112206155-112206177 GAAGCCTCCAGGCACCAGTGGGG + Intronic
997894341 5:137702809-137702831 GCAGCCTCTGAGAACCACGGAGG + Intronic
998391459 5:141789450-141789472 GAAGCCTCTGACTACCACTGAGG + Intergenic
998570633 5:143253715-143253737 GAAGCCTCTGGATAAACCTGGGG + Intergenic
998909686 5:146945526-146945548 AAAGCCTCTGGGTTGCAGTGGGG - Intronic
1000693390 5:164349940-164349962 CAAGCATCTGGTCACCACTGTGG - Intergenic
1001168133 5:169390434-169390456 GATGCCTCTGTTGACCACTGGGG + Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG + Intergenic
1004335738 6:14762805-14762827 GAAGCCTCTGGGCACTGCAGAGG - Intergenic
1005181937 6:23115923-23115945 GAAGCCTTTGGGTAACACCCGGG + Intergenic
1006151524 6:31992617-31992639 GCAGCCCCTGGATCCCACTGAGG + Intronic
1006157825 6:32025355-32025377 GCAGCCCCTGGATCCCACTGAGG + Intronic
1007681930 6:43640041-43640063 GAAACCTCGGGCCACCACTGAGG + Exonic
1009640626 6:66331123-66331145 GAAGCGTCAGGGTAACAATGGGG - Intergenic
1009657829 6:66568849-66568871 GAAGCCTTTGGATAACGCTGGGG + Intergenic
1013159100 6:107523972-107523994 GAATCCTCTGTCTACCTCTGGGG + Intronic
1013351822 6:109312822-109312844 GAAGCCCCAGGGTATCTCTGAGG - Intergenic
1016013756 6:139163933-139163955 GAAGTGCCTGTGTACCACTGAGG - Intronic
1019221802 6:170478988-170479010 GAAGGCTCTGAGAACCGCTGGGG - Intergenic
1021285612 7:18777725-18777747 CAATCCTCTGAATACCACTGGGG - Intronic
1021947611 7:25743572-25743594 GAAGCCTTTGGCCACCTCTGTGG + Intergenic
1023029510 7:36080062-36080084 GAAGGCTCTGAGTCCTACTGTGG + Intronic
1028251944 7:88547276-88547298 GAAGCCTTTGGATAACACTGGGG + Intergenic
1029930213 7:104362910-104362932 GATGCCTCTGGGCACCACCCAGG - Intronic
1032923973 7:136580655-136580677 GAGGCCACTGGGAACCACAGTGG + Intergenic
1033632324 7:143170931-143170953 GAAGCCTCAGTGTTCCACTGTGG + Intergenic
1034048036 7:147950555-147950577 ACAGCTTCTGGGTACCCCTGTGG + Intronic
1035342838 7:158175266-158175288 GAAGCCTGTGAATAGCACTGAGG - Intronic
1036602395 8:10274002-10274024 GAAGCCTCTGGGAACCAGGAAGG + Intronic
1037671513 8:21019290-21019312 GACCCCTCTGGGTATAACTGAGG - Intergenic
1038727789 8:30096150-30096172 AAAGCCTCAGGGTGCAACTGCGG - Intronic
1039010343 8:33086555-33086577 GCAGCCATTGGGTACCACAGTGG + Intergenic
1040887547 8:52282469-52282491 CAAGCCACTGGGGACCTCTGAGG + Intronic
1041378229 8:57223945-57223967 GAAGCCTTTGGGTAACAGTGGGG + Intergenic
1041709044 8:60876408-60876430 GACGCCTCTGGGTCCCGCGGTGG + Intergenic
1041867263 8:62589942-62589964 GAAGACTTTAGGTACCACTTAGG + Intronic
1042276686 8:67012366-67012388 GAAGCCAGAGGGTACCACTTAGG - Intronic
1042932924 8:74031057-74031079 GAAGCCTTTGGATAACACGGGGG - Intergenic
1048008142 8:130435825-130435847 AAAGCCTCTGGGTGTGACTGTGG + Intronic
1050610756 9:7350386-7350408 GAAGCCTCTGAGTACCCAGGTGG + Intergenic
1053314197 9:37037724-37037746 GAAGCCTCAGGGAACGACTCTGG + Intergenic
1055269624 9:74543268-74543290 GAAGCCTGTAGATACTACTGGGG - Intronic
1058918954 9:109594905-109594927 GTAGCCTCTGGGTCCAGCTGTGG - Intergenic
1059009868 9:110445255-110445277 CAAGACTCTGGGTACAACTAAGG + Intronic
1062450896 9:136615268-136615290 CAAGCATCTGGGTGACACTGTGG + Intergenic
1189217983 X:39343874-39343896 GAAGTCAATGGGTACAACTGTGG + Intergenic
1189752323 X:44234999-44235021 GAAGCCCTTGGGTTCCACAGAGG + Intronic
1192043028 X:67643335-67643357 GAAGCTTCTGGGTGTCACTATGG + Exonic
1192362252 X:70447236-70447258 GAAGCCTCTGGGTACCACTGGGG + Intronic
1193790729 X:85812869-85812891 GAAGCCTTTGGATAACACTGGGG - Intergenic
1197356244 X:125439769-125439791 GAAGCCTTTGGATAACACTGGGG + Intergenic
1198414685 X:136407984-136408006 GAAGCCTGGAGTTACCACTGTGG - Intronic
1199748422 X:150791558-150791580 GAAGCCATTGGGAACCACAGTGG + Intronic
1199812158 X:151360429-151360451 GAAGCCTCTAGGTGGCACTGCGG - Intergenic
1199980233 X:152916721-152916743 GAAGCCTCTGGCTCTGACTGGGG + Intronic