ID: 1192362337

View in Genome Browser
Species Human (GRCh38)
Location X:70447667-70447689
Sequence CAACATAGCCAGAGAAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192362327_1192362337 16 Left 1192362327 X:70447628-70447650 CCCCACTTCTGAGGAGGAGGCTA 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
1192362329_1192362337 14 Left 1192362329 X:70447630-70447652 CCACTTCTGAGGAGGAGGCTAGA 0: 1
1: 0
2: 2
3: 17
4: 178
Right 1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
1192362322_1192362337 30 Left 1192362322 X:70447614-70447636 CCTGGTTTCCAGCTCCCCACTTC 0: 1
1: 0
2: 0
3: 38
4: 384
Right 1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
1192362324_1192362337 22 Left 1192362324 X:70447622-70447644 CCAGCTCCCCACTTCTGAGGAGG 0: 1
1: 0
2: 0
3: 26
4: 284
Right 1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 179
1192362328_1192362337 15 Left 1192362328 X:70447629-70447651 CCCACTTCTGAGGAGGAGGCTAG 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192362337 Original CRISPR CAACATAGCCAGAGAAAGGT GGG Intronic
900457786 1:2785826-2785848 AAAGATGGCCAGAGACAGGTAGG + Exonic
901016524 1:6235132-6235154 CCACACAGCCAGAGAGCGGTGGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907116034 1:51969342-51969364 CCTCATAGACAGAGAAAGGAGGG - Intronic
907621900 1:55990032-55990054 CTACATAACCAGAGAAAGTGAGG + Intergenic
908669113 1:66526193-66526215 CTACAGAAGCAGAGAAAGGTAGG - Intergenic
910814691 1:91279205-91279227 CACCATAGCCACAGAACTGTGGG - Intronic
912196112 1:107399040-107399062 GAACATAGCCAGAGAAGGAGAGG - Intronic
916662880 1:166938204-166938226 CAACATAGCCTGAGATAGATAGG + Intronic
917537672 1:175886172-175886194 CCACTAGGCCAGAGAAAGGTGGG - Intergenic
918070379 1:181129844-181129866 GAACAGAGCCAGGGAAAGGCAGG - Intergenic
919062878 1:192656453-192656475 CACCATAGGCACAGAAAGGTTGG - Intronic
919422930 1:197393383-197393405 CAGCATAGCAAGAGAAGGGCTGG + Intronic
921192273 1:212721358-212721380 CAACAGAGGCAGAGAAGTGTTGG + Intergenic
923313688 1:232759151-232759173 TAACATAGCCAGAGAGAGGGAGG - Intergenic
1063739198 10:8798202-8798224 TCACATAGACAAAGAAAGGTAGG + Intergenic
1065286779 10:24194370-24194392 CAACATAGCAAGGGGAAGGAAGG - Intronic
1065329691 10:24582279-24582301 AATTATAGCCAAAGAAAGGTTGG + Intergenic
1070102419 10:73400802-73400824 CAGGATATCCAGGGAAAGGTGGG + Exonic
1074540465 10:114361316-114361338 CAACATGAGCAGAAAAAGGTGGG + Intronic
1077027435 11:447277-447299 AAACTGAGGCAGAGAAAGGTTGG - Intergenic
1077819396 11:5721514-5721536 TAACATAGGCTCAGAAAGGTGGG + Intronic
1081589411 11:44410688-44410710 AAAAGTAGCCAGAGAAAGGCAGG + Intergenic
1081747228 11:45481784-45481806 AAAGAGAGCCAGAGAAAGGAAGG - Intergenic
1081779957 11:45703384-45703406 CAACATTTCCAGAGGCAGGTGGG + Intergenic
1082054985 11:47806973-47806995 CACCTTTGCCATAGAAAGGTTGG - Intronic
1082105827 11:48220459-48220481 CAAGATATCAAGAGAAAGGAAGG - Intergenic
1082837232 11:57660082-57660104 GGTCAGAGCCAGAGAAAGGTGGG + Exonic
1084381990 11:68818404-68818426 CCACATCGCCAGAGCAAGGGAGG + Intronic
1088319172 11:108537082-108537104 CAACACTGCCAAAGAAAGTTAGG + Intronic
1089168434 11:116495672-116495694 CAGCAAATACAGAGAAAGGTAGG - Intergenic
1089773136 11:120817377-120817399 AAACATAACCAGACAAAGGCGGG - Intronic
1092478194 12:8836988-8837010 GAAGAGAGCTAGAGAAAGGTAGG + Intronic
1092783935 12:12011173-12011195 CAAGATATCCTGAGAGAGGTGGG - Intergenic
1092902181 12:13070388-13070410 GAGCATAGGCAGAGAAAGGCAGG + Intronic
1093688133 12:22079150-22079172 AAGCTTAGCCACAGAAAGGTTGG - Intronic
1094077663 12:26495821-26495843 CAAAATAGCCAGAAAAAGAGTGG + Intronic
1094159056 12:27370552-27370574 CAACAGTGCCACAGAAAGGGTGG - Intronic
1097474966 12:60042421-60042443 CAACAGAGACAGAAAAAGGGAGG + Intergenic
1098091460 12:66906560-66906582 CATCATTGCCACAGAAAGGCAGG + Intergenic
1098871441 12:75821413-75821435 GATCATGGCAAGAGAAAGGTAGG + Intergenic
1099487038 12:83241704-83241726 TGACATAGACACAGAAAGGTGGG - Intergenic
1100254083 12:92863757-92863779 AGCCATAGCCAGAGAATGGTAGG + Intronic
1100277987 12:93089545-93089567 AAACATAGCCAGAAAATGGTAGG - Intergenic
1101950937 12:109174520-109174542 GAATATGGCCAGAAAAAGGTTGG - Intronic
1102497481 12:113329597-113329619 CAAGAGAGACAGAGTAAGGTGGG + Intronic
1104231297 12:126887002-126887024 CACAAAAGCCAAAGAAAGGTTGG - Intergenic
1105806266 13:23953311-23953333 CAACATAGAGTGAGAAAGCTCGG + Intergenic
1106543681 13:30712941-30712963 CAGCATGGCCAGAGAGAAGTTGG - Intergenic
1108043719 13:46363210-46363232 CAACCTAGACAAAGAAAGGAAGG + Exonic
1108490304 13:50975066-50975088 CCACATAGCCAGAGTAAGCATGG - Intergenic
1109309379 13:60673855-60673877 AAACATATCCAGAATAAGGTGGG - Intergenic
1110127753 13:71968188-71968210 AAACAAAGCCAGAGACAGGAAGG - Intergenic
1111216681 13:85152139-85152161 CAACAGAGCAAGAAAAAGGAAGG - Intergenic
1114345636 14:21791698-21791720 GAACATAACCAGAAAAGGGTAGG - Intergenic
1114732309 14:25006370-25006392 AAACAGAGCAAGAGAAAGCTTGG - Intronic
1115405090 14:33006101-33006123 CAATAGAGCCAGAGACAAGTAGG - Intronic
1115829344 14:37317309-37317331 GAACATAACTAGAGAAATGTAGG + Intronic
1116010139 14:39341963-39341985 AAACAAAACCACAGAAAGGTTGG + Intronic
1119075866 14:71638216-71638238 TACCAAAGCCAGACAAAGGTAGG + Intronic
1119858739 14:77921597-77921619 CAGCATAGACAGAGACAGGAGGG - Intronic
1119938262 14:78613511-78613533 CAAGTTAGCCAGAGAAAAGGGGG + Intronic
1121317316 14:92970014-92970036 CAGCAGAGCCAGAAAAAGGCTGG + Intronic
1123933067 15:25181177-25181199 CTCCATCCCCAGAGAAAGGTGGG + Intergenic
1128635108 15:69298191-69298213 CGACCCTGCCAGAGAAAGGTTGG - Intergenic
1134352683 16:13452495-13452517 CAACAGAGCTAAACAAAGGTGGG + Intergenic
1135234948 16:20746579-20746601 CTACAAAGCTAGTGAAAGGTGGG - Intronic
1137558133 16:49485738-49485760 AAAGATAGTCAGAGACAGGTGGG + Intergenic
1137773750 16:51039291-51039313 CAACATTGCCAGAACATGGTAGG - Intergenic
1138148164 16:54630938-54630960 CAACATAGATAAAGAAAGGCAGG + Intergenic
1139825654 16:69755079-69755101 CCGCATAGCCAGAGAAGTGTGGG + Intergenic
1141256554 16:82408041-82408063 CATCACAGCCAGAGAACGGAGGG + Intergenic
1142333382 16:89470500-89470522 CACCATAGACTGAGAAAGGAGGG + Intronic
1203085708 16_KI270728v1_random:1183055-1183077 AAAAACAGCCAGGGAAAGGTGGG - Intergenic
1142605567 17:1079276-1079298 CTGCACAGCCAGACAAAGGTAGG + Intronic
1145840414 17:27989586-27989608 CAGCATTGCCACAGAAAGGTAGG + Intergenic
1147143318 17:38471251-38471273 AAAAACAGCCAGGGAAAGGTGGG - Intronic
1150217515 17:63478705-63478727 CACCAAAGCCAGAGAATGGGAGG + Intergenic
1150710328 17:67525846-67525868 CAACATAGCCAGTGTGAGGCAGG + Intronic
1152988132 18:337906-337928 CAAAAAAGACAGAGAGAGGTGGG - Intronic
1159135752 18:64335038-64335060 AAATATATCCAGAGAAATGTTGG - Intergenic
1160066926 18:75584158-75584180 GAAGGGAGCCAGAGAAAGGTAGG - Intergenic
1161512367 19:4678903-4678925 CAAAGCAGCCAGAGAAATGTGGG + Intronic
1163207350 19:15813411-15813433 AAACAGAGAGAGAGAAAGGTAGG + Intergenic
1164699275 19:30271574-30271596 GAACATGGCGAGAGAATGGTGGG - Intronic
1164716257 19:30392415-30392437 CAGGGTAGCCAGAGAAGGGTTGG + Intronic
1165522287 19:36324052-36324074 CATCATAGACAGAGACAAGTGGG + Intergenic
1166863134 19:45821133-45821155 CATCAGAGGCAGAAAAAGGTGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
925427011 2:3758100-3758122 CAAAATAGACAGAGAAGGGCTGG + Intronic
926527870 2:14005196-14005218 TAACATAGCCAGCGAGAGGAAGG + Intergenic
927612408 2:24554698-24554720 CAACATAGCCAGCAACATGTTGG + Intronic
929230901 2:39558917-39558939 CCAGATAACCAGAGAGAGGTTGG - Intergenic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
930982130 2:57539413-57539435 GAACACAGCCAGAAAAAGTTTGG + Intergenic
932080507 2:68710155-68710177 AAAAATAGCCATAGAAAGGCAGG + Intronic
932752094 2:74377763-74377785 CAATATAGCCAGATCAAGGACGG + Intronic
934076691 2:88434426-88434448 AAACACTGCAAGAGAAAGGTAGG - Intergenic
934662979 2:96153008-96153030 CACCACAGCCAGAGAGAGCTGGG + Intergenic
939631169 2:144528175-144528197 CACCAAAGCCAGAGAAACTTTGG - Intergenic
942987268 2:182158047-182158069 CATCATAGCCAGCCAAAGTTAGG - Intronic
945216096 2:207435814-207435836 AAACATAAGCAGAGAATGGTAGG - Intergenic
946284197 2:218690473-218690495 CAACAGGTCCAGAAAAAGGTTGG - Exonic
946947918 2:224841460-224841482 GAATAAAGCCAGATAAAGGTGGG - Intronic
947451681 2:230214252-230214274 AAACATAGCCACAGAAAGAGAGG - Intronic
1170217706 20:13909151-13909173 CAACATAGCAACAGAAATGTGGG - Intronic
1171143460 20:22762746-22762768 CCACATGGCCAGGGAAGGGTGGG + Intergenic
1171498047 20:25571176-25571198 CAAAATATCCAGAAAAAGGAAGG + Intronic
1172378010 20:34461743-34461765 AAACAAAGCCAGAGAAAGGATGG + Intronic
1178051066 21:28747883-28747905 GAACATAACCAGAGAGAGATAGG + Intergenic
1178051221 21:28749797-28749819 GAACATAACCAGAGAGAGATAGG + Intergenic
1179798021 21:43796987-43797009 CAGCACAGGCAGAGAAAGGAAGG - Intronic
1180165874 21:46028396-46028418 CAACATAGCTGGAGAAAGCTCGG - Intergenic
1183700476 22:39448328-39448350 CCACAAAGCCACAGGAAGGTGGG - Intergenic
951635009 3:24764238-24764260 AAACATAGGCAGAGAAAGGATGG - Intergenic
951693146 3:25418036-25418058 CAAGATAGCAAGTGGAAGGTGGG + Intronic
955684752 3:61538816-61538838 CAACAGAGCGAGAAAAAGTTTGG - Intergenic
955774544 3:62419322-62419344 CAACATATCCAGAGAAAAATAGG - Intronic
957319844 3:78615996-78616018 CATCATAGCTAAAGAGAGGTTGG - Intronic
958746936 3:98147653-98147675 CAAAATAGCCAGAAGAAAGTTGG + Intergenic
960279622 3:115766689-115766711 GAACAAACCCTGAGAAAGGTTGG - Intergenic
960620699 3:119633940-119633962 CAATAGAGCGAGAAAAAGGTGGG + Intergenic
962404599 3:135090119-135090141 CAACAGAGGCAGCGAAGGGTTGG - Intronic
962469156 3:135689743-135689765 GAACATAGCCAGAGAGAGCCAGG - Intergenic
962556992 3:136563722-136563744 AAACATATCCAGAGAAAGGCCGG + Intronic
962679133 3:137780681-137780703 AAACAAACCCAGAGAGAGGTAGG - Intergenic
965545216 3:169908873-169908895 CAAAATAGCCAGAGACCTGTGGG + Intergenic
966513546 3:180791530-180791552 CAACAAAGACAAAGAAAGGCTGG + Intronic
968581418 4:1397077-1397099 CAACAGTGCCAGAGGCAGGTGGG + Intergenic
970286143 4:14518396-14518418 CAACATAGCCACAGGACTGTTGG + Intergenic
971278490 4:25220851-25220873 CAACATTACCAAAGAAAAGTTGG + Intronic
974510135 4:62828980-62829002 CCACATATCCAGTGAAAGATTGG - Intergenic
976596553 4:86900589-86900611 CAACCTGGCCAGAGAAAGAGGGG - Intronic
977187829 4:93962452-93962474 CAACATAGCCAGACTAGGCTGGG - Intergenic
981223366 4:142262905-142262927 CAACATGGCCTGAGAAAAGCAGG + Intronic
984514319 4:180719605-180719627 CAACATGGTCAGACAAAGGGAGG - Intergenic
986700009 5:10397545-10397567 CAACAGAGGGAGAGATAGGTAGG - Intronic
986800310 5:11253257-11253279 CACAAAAGCCAGAGAAAGGCAGG - Intronic
987223911 5:15820251-15820273 GAACAGAGCCAGAGCAAGGCTGG - Intronic
987238676 5:15969915-15969937 CAGCATAGCCAAGGAAAGGTTGG - Intergenic
987242713 5:16017070-16017092 TAACATAGTAAGAGCAAGGTTGG - Intergenic
991724167 5:69519468-69519490 CAAGATATCCAGAAAAAGGAAGG - Intronic
991950933 5:71946170-71946192 GAACACAGCCAGGGAAGGGTAGG + Intergenic
994389944 5:99180489-99180511 CACCAGAGTCTGAGAAAGGTGGG - Intergenic
994796340 5:104305517-104305539 CAACATAGACAGAGAATGGAAGG - Intergenic
994814159 5:104562892-104562914 CAACATAGCGGGAAAAATGTGGG + Intergenic
995372953 5:111440041-111440063 GAGTATAGCCAGAGAAAGCTGGG + Intronic
998073723 5:139219154-139219176 CAAGAAACCCAGAGATAGGTGGG - Intronic
998488711 5:142526993-142527015 CAGCATAGACAGTGCAAGGTAGG + Intergenic
1001759504 5:174195505-174195527 AAACAGAGCCATAGAGAGGTTGG + Intronic
1003384679 6:5656240-5656262 CAGCAAAGCCAGTGACAGGTTGG - Intronic
1004576304 6:16898768-16898790 CAAAATAGAGAGAGAGAGGTGGG - Intergenic
1006541815 6:34746160-34746182 CCACATAGCCAGGCAAAGATGGG + Intergenic
1009406680 6:63322480-63322502 CAACAAATCGGGAGAAAGGTAGG - Intergenic
1011067848 6:83347441-83347463 CATCATATTCAGAGAAACGTGGG + Intronic
1012566116 6:100654683-100654705 CAACTGAGACAAAGAAAGGTAGG + Intronic
1014050584 6:116948630-116948652 CAACCAAGCCAGAGGAAGGTAGG - Intergenic
1014434112 6:121402333-121402355 TAACACAGAAAGAGAAAGGTGGG + Intergenic
1015781252 6:136868658-136868680 CAACATAGTCAGACAATGTTAGG + Intronic
1022419789 7:30209708-30209730 CACCAATACCAGAGAAAGGTAGG + Intergenic
1023652555 7:42387277-42387299 CAACAGAGCCAGAGACTGGAGGG - Intergenic
1023813925 7:43934148-43934170 CTTCATAGCCACAGAAAGGAAGG + Intronic
1024115190 7:46186216-46186238 AAATATAACCAGAGAAAGCTAGG - Intergenic
1026593462 7:71715152-71715174 TAACAAAGCAAGAGAAAGGGAGG + Intergenic
1029034445 7:97504026-97504048 CAACATCTCCAGTGACAGGTAGG + Intergenic
1029335007 7:99891510-99891532 CAACATAGGCAGAGTGAGGGGGG + Exonic
1030849402 7:114464255-114464277 AAAAAGAGACAGAGAAAGGTAGG + Intronic
1033734920 7:144212671-144212693 ATAAATAGACAGAGAAAGGTAGG - Intergenic
1033748136 7:144338298-144338320 ATAAATAGACAGAGAAAGGTAGG + Intergenic
1034731795 7:153393277-153393299 CAACATTACCAGAGACTGGTAGG - Intergenic
1034776934 7:153836439-153836461 TAAAATAGCCAGGGAAAAGTGGG + Intergenic
1035104868 7:156434039-156434061 GAAAATAGCCAGAGAAAGTGAGG + Intergenic
1035937385 8:3856675-3856697 CCACATGGCCAGTGAAAGCTGGG + Intronic
1039025730 8:33255805-33255827 CAGTTTAGCCAGACAAAGGTTGG + Intergenic
1039991005 8:42487556-42487578 GAACAGAGCCAGAGAAATGTGGG - Intronic
1043336720 8:79185277-79185299 CAACATGGGCAGAAAAAGGAAGG - Intergenic
1045452685 8:102344224-102344246 AAACATATACAGAGAAAGGCAGG + Intronic
1045741807 8:105369133-105369155 AAACATAGCCAGTTAAATGTAGG - Intronic
1051345913 9:16151205-16151227 CAAGAGTGCCAGAGGAAGGTGGG + Intergenic
1051604930 9:18909421-18909443 CAGCAAAGCCAGTGAGAGGTGGG + Exonic
1051828792 9:21252411-21252433 CAAAAGAGCCATATAAAGGTTGG + Intergenic
1052391968 9:27889771-27889793 CAAGACAGACAGAGAAGGGTCGG + Intergenic
1059078419 9:111220498-111220520 CAACATAGTGAGAGGAAGGAAGG + Intergenic
1061119616 9:128634978-128635000 CAACAGAGCCAGAGAACAGGAGG + Intronic
1061670589 9:132186046-132186068 CAGCATAGCCAGAGAAAAATAGG + Intronic
1187132295 X:16514444-16514466 CAATATAGCCACAGAAGGCTGGG + Intergenic
1187741832 X:22364430-22364452 CAAAATAGACAGAGAGATGTTGG - Intergenic
1190792315 X:53711803-53711825 CAACAAAGCAGGAGAATGGTAGG + Intergenic
1192239802 X:69320023-69320045 CACCATAGGCAGAGAAGGGTTGG + Intergenic
1192253067 X:69429640-69429662 AAACAAAACCAGAGAAAGGGAGG - Intergenic
1192362337 X:70447667-70447689 CAACATAGCCAGAGAAAGGTGGG + Intronic
1194268804 X:91784168-91784190 CAAAATAGCCTGAGAAAATTGGG + Intronic
1196757216 X:119168427-119168449 AAACATAGCAAAAGAAAAGTGGG - Intergenic
1197815168 X:130490697-130490719 CAGCATAGCCAGAGAAGTGCAGG - Intergenic
1198590178 X:138171219-138171241 CACAATAGGCACAGAAAGGTGGG - Intergenic
1198673422 X:139106284-139106306 CAACAGAGCCACAGAAAAGTTGG + Intronic
1199171365 X:144738026-144738048 CAACATAGCTAGGGATAGCTTGG - Intergenic
1201947664 Y:19529404-19529426 CAATATAGCCTGAGAAACATAGG + Intergenic