ID: 1192362639

View in Genome Browser
Species Human (GRCh38)
Location X:70449247-70449269
Sequence CTAGTTCTCCAGGCCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 882
Summary {0: 1, 1: 0, 2: 1, 3: 97, 4: 783}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192362639_1192362643 -8 Left 1192362639 X:70449247-70449269 CCTTCTGAGGCCTGGAGAACTAG 0: 1
1: 0
2: 1
3: 97
4: 783
Right 1192362643 X:70449262-70449284 AGAACTAGCTCTGGGATATAAGG 0: 1
1: 0
2: 0
3: 18
4: 150
1192362639_1192362646 2 Left 1192362639 X:70449247-70449269 CCTTCTGAGGCCTGGAGAACTAG 0: 1
1: 0
2: 1
3: 97
4: 783
Right 1192362646 X:70449272-70449294 CTGGGATATAAGGGGAGATGAGG 0: 1
1: 0
2: 2
3: 20
4: 256
1192362639_1192362644 -7 Left 1192362639 X:70449247-70449269 CCTTCTGAGGCCTGGAGAACTAG 0: 1
1: 0
2: 1
3: 97
4: 783
Right 1192362644 X:70449263-70449285 GAACTAGCTCTGGGATATAAGGG 0: 1
1: 0
2: 0
3: 9
4: 100
1192362639_1192362645 -6 Left 1192362639 X:70449247-70449269 CCTTCTGAGGCCTGGAGAACTAG 0: 1
1: 0
2: 1
3: 97
4: 783
Right 1192362645 X:70449264-70449286 AACTAGCTCTGGGATATAAGGGG 0: 1
1: 0
2: 0
3: 8
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192362639 Original CRISPR CTAGTTCTCCAGGCCTCAGA AGG (reversed) Intronic
900165504 1:1242880-1242902 GTTGCTCTCCAGGCCTGAGACGG + Exonic
900556337 1:3282772-3282794 CACGTTCGCCAGGCTTCAGACGG - Intronic
900730790 1:4258279-4258301 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
900738361 1:4314500-4314522 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
900838278 1:5023884-5023906 CTTGATCTCCTGGCCTCAGGTGG - Intergenic
901025012 1:6274537-6274559 CTCCTTCTCCTGGCCTCAGCTGG - Intronic
901925431 1:12563275-12563297 CTAGGCCTCCAGGCCTATGATGG - Intergenic
904057440 1:27680654-27680676 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
904958986 1:34316137-34316159 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
906371540 1:45258201-45258223 CTAGACCTCCAGGCCTGTGATGG - Intronic
906821138 1:48931602-48931624 CTTGTTCTCCAGTGCTCAAATGG + Intronic
907344063 1:53759507-53759529 CTAAATCTCCAGGCCTGTGATGG + Intergenic
908090974 1:60685626-60685648 CTAGTTCTCCTGACCTGTGATGG - Intergenic
908524578 1:64975719-64975741 ATAGTGCTCCTGGCCTGAGAAGG - Intergenic
908601525 1:65744887-65744909 CTAGGCCTCCAGGCCTTTGATGG - Intergenic
908746885 1:67384459-67384481 CTAGGCCTCCAGGCCTGTGATGG + Intronic
908871751 1:68620768-68620790 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
908942492 1:69452569-69452591 CCAGGTCTACAGGCATCAGAGGG - Intergenic
909086261 1:71172821-71172843 CTAGGACTCCAGGCCTGTGATGG + Intergenic
909177685 1:72380935-72380957 CTAAGTCTCCAGGCCTTTGATGG + Intergenic
909834065 1:80231393-80231415 CTAGGCCTCCAGGCCTGTGACGG + Intergenic
910233259 1:85008269-85008291 CTAGGTCTCCGGGCCTGTGATGG + Intronic
910726896 1:90349282-90349304 CTAGACCTCCAGGCCTGTGATGG - Intergenic
911007660 1:93243451-93243473 CTAGGCCTCCAGGCCTGTGATGG + Intronic
911331374 1:96529475-96529497 ATAGGCCTCCAGGCCTCTGATGG - Intergenic
911708367 1:101040850-101040872 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
911848477 1:102784138-102784160 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
912112710 1:106363305-106363327 TTAGTCCTCCAGGCCTGTGATGG - Intergenic
912136147 1:106662417-106662439 CTAGACCTCCAGGCCTATGATGG - Intergenic
912147365 1:106809776-106809798 CTAGTCCTCCATGCCTGTGATGG + Intergenic
912890390 1:113523893-113523915 CTCGGTCTCCAGGCCTGTGATGG - Intronic
912907130 1:113718837-113718859 CTAGGCCTCCAGGCCTGTGAAGG + Intronic
913289497 1:117259023-117259045 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
916207590 1:162330535-162330557 CTAGTTCTGCAGGCCTGTGTAGG + Intronic
916948923 1:169759050-169759072 CTAGGCCTCCAGGCCTGTGATGG + Intronic
916993027 1:170265451-170265473 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
917035493 1:170743296-170743318 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
917043637 1:170833387-170833409 CTACGTCTCCAGGCCTGTGATGG - Intergenic
917082599 1:171272021-171272043 CTAGGCCTCCAGGCCTGTGATGG - Intronic
918718188 1:187818356-187818378 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
918935473 1:190915721-190915743 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
919175114 1:194010231-194010253 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
919179269 1:194059850-194059872 CTAGAGCTCCAGGCCTGTGATGG + Intergenic
919233531 1:194807358-194807380 CTGGGCCTCCAGGCCTCTGATGG - Intergenic
919460602 1:197872285-197872307 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
919472231 1:197994220-197994242 CTGGTTCTCAGTGCCTCAGATGG - Intergenic
920380349 1:205531456-205531478 CTCGTTCTTCAGTCCTCCGAGGG - Exonic
921397919 1:214688635-214688657 CTGGGTCTCCAGCCCACAGATGG - Intergenic
921424312 1:214984685-214984707 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
921531213 1:216285186-216285208 CTAGGCCTCCAGGCCTGTGATGG - Intronic
921621474 1:217330382-217330404 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
922393985 1:225177522-225177544 CTAGGCCTCCAGGCCTGTGATGG - Intronic
923172690 1:231431397-231431419 CTAGGTCTCCAGGCCTGTAATGG + Intergenic
923179207 1:231499604-231499626 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
923233032 1:232006835-232006857 CTAGGTCTCCAGGCCTGTAATGG - Intronic
923339208 1:232993701-232993723 CTAGGCCTCCAGGCCTGTGATGG - Intronic
924152469 1:241142664-241142686 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1064016542 10:11777136-11777158 TTATTTCTCAAGGACTCAGAGGG + Intergenic
1064037001 10:11922156-11922178 GTCTTCCTCCAGGCCTCAGAAGG + Intronic
1065397500 10:25255469-25255491 CTAGGTCTCTAGGCTTCAGCTGG + Intronic
1066083447 10:31954974-31954996 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1066451822 10:35536997-35537019 CTAGACCTCCAGGCCTGTGATGG - Intronic
1068056259 10:52015465-52015487 CTAGATCTCCAGACCTGTGATGG + Intronic
1068163116 10:53293560-53293582 CTAGGTCTCCAGGCATGTGATGG - Intergenic
1068449380 10:57165854-57165876 CTAGGCCTCCAGGCCTGAGATGG + Intergenic
1068805817 10:61192788-61192810 CTAGTCTTCCAGGCCTGTGATGG + Intergenic
1068943724 10:62706877-62706899 CAAGTTCTACAGGCATCAAAGGG - Intergenic
1069291451 10:66785629-66785651 CTGGTTCTCTGGCCCTCAGATGG + Intronic
1069573275 10:69507204-69507226 CTTGTTCCCCAGGCCCCAGGTGG - Exonic
1069754588 10:70765908-70765930 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1069805157 10:71117771-71117793 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1070059306 10:72967168-72967190 CAAGCTCCCCAGGCCCCAGATGG + Intergenic
1070870039 10:79743656-79743678 CTAGGTCTCCAGTCCTGTGATGG - Intergenic
1071159259 10:82727303-82727325 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1071337882 10:84616570-84616592 CTGGTACTCCAGGCCTGTGATGG - Intergenic
1071506934 10:86238241-86238263 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1071636963 10:87265876-87265898 CTAGGTCTCCAGTCCTGTGATGG - Intergenic
1071658284 10:87472078-87472100 CTAGGTCTCCAGTCCTGTGATGG + Intergenic
1071859287 10:89656113-89656135 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1072629497 10:97135590-97135612 TTACCTCTCCAGGCCTCAGGCGG - Intronic
1072944713 10:99799371-99799393 GTGAGTCTCCAGGCCTCAGATGG + Intronic
1073883319 10:108008107-108008129 CTAGACCTCCAGGCCTGTGATGG + Intergenic
1074259244 10:111835222-111835244 CAAGTTCTCCAGACACCAGATGG - Intergenic
1074820048 10:117171266-117171288 CAAGTTCTCCTGGCCACAGCAGG + Intergenic
1075354303 10:121756813-121756835 CTAGGTCTCCAGGCCTGTGATGG + Intronic
1075376734 10:121984072-121984094 CTAGTTCTCCAGCCTGCAGATGG + Intergenic
1075530595 10:123225646-123225668 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1075573870 10:123564303-123564325 CTGGTTCTCCAGCCTACAGATGG + Intergenic
1075938029 10:126360174-126360196 CTAGGTCTCCAGGCCTGTGATGG + Intronic
1078407869 11:11087005-11087027 CTTGTACTCCAGACCTCAGCAGG + Intergenic
1078514925 11:12014014-12014036 CTAGGTCTCCAGCCCTGTGATGG - Intergenic
1078516006 11:12023178-12023200 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1078558177 11:12347932-12347954 CTCGAACTCCTGGCCTCAGATGG - Intronic
1078615280 11:12859554-12859576 CTACTTCTCCATCTCTCAGATGG - Intronic
1078687383 11:13546262-13546284 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1078761229 11:14253500-14253522 CCAGTTCCCCAGGCCCCAGTCGG + Intronic
1078984967 11:16584801-16584823 CTAGATTTCTAGGCCACAGAAGG - Intronic
1079537022 11:21526857-21526879 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1079542590 11:21593969-21593991 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1079586222 11:22128995-22129017 CTAGTCCTCCGGGCCTGTGATGG + Intergenic
1079656153 11:22988428-22988450 CTAAGTCTCCAGGCCTGTGATGG + Intergenic
1079916157 11:26371077-26371099 CTAGGCCTCCAGGCCTGCGATGG - Intronic
1080151419 11:29056648-29056670 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1081045660 11:38270034-38270056 CTAGCTCTCCAGGCCTGTCATGG + Intergenic
1081080511 11:38733925-38733947 TTAGATCTCCAGGCCTGTGATGG + Intergenic
1081083884 11:38775270-38775292 CTATATCCCCAGGCCTCTGATGG + Intergenic
1081122707 11:39286026-39286048 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1081441517 11:43086089-43086111 CTAGACCTCCAGGCCTGTGATGG + Intergenic
1081573010 11:44303138-44303160 CTGGCTCTCCAGGGCTCTGAAGG - Intronic
1081783851 11:45732677-45732699 CCACTGCTCCAGGCCTCAGTGGG - Intergenic
1082616889 11:55371661-55371683 CTAGGTCTCCTGGCCTGTGATGG + Intergenic
1082934884 11:58646065-58646087 CTAGCTCTCCAGGCCTGTGATGG + Intronic
1083136154 11:60678436-60678458 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1083808102 11:65087084-65087106 GGAGTTATCCAGGCCGCAGAAGG + Intronic
1084191953 11:67503490-67503512 CTATTGCTCCGGGGCTCAGATGG + Intronic
1084608407 11:70185805-70185827 CAAGTTCTCCAAGCCTCTGGAGG - Intronic
1084838674 11:71827235-71827257 CTAGGCCTCCAGGCCTTTGAGGG - Intergenic
1085023431 11:73222945-73222967 CTGGTGCACCTGGCCTCAGATGG - Intronic
1085235427 11:75010753-75010775 CTAGTTTTCCAGGCCTCCAAGGG + Exonic
1085236452 11:75019333-75019355 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1085418350 11:76334945-76334967 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1085600903 11:77855162-77855184 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1085609667 11:77935511-77935533 GTTCTTTTCCAGGCCTCAGATGG - Intronic
1086120210 11:83297991-83298013 ATCCTTCTCTAGGCCTCAGAGGG - Intergenic
1086764284 11:90675644-90675666 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1086933866 11:92722936-92722958 CTAGTTCTCTGGGCCTGTGATGG + Intronic
1087336548 11:96851666-96851688 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1087433297 11:98080903-98080925 CTATGTCTCCAGGCCTGTGATGG - Intergenic
1087578753 11:100025082-100025104 CAAGGCCTCCAGGCCTTAGATGG - Intronic
1087618125 11:100511808-100511830 CTGGGTCTCCAGGCTGCAGACGG + Intergenic
1087793595 11:102432721-102432743 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1088048338 11:105480374-105480396 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1088175786 11:107051496-107051518 CTAATCCTCCAGGCCTGTGATGG - Intergenic
1088426997 11:109714987-109715009 CTAGGCCTCCAGGCCTCTGATGG + Intergenic
1088987240 11:114920063-114920085 CTCTTTCTCCAGGACTCAGAAGG + Intergenic
1089053044 11:115562485-115562507 CTGGTTCTCCAGCTCACAGATGG - Intergenic
1089053134 11:115563312-115563334 CTAGTTCTCCAGCTCACAGATGG - Intergenic
1090756389 11:129795299-129795321 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1090913260 11:131140451-131140473 ATACTTCTTCAGGCCTCAGGAGG + Intergenic
1091244576 11:134081352-134081374 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1091959946 12:4685287-4685309 CTTGTTATCCAGGGCTCAAATGG - Exonic
1092400005 12:8166854-8166876 CTAGGCCTCCAGGCCTTTGAGGG + Intronic
1092618228 12:10234767-10234789 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1093076119 12:14760708-14760730 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1094037017 12:26082256-26082278 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1094706027 12:32915321-32915343 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1094716149 12:33017194-33017216 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1094785817 12:33846997-33847019 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1095300875 12:40582140-40582162 CTAAGCCTCCAGGCCTCTGATGG + Intergenic
1095651582 12:44617323-44617345 CTAGTTCTCTGGACCTGAGAAGG + Intronic
1096002786 12:48143445-48143467 CTGGTTCCCCTTGCCTCAGAGGG - Intronic
1096745181 12:53722178-53722200 CTGGTTCTACAGGCAGCAGAAGG + Exonic
1096750467 12:53755756-53755778 CCATTTCTCCTGGCCTCAGGTGG + Intergenic
1096875538 12:54627460-54627482 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1097139246 12:56886217-56886239 CTAGATCTCCAGGCATCTGATGG - Intergenic
1097401686 12:59135037-59135059 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1097445591 12:59667796-59667818 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1097501582 12:60410204-60410226 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1097571302 12:61335377-61335399 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1097575628 12:61389257-61389279 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1097985430 12:65777972-65777994 CTAGATCTCCAGGGCTCAAGTGG + Intergenic
1097999057 12:65921758-65921780 CTGGATCTCCAGGCCTGTGATGG - Intronic
1098163933 12:67673725-67673747 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1098578505 12:72071240-72071262 CTAGACCTCCAGGCCTGTGATGG + Intronic
1098614614 12:72507803-72507825 CTAGGTCTCCAGGCCTATGATGG - Intronic
1098778565 12:74654241-74654263 CTAGGGCTCCAGGCCTGTGATGG + Intergenic
1098836768 12:75433117-75433139 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1099096365 12:78379280-78379302 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1099229348 12:80003925-80003947 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1099360465 12:81694290-81694312 CTAGGTCTCCAGGCCTGTGATGG - Intronic
1099407414 12:82281475-82281497 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1099675441 12:85755395-85755417 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1099724736 12:86411808-86411830 CTAGTCCTCCGGGCCTATGATGG - Intronic
1099932608 12:89091446-89091468 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1101936037 12:109058035-109058057 CCAGTACTCCAGGGATCAGAAGG + Exonic
1103223554 12:119267177-119267199 CTAGGCCTCCAGGCCTGTGACGG - Intergenic
1103264538 12:119617970-119617992 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1103956181 12:124578130-124578152 CCAGTGCCCCAGGCCTCAGGAGG + Intergenic
1104172144 12:126292205-126292227 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1104210530 12:126684182-126684204 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1104758055 12:131281155-131281177 CTACTGCCCCAGGCCTCAGAAGG - Intergenic
1104830049 12:131744085-131744107 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1105608239 13:21944846-21944868 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1105838506 13:24232112-24232134 CTGGTTCTCCAGGCTGCAGATGG - Intronic
1106718734 13:32418142-32418164 CTAGGTCTCCAGGCCTGTGATGG - Intronic
1106877277 13:34087966-34087988 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1107116345 13:36750626-36750648 CTAGTTCACAAGTCCACAGACGG + Intergenic
1107549497 13:41461773-41461795 CTGGTTCTCCAGGGCCCACAAGG - Intronic
1108083635 13:46762386-46762408 CTGGTTCTCCAGCTCTCAGATGG + Intergenic
1108277584 13:48826612-48826634 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1108325176 13:49323528-49323550 CTCATTCTCCAAGCCTCAGATGG + Intronic
1108718530 13:53106101-53106123 CTGGTTCTCCAGCTTTCAGATGG + Intergenic
1108832502 13:54497975-54497997 CTAGGTCTTCAGGCCTGTGATGG - Intergenic
1109246079 13:59956269-59956291 CTAGGTCTCCGGGCCTATGATGG - Intronic
1109393702 13:61725878-61725900 CTAGATCTCCAGGCCTGTGGTGG + Intergenic
1109407362 13:61919075-61919097 CTAGGTCTCAAGGCCTGTGATGG + Intergenic
1109485289 13:63010331-63010353 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1109658550 13:65427905-65427927 CTAGCCCTCCAGACCTCATAAGG - Intergenic
1109863048 13:68225189-68225211 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1110044712 13:70813488-70813510 CTAGGGCTCCAAGCCTCTGATGG - Intergenic
1110250718 13:73377533-73377555 CTAGGCCTCCAGGCCTGAGATGG + Intergenic
1110342004 13:74402776-74402798 CTAGGCCTCCAGGCCTGTGAAGG + Intergenic
1110955376 13:81546788-81546810 CTAGGCCTCCAGACCTCTGATGG + Intergenic
1110970819 13:81758687-81758709 CTAGGCCTCCAGGCCTTTGATGG + Intergenic
1111065712 13:83089031-83089053 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1111072522 13:83187588-83187610 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1111077977 13:83263913-83263935 CTAGGTCTCTAGGCCTCTGATGG - Intergenic
1111441288 13:88285505-88285527 CTAGACCTCCAGGCCTGTGAGGG - Intergenic
1111457680 13:88506292-88506314 CTAGGCCTCCATGCCTCTGATGG - Intergenic
1112031393 13:95459660-95459682 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1112163090 13:96889329-96889351 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1112512200 13:100019995-100020017 CTAGGCCTCCAGGCCTGTGAAGG - Intergenic
1112568267 13:100569563-100569585 CTAGGTCTCCAGGCCTGTGATGG + Intronic
1112789575 13:102988106-102988128 CTAGGCCTCCAGGCCTGTGACGG + Intergenic
1113167041 13:107453560-107453582 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1113446956 13:110376677-110376699 CTAGTTCTGCAGGCCCAGGAGGG + Intronic
1114557254 14:23569103-23569125 CTTTTTCACTAGGCCTCAGAGGG + Exonic
1114707067 14:24737896-24737918 CTAGGTCTCCAGGCATGCGATGG + Intergenic
1114795724 14:25712737-25712759 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1115481777 14:33867887-33867909 CTAGACCTCCAGGCCTGTGATGG + Intergenic
1115916594 14:38321661-38321683 CTACTTCTCCAGGCCTGTGTTGG + Intergenic
1116263516 14:42660640-42660662 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1116293463 14:43073792-43073814 CTAGGCCTCCAGGCCTGTGAAGG - Intergenic
1116387346 14:44348094-44348116 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1116625137 14:47254114-47254136 CTAGCCCTCCAGGCCTGTGATGG + Intronic
1116789691 14:49327344-49327366 CTAGGCCTCCAGGCCTTTGATGG - Intergenic
1116917215 14:50537075-50537097 CTAGGTCTCCTGGCCTGTGATGG - Intronic
1116931390 14:50694483-50694505 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1117234291 14:53754858-53754880 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1117413544 14:55472510-55472532 CTCGATCTCCTGGGCTCAGATGG + Intergenic
1117745561 14:58865855-58865877 CTGGTTCTCCAGGTCTTACAGGG - Intergenic
1117779767 14:59220605-59220627 CTAGTTCTCCAGCTTGCAGATGG - Intronic
1117854231 14:60010476-60010498 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1117907466 14:60605499-60605521 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1117908270 14:60612257-60612279 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1119228856 14:72964466-72964488 CTAGAACTCCTGGCCTCAAAGGG + Intergenic
1119305827 14:73607458-73607480 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1119681300 14:76594059-76594081 CTGGTTCTCCAGCTCACAGACGG + Intergenic
1119996564 14:79260415-79260437 CTAGTTCTCTGGGCCTTAAATGG - Intronic
1120104004 14:80473891-80473913 CTAGGACTCCAGGCCTGTGATGG + Intergenic
1120326521 14:83036666-83036688 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1120392770 14:83929605-83929627 CTAGGTCTCCAGGCTTGTGATGG - Intergenic
1120457739 14:84754309-84754331 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1120623229 14:86791967-86791989 CTAGTCCTCCAGGCTTGTGATGG - Intergenic
1120799825 14:88675549-88675571 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1121130182 14:91439008-91439030 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1121842263 14:97144392-97144414 CTAGATCCCCAGGGATCAGATGG + Intergenic
1121925850 14:97926779-97926801 CTGGGACTCCAGGCCTCAGCAGG + Intronic
1122765558 14:104066952-104066974 CTAGTCCTCCAGGCCTGTGATGG + Intergenic
1123795560 15:23766936-23766958 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1124191461 15:27580758-27580780 CTCGTTCTCCAGCCTGCAGATGG - Intergenic
1124509117 15:30307077-30307099 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1124734442 15:32231585-32231607 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1125472135 15:40014615-40014637 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1125515114 15:40314517-40314539 CTTGAGCTCCTGGCCTCAGATGG - Intergenic
1126647963 15:50894144-50894166 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1127791033 15:62398928-62398950 CTAGGCCTCCGGGCCTGAGATGG - Intronic
1131589380 15:93731716-93731738 CTGGTTCTCAAGGCATTAGAAGG + Intergenic
1132520335 16:384297-384319 CAAGTTCACCAGCCCTCAGCTGG - Intronic
1134184017 16:12069063-12069085 CCCGTTCTCCAGGCTTCCGAGGG - Exonic
1137350149 16:47706294-47706316 CTCTTACTCCTGGCCTCAGACGG + Intergenic
1137638513 16:50008549-50008571 CTGGGCCTCCAGGCCTCAGATGG - Intergenic
1137729778 16:50680943-50680965 CTTATTCTCCAGGCCCAAGATGG + Intronic
1138970207 16:62134222-62134244 CTAGTCCTCTAGGCCTGTGATGG + Intergenic
1138997602 16:62474031-62474053 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1139451974 16:67035302-67035324 CTTGTACTCCTGACCTCAGATGG + Intronic
1140643493 16:77004041-77004063 CTAGTTCTTCAGTCCAGAGATGG - Intergenic
1141037861 16:80643828-80643850 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1141726458 16:85792462-85792484 CGAGTTCTCCATTCCTCAGTTGG - Intronic
1142329206 16:89440141-89440163 CTACTTCTCCAGTCCTCAAGGGG + Intronic
1143130395 17:4673664-4673686 CTTCTTCCCCAGGCCTCAGCCGG - Exonic
1143210893 17:5186456-5186478 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1143935761 17:10482285-10482307 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1144351604 17:14402503-14402525 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1145772195 17:27501494-27501516 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1146133613 17:30298638-30298660 CCAGTTCTCCTGGACACAGATGG - Intergenic
1146821456 17:35986202-35986224 CTGAATCTCCAGGCCTCACATGG - Intronic
1148640714 17:49185269-49185291 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1149341086 17:55687191-55687213 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1149405853 17:56350210-56350232 ATAGTTCACCAAGCCTCAGATGG + Intronic
1150203075 17:63377152-63377174 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1150515685 17:65807525-65807547 CTAGTCCTCCAGGCCTATGGTGG - Intronic
1151135791 17:71944883-71944905 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1151249760 17:72825115-72825137 CTAGGCCTCCAGGCCTATGATGG - Intronic
1151978110 17:77493609-77493631 CTGGTCCTCAGGGCCTCAGAAGG - Intronic
1153348397 18:4052551-4052573 CTAGTCCTCCAGGCCTGTGACGG + Intronic
1154234156 18:12587589-12587611 CTAATTCTGCAGGCCTGTGAAGG - Intronic
1155988158 18:32252637-32252659 CTAGGCCTCCTGGCCTCTGATGG + Intronic
1156052396 18:32952577-32952599 CTAGGCCTCCAGGCCTGTGACGG + Intronic
1156065614 18:33139882-33139904 CTAGGTCTCCAGGCCTGTGATGG - Intronic
1156122719 18:33864139-33864161 CTAGACCTCCAGGCCTATGATGG + Intronic
1156207940 18:34906295-34906317 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1156357973 18:36359429-36359451 CTAATTTCCCTGGCCTCAGAAGG - Intronic
1156914410 18:42448172-42448194 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1157077217 18:44479273-44479295 CCAGGTCTCCAGGCCTGTGATGG - Intergenic
1157239466 18:45996180-45996202 CAAGTTCTCCATGCCCAAGAAGG + Intronic
1158299280 18:56033582-56033604 CTAGGTCTCCAGGCCTGTGGTGG + Intergenic
1158621665 18:59037964-59037986 CTAGTTCCAAAGGTCTCAGAAGG + Intergenic
1159129142 18:64260065-64260087 CTAGGTCTCAAGGCCCCAGAGGG + Intergenic
1159308750 18:66680050-66680072 CTAGAACTCCTGGCCTCAAAAGG - Intergenic
1159439214 18:68455990-68456012 CCAGGTCTCCAGGCCTATGATGG - Intergenic
1160599363 18:80001017-80001039 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1161470157 19:4453246-4453268 CCACTTCTCCAGGCCTGAGCCGG + Intronic
1161612872 19:5252940-5252962 CAAGTTCCCCTGGCATCAGAGGG + Intronic
1162787897 19:13047046-13047068 CTAGTTATCCAGGACTCTTAAGG + Intronic
1167250464 19:48396248-48396270 CCAGTCCTCCAGGACTCTGAAGG - Intronic
1168033804 19:53702974-53702996 CTAGATCTCTTGGGCTCAGATGG + Intergenic
1168036896 19:53727150-53727172 CTAGATCTCTAGGGCTCAAATGG + Intergenic
925527059 2:4814336-4814358 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
925669128 2:6292882-6292904 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
926502495 2:13673453-13673475 CTAGACCTCCAGGCCTTTGATGG + Intergenic
926508088 2:13740874-13740896 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
926768973 2:16351291-16351313 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
926870185 2:17407756-17407778 CTAGATCTCAAGGCCTGTGAGGG - Intergenic
927341937 2:21992577-21992599 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
928274621 2:29888869-29888891 CGAGTTCCCCAGGAGTCAGAAGG - Intronic
928821984 2:35372674-35372696 CTAGGCCTTCAGGCCTCTGATGG - Intergenic
928906192 2:36370500-36370522 CAAGTTTTCCAGCCCTCAGTTGG - Intronic
929081558 2:38127426-38127448 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
929106955 2:38375181-38375203 CTATTTCTCCAGGAAGCAGAGGG + Intronic
930523463 2:52497410-52497432 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
932648557 2:73530989-73531011 CTAGGCCTCCAGGCCTGTGATGG + Intronic
932910145 2:75797954-75797976 CTGGTTCTCCAGCTCACAGATGG - Intergenic
932956440 2:76356975-76356997 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
932960602 2:76408660-76408682 CTAGATCTCCAGGCCTGTGATGG - Intergenic
933047552 2:77558033-77558055 CTAGGCCTCCAGGCCTGTGATGG - Intronic
933343210 2:81048824-81048846 CTAGGTCTCTGGGCCTGAGATGG + Intergenic
933578143 2:84093043-84093065 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
935797928 2:106663694-106663716 CTAGGTCTCCAGGCCTATGATGG - Intergenic
936346469 2:111679257-111679279 CTGGGTCCCCAGGCCTCAAAAGG + Intergenic
936814700 2:116445271-116445293 CTAGTTCTCCAGGTCTATGATGG + Intergenic
937008886 2:118543923-118543945 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
937142482 2:119613686-119613708 CTAGGTCTCCAGACCTGTGATGG + Intronic
938218315 2:129542622-129542644 CTTGTTCTCCATGACTTAGATGG - Intergenic
938698120 2:133853057-133853079 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
938928119 2:136062885-136062907 CTAGTTGTCCAGGCAAGAGAAGG - Intergenic
939092823 2:137799242-137799264 CTAGGACTCCAGGCCTGTGATGG - Intergenic
939224971 2:139353637-139353659 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
939762375 2:146198855-146198877 CTAGCCCTCCAGGCCTGTGATGG - Intergenic
939800502 2:146700982-146701004 CGAGGTCCCCAGGCCTCAGGTGG - Intergenic
940484054 2:154275312-154275334 CTAGGCCTCCAGGCCTGTGATGG - Intronic
940533150 2:154905123-154905145 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
940543027 2:155046064-155046086 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
940699242 2:157021455-157021477 CTGGTTCTCCAGGTCACAGATGG - Intergenic
941057680 2:160807070-160807092 CTAGGCCTCCAGGTCTAAGATGG + Intergenic
941123691 2:161561430-161561452 CTAGGCCTCCAGGCCTTTGATGG - Intronic
941227278 2:162865344-162865366 CTAGGCCTCCAGGCCTTTGATGG + Intergenic
941525221 2:166598259-166598281 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
942203291 2:173593320-173593342 CTAGTCCTCCAGGCCTGTGATGG + Intergenic
942283342 2:174389700-174389722 CTAGGCCTCCAGGCCTATGATGG - Intronic
942724798 2:178994516-178994538 CTAGGCCTCCAGGCCTGTGATGG + Intronic
943543323 2:189244078-189244100 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
943620271 2:190140696-190140718 CTAGGCCTCCAGGCCTGTGATGG + Intronic
943817770 2:192277703-192277725 CTAGTCCTCCAGGCGTGTGATGG + Intergenic
944101779 2:196035654-196035676 TAAGTTTTCCATGCCTCAGAGGG - Intronic
944272262 2:197796617-197796639 CTAGACCTCCAGGCCTGTGATGG + Intergenic
944491490 2:200262659-200262681 CTAGGTCTCTAGGCCTGTGATGG - Intergenic
944920979 2:204412943-204412965 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
945073594 2:206015325-206015347 CTAGGCCTCCAGGCCTATGATGG - Intronic
945166685 2:206954068-206954090 CTAGGCCTCCAGGCCTGTGATGG + Intronic
945456300 2:210055994-210056016 CTAAGTCTCCAGGCCTGTGATGG - Intronic
945534021 2:210989589-210989611 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
945618647 2:212106688-212106710 CTAGGCCTCCAGGCCTGTGATGG - Intronic
946028355 2:216686152-216686174 CTATTTCTCCCGGCCTAAAATGG - Intronic
946325182 2:218981396-218981418 CTAGGTCTCCAGGTCCCGGAGGG - Exonic
946732291 2:222721036-222721058 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
947048780 2:226018853-226018875 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
947893477 2:233646258-233646280 CTAGGCCTCCAGGCCTGTGATGG + Intronic
947903062 2:233738905-233738927 CTAGGCCTCCAGGCCTGTGATGG - Intronic
947904479 2:233750570-233750592 CTAGGCCTCCAGGCCTGTGATGG - Intronic
948009081 2:234636484-234636506 CTAGGGCTCCAGGCCTGTGAGGG - Intergenic
948016788 2:234697518-234697540 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
948773141 2:240262686-240262708 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1169305635 20:4488043-4488065 CTAGATCTCCAGGGCACAAAGGG + Intergenic
1170741774 20:19064946-19064968 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1170750392 20:19139790-19139812 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1171001925 20:21423542-21423564 CTAGACCTCCAGGCCTGTGATGG + Intergenic
1171387461 20:24779915-24779937 CTAGCTCTCCAGTCCTCCCAGGG - Intergenic
1171399635 20:24864598-24864620 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1172812034 20:37654973-37654995 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1174337113 20:49870557-49870579 CAGGTTCTGCAGGCCTGAGAAGG + Intronic
1174448359 20:50605280-50605302 ATAATTCTCCAGGCCACAGAGGG - Intronic
1174824417 20:53756585-53756607 CCAGCTCTCCAGGACTCAGGGGG - Intergenic
1175492007 20:59385575-59385597 CTAGGTCTGCAGGCCACAGAGGG + Intergenic
1176124272 20:63468535-63468557 CGAGTTCTCCAGGACTGTGAGGG + Intronic
1176689089 21:9882079-9882101 CTAGGTCACCAGGCCTGTGATGG + Intergenic
1177067906 21:16463859-16463881 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1177139654 21:17344522-17344544 CTAGTCCTCCAGGCCTGTGGTGG - Intergenic
1177236170 21:18392077-18392099 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1177285206 21:19040555-19040577 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1177478115 21:21650876-21650898 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1177528995 21:22336709-22336731 CTAGTCCTCCAGGCCTGTGATGG - Intergenic
1177654916 21:24004407-24004429 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1178011375 21:28290415-28290437 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1178143922 21:29716902-29716924 CTAGGCCTCCAGGCCTATGATGG - Intronic
1178216679 21:30606349-30606371 GAAGTTCCCCAGGCCTCAGGTGG - Intergenic
1179936641 21:44610288-44610310 CCAGGCCTCCAGGCCTCTGATGG - Intronic
1180153396 21:45964789-45964811 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1183136868 22:35897450-35897472 CTTGTTGTCCAGGACTCAAATGG + Intronic
1183455046 22:37918023-37918045 CTCCTTCTCCAGGACTCAGGTGG + Intronic
1184311888 22:43651166-43651188 CTAGACCTCCAGGCCTGTGATGG - Intronic
1184696937 22:46145030-46145052 CTCGAACTCCTGGCCTCAGATGG + Intergenic
949226940 3:1705803-1705825 CTGGTTTTCCAGGCCTCACTGGG - Intergenic
950678377 3:14568392-14568414 ATACTTCTCCTGGCCTCACAGGG - Intergenic
950682573 3:14595245-14595267 CTAGAACTCCTGGCCTCAGATGG + Intergenic
951446191 3:22782841-22782863 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
951980438 3:28560234-28560256 GTAATTCTCCATGCCTCAGAAGG - Intergenic
952202702 3:31147752-31147774 CCAGTCCTCCAGGCCTGTGACGG + Intergenic
952939748 3:38433301-38433323 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
953008015 3:38995718-38995740 CTGGTTCTCCAGCCTGCAGATGG + Intergenic
953898538 3:46823538-46823560 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
954379080 3:50210159-50210181 CTGCTCCTCCAGGCTTCAGAGGG - Intronic
954536282 3:51361698-51361720 GGACTGCTCCAGGCCTCAGATGG + Intronic
956169582 3:66422114-66422136 CTAGGCCTCCAGGCCTGTGATGG + Intronic
956412450 3:68993030-68993052 CTGGGTCTCCAGGCCTGTGATGG + Intronic
956474922 3:69609820-69609842 CTAGACCTCCAGGCCTGTGATGG - Intergenic
957403621 3:79749528-79749550 CTAGACCTCCAGGCCTGTGATGG - Intronic
957495072 3:80982149-80982171 CTAGGCCTCCAGGCCTTTGATGG - Intergenic
957524090 3:81357960-81357982 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
957675442 3:83357903-83357925 CTACTCCTCCAGGCCTCTAATGG + Intergenic
957843419 3:85699711-85699733 CTAGGCCTCCAGGCCTGTGATGG + Intronic
958010521 3:87873204-87873226 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
958083875 3:88780868-88780890 CTAGGTCTCCGGGCCTTTGATGG + Intergenic
958577672 3:95973804-95973826 CTAGGTCTCCAGGCTTGTGATGG - Intergenic
958857178 3:99399028-99399050 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
959149425 3:102591046-102591068 CTAGATCTCCAGGCCTGCAATGG - Intergenic
959229662 3:103632132-103632154 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
959754772 3:109883991-109884013 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
959838653 3:110949422-110949444 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
959973376 3:112431801-112431823 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
960060183 3:113312617-113312639 CTAGGCCTCCAGGCCTGTGATGG - Intronic
960335341 3:116410918-116410940 CTATTTCTCCAGGCCATAGGTGG + Intronic
960564449 3:119118529-119118551 CTAGGCCTCCAGGCCTCTGATGG + Intronic
961514878 3:127426298-127426320 CTTGTTCTCCAGGCCTCCTGTGG - Intergenic
961701862 3:128750816-128750838 CTAGGCCTCCAGGCCTGTGATGG - Intronic
962339537 3:134570111-134570133 CTAGGCCTCCAGGCCTGTGATGG + Intronic
962440238 3:135406545-135406567 CTGGTCCTCCAGGCCTGTGATGG + Intergenic
962509436 3:136084145-136084167 CTAGGCCTCCAGGCCTGTGATGG - Intronic
963011711 3:140776120-140776142 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
963297065 3:143557997-143558019 CTAGGCCTCCAGGCCTGTGATGG - Intronic
963363269 3:144303475-144303497 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
963391201 3:144665858-144665880 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
963593040 3:147286753-147286775 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
963949098 3:151179118-151179140 CTAGATCTCCTGACCTCAGGTGG - Intronic
964076731 3:152701008-152701030 CTGCTTCTCCAGGCCTGTGATGG + Intergenic
964456996 3:156879662-156879684 CTAGGCCTCCAGGCCTGTGATGG - Intronic
964520730 3:157563683-157563705 CTAGGCCTCCAGGCCTGTGATGG + Intronic
964737854 3:159934469-159934491 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
964912680 3:161801347-161801369 CTAGGTCTCCATGCCTGTGATGG + Intergenic
964989160 3:162785215-162785237 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
965083379 3:164064482-164064504 CTAGGCCTCCAGGCCTATGATGG - Intergenic
965127498 3:164649487-164649509 CTAGGTCTCCAGGACTGTGATGG - Intergenic
965146616 3:164913147-164913169 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
965809715 3:172579156-172579178 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
965911656 3:173785191-173785213 CTTGTTTCCCAGGCCACAGATGG + Intronic
966074993 3:175924960-175924982 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
966216399 3:177507779-177507801 CTAGATCTCCGGGCCTGCGATGG - Intergenic
967695780 3:192528938-192528960 CTAGTCCTCTAGGCCTGAGATGG + Intronic
968981425 4:3852027-3852049 CTAGTTCTCCGGGTCTGAGGCGG + Intergenic
969411311 4:7030117-7030139 CTAGCTCACCAGGCCAGAGAGGG + Intronic
969780097 4:9394720-9394742 CTAGGCCTCCAGGCCTTTGAGGG - Intergenic
969906838 4:10405081-10405103 CTAGGGCTCCAGGCTGCAGATGG + Intergenic
970217667 4:13776682-13776704 CTAGGCCTCCAGGCCTTTGATGG + Intergenic
970344071 4:15136185-15136207 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
970554263 4:17215391-17215413 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
970665837 4:18335063-18335085 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
970981634 4:22105894-22105916 CTGGTTCTCCAGTTTTCAGATGG - Intergenic
970997395 4:22283006-22283028 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
971070004 4:23080374-23080396 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
971593503 4:28498150-28498172 CTATGTCTCCAGGCTTCACAGGG + Intergenic
972100313 4:35407446-35407468 CTAGACCTCCAGGCCTGTGATGG - Intergenic
972251334 4:37305257-37305279 CTAGGTCTCCAGGCCTGTGATGG + Intronic
972262433 4:37423444-37423466 CTAGGCCTCCAGCCCGCAGATGG - Intronic
972370598 4:38419645-38419667 CTAGACCTCCAGGCCTGTGATGG + Intergenic
973010713 4:45069554-45069576 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
974012991 4:56624503-56624525 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
974112551 4:57542558-57542580 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
974666590 4:64969768-64969790 CCAGATCTCCAGGCCTGTGATGG + Intergenic
974733565 4:65899979-65900001 CTAGACCTCCAGGCCTGTGAAGG - Intergenic
974846064 4:67352069-67352091 CTAGGCCTCCAGGCCTGAGATGG + Intergenic
974897569 4:67957805-67957827 CTAGGTCTCCAGGCCTGTGATGG - Intronic
974923494 4:68270453-68270475 CTAGGCCTCCAGGCCTATGATGG + Intergenic
974952908 4:68603702-68603724 CTAGGACTCCAGGCCTGTGATGG - Intronic
975216464 4:71761602-71761624 CTAGGTCTCCAGGCCTGTGATGG - Intronic
975403294 4:73962121-73962143 CTAGATCTCCAGGCCTGTGATGG - Intergenic
975729274 4:77321494-77321516 CTAGGCCTCCAGGCCTGTGATGG + Intronic
975917900 4:79347025-79347047 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
975952305 4:79788792-79788814 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
976000822 4:80371280-80371302 CTAGGCCTCCAGGCCTGTGATGG + Intronic
976051074 4:81012212-81012234 CTTGGTCTCCAGGCCTGTGATGG - Intergenic
976283391 4:83347181-83347203 CTAGTCCTCCAGGCCTGTGATGG + Intergenic
976312120 4:83622909-83622931 CTAGATCTCTAGGCCTGTGATGG - Intergenic
976405652 4:84658356-84658378 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
976738524 4:88334718-88334740 CTAGTTCTCCATGCTACAGCTGG + Intergenic
976842320 4:89445792-89445814 CTAGGCCTCCAGGCCTCTGATGG + Intergenic
976952421 4:90849940-90849962 CTAGGCCTCCAGGCCTTGGATGG - Intronic
976988107 4:91327501-91327523 CTAGGCCTCCAGGCCTGTGATGG + Intronic
977046250 4:92071822-92071844 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
977356438 4:95952757-95952779 CTAGGTCTCCAGACCTGTGATGG + Intergenic
977415942 4:96733280-96733302 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
977512005 4:97973606-97973628 CTAGGCCTCCAGGCCTGTGATGG - Intronic
977545009 4:98367067-98367089 CTAGGCCTCCAGGCCTGTGATGG - Intronic
977783385 4:101005622-101005644 TTAGGTCTCCAGGCCTGTGATGG - Intergenic
977952882 4:102993993-102994015 CTAGGTCTCCAGGCCTGTGATGG + Intronic
978101122 4:104841622-104841644 CTAGGCCTCCAGGCCTATGATGG + Intergenic
978213193 4:106162818-106162840 CTAGGTCTCCAGGCCTATGATGG + Intronic
978666056 4:111183188-111183210 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
978761157 4:112357428-112357450 GTGGTGCTCCAGGCATCAGATGG - Intronic
978774387 4:112491028-112491050 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
978904010 4:113985264-113985286 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
978915732 4:114124273-114124295 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
978991203 4:115084508-115084530 CTAGGCCTCCAGGCCTGTGATGG - Intronic
979182807 4:117752991-117753013 CTAGGCCTCCAGGCGTCTGATGG - Intergenic
979411430 4:120384420-120384442 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
979895889 4:126156729-126156751 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
979895909 4:126156823-126156845 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
980153757 4:129080102-129080124 CTATGTCTCCAGGCCTGTGATGG + Intronic
980346801 4:131633017-131633039 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
980352471 4:131699896-131699918 CTAGGTCACCAGGCCTGTGATGG + Intergenic
980458250 4:133073043-133073065 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
980702769 4:136454623-136454645 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
981155260 4:141427322-141427344 CTGATTCTCCAGCTCTCAGAAGG + Intergenic
981242348 4:142492912-142492934 CTAGGTCTCCAGGGCTGTGATGG - Intronic
981275373 4:142893219-142893241 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
981356913 4:143799410-143799432 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
981368444 4:143930007-143930029 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
981378241 4:144040292-144040314 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
981914193 4:150015795-150015817 ATAGGCCTCCAGGCCTCTGAGGG + Intergenic
981915321 4:150026884-150026906 CTAGGTCTCCAGGGCTGTGATGG - Intergenic
982299838 4:153867542-153867564 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
982301164 4:153880880-153880902 CTAGGCCTCCAGGCCTTTGATGG - Intergenic
982805213 4:159754956-159754978 CTAGACCTCCAGGCCTGTGATGG - Intergenic
983006352 4:162490203-162490225 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
983348598 4:166559071-166559093 CTAGGTCTCTAGGCCTGTGATGG - Intergenic
983379075 4:166968380-166968402 CTAGGCCTCCAGGCCTGTGATGG - Intronic
983456352 4:167969181-167969203 TGAGTTCTCCAGGCCCCAGGTGG - Intergenic
983657550 4:170098426-170098448 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
983669044 4:170215045-170215067 CTAGTCCTCCAGGCCTATGATGG - Intergenic
983812292 4:172077839-172077861 CTAGGTCTCCAGGCCTGTGATGG - Intronic
983886752 4:172988639-172988661 CTAGGCCTCCAGGCCTGTGATGG - Intronic
984065544 4:175043671-175043693 CTATGTCTCCAGGCCTAGGATGG - Intergenic
984364702 4:178783748-178783770 TTAGTTCTCAAGTCATCAGATGG + Intergenic
984699848 4:182811859-182811881 CTAGACCTCCAGGCCTGTGATGG + Intergenic
985220270 4:187696788-187696810 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
985371702 4:189292154-189292176 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
986021609 5:3809489-3809511 CCACTTCTCAAGGCCTTAGATGG + Intergenic
986105554 5:4656148-4656170 CTAGGCCTCCAGGCCTATGATGG + Intergenic
986173241 5:5330723-5330745 CTGGTTCTCCAGGCTGCAGAGGG + Intergenic
986226248 5:5817287-5817309 CTAGGTCTCCAGCTTTCAGATGG - Intergenic
986258750 5:6124143-6124165 TTAGGTCTCCAGGCCTGTGATGG + Intergenic
986615038 5:9607058-9607080 CTATTTCTCTAGGCCTCTTAAGG + Intergenic
987000026 5:13651225-13651247 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
987201756 5:15584184-15584206 CTAGTCCTCCAGGCCTGTGATGG + Intronic
987216616 5:15744042-15744064 CTAGGCCTCCAGGCCTGTGAAGG + Intronic
987433516 5:17865183-17865205 CTAGGCCTCCAGGCCTATGATGG - Intergenic
987435207 5:17885514-17885536 CTAGGTCTCCAGGCCTCTCATGG - Intergenic
987457595 5:18165914-18165936 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
987510284 5:18828581-18828603 CTAGGTCTCCAGGTCTGTGATGG - Intergenic
987542763 5:19276634-19276656 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
987597479 5:20020433-20020455 CTAGGCCTCCAGGCCTTTGATGG - Intronic
987862002 5:23500684-23500706 CTAGGCCTCCAGGCCTCTAATGG + Intergenic
987962979 5:24834377-24834399 CTAGTTCTCCAGCCTGCAGATGG + Intergenic
987984853 5:25133826-25133848 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
988031670 5:25771225-25771247 CTAGGCCTCCAGGCCTAGGATGG - Intergenic
988061415 5:26175421-26175443 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
988353549 5:30143086-30143108 CTAGACCTCCAGGCCTGTGATGG + Intergenic
988928524 5:36013363-36013385 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
989507763 5:42247139-42247161 CTAGACCTCCAGGCCTGAGATGG + Intergenic
990083358 5:51944634-51944656 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
990086568 5:51985978-51986000 CTTGTTCTCCAGGTATCACATGG - Intergenic
990213761 5:53508317-53508339 CTAGGCCTCCAGGCCTGTGAAGG + Intergenic
990291212 5:54354070-54354092 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
990526033 5:56628803-56628825 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
990701108 5:58475631-58475653 CTAGGCCTCCGGGCCTCTGATGG + Intergenic
991010004 5:61872403-61872425 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
991030604 5:62078272-62078294 CTACATCTCAAGGGCTCAGAGGG - Intergenic
991116892 5:62964637-62964659 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
991122503 5:63032471-63032493 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
991186533 5:63815332-63815354 CTAGATCTCCAGGCCTATGATGG - Intergenic
991355795 5:65767504-65767526 CTAGGCCTCCAGGCCTGTGATGG + Intronic
991940854 5:71850591-71850613 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
992375697 5:76185722-76185744 CTAGGCCTCCAGGCCTGTGATGG + Intronic
993285473 5:85990943-85990965 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
993442904 5:87978513-87978535 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
993531192 5:89027269-89027291 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
993752909 5:91692284-91692306 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
994425161 5:99576344-99576366 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
994436177 5:99735889-99735911 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
994524161 5:100882625-100882647 CTAGGTCTCCAGGTCTGTGATGG - Intronic
994580312 5:101632959-101632981 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
994637728 5:102363620-102363642 CTAGGCCTCCAGGCCTGCGATGG + Intergenic
994655998 5:102593606-102593628 CTAGACCTCCAGGCCTGTGATGG + Intergenic
994808206 5:104479155-104479177 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
994833047 5:104810365-104810387 TTAGGTCTCCAGGCCTGTGATGG + Intergenic
995055366 5:107753583-107753605 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
995147726 5:108806013-108806035 CTAGGCCTCCAGGCCTATGATGG - Intronic
995429070 5:112054584-112054606 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
995724176 5:115167227-115167249 CTAGGCCTCCAGGCCTGTGATGG + Intronic
996030971 5:118703448-118703470 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
996072574 5:119150314-119150336 CTAGTTTACCAGGACTCAGCCGG + Exonic
996618671 5:125472743-125472765 CTAGTTCTCATGGCTTCTGAAGG + Intergenic
997108278 5:131046141-131046163 CTAGACCTCCAGGCCTGTGATGG + Intergenic
997116098 5:131127259-131127281 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
997181457 5:131832915-131832937 CTAGGCCTCCAGGCCTGTGATGG + Intronic
998157115 5:139793363-139793385 CTAGCTCCCTAGGGCTCAGAGGG - Intergenic
998813977 5:145993747-145993769 CTAGGCCTCCAGGCCTGTGATGG + Intronic
998873518 5:146576004-146576026 CTAGGTCTCCAGGCCTGTGGTGG + Intergenic
998980518 5:147697521-147697543 CTAGGCCTCCAGGCCTGTGATGG - Intronic
999394004 5:151215006-151215028 CTAGTTCTGGTTGCCTCAGAGGG + Intronic
1000359384 5:160433255-160433277 CTGGTTCTGCAGCCCTCAAAGGG - Intergenic
1000777919 5:165442404-165442426 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1002991245 6:2241085-2241107 CTAGGTCTCTGGGCCTCTGATGG - Intronic
1003484464 6:6563566-6563588 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1004997041 6:21203595-21203617 CTTGAACTCCAGGCCTCAAACGG + Intronic
1005272214 6:24178617-24178639 CTATTTCTGCTGGCCTCTGATGG + Exonic
1005428769 6:25731842-25731864 CTAGTTCCCCAGGCAGCAGCAGG + Intergenic
1005655308 6:27929352-27929374 CTAGGTCTCCAGGCCTATGATGG + Intergenic
1005982946 6:30851527-30851549 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1006217030 6:32453345-32453367 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1006298059 6:33178822-33178844 CTAGTTCTCCAGGCTTCCCCAGG - Intronic
1006415268 6:33899986-33900008 CAAGGTCTCCTGGTCTCAGAGGG + Intergenic
1007777964 6:44234284-44234306 GTAGTCCTCTTGGCCTCAGAGGG + Intergenic
1008032671 6:46714500-46714522 ATTTTTCACCAGGCCTCAGAGGG + Exonic
1008220910 6:48852458-48852480 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1008261040 6:49366765-49366787 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1008756089 6:54797082-54797104 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1009209718 6:60847590-60847612 CTGGTTCTCCAGCCTGCAGAAGG - Intergenic
1009527430 6:64764516-64764538 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1009605146 6:65857611-65857633 CTAGATCTCCTGGCCTGTGATGG + Intergenic
1009607824 6:65896551-65896573 TTAGGTCTCCAGGCCTGTGATGG + Intergenic
1009637076 6:66280367-66280389 CTAGGCCTCCAGGCCTCTGATGG - Intergenic
1009637543 6:66285177-66285199 CTAGTTCTCCAGGCCTATGAGGG - Intergenic
1009715855 6:67394425-67394447 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1009729282 6:67579059-67579081 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1009772436 6:68160912-68160934 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1010366672 6:75059273-75059295 CTAGGTCTCCAAGCCTGTGATGG + Intergenic
1010536575 6:77038439-77038461 TTAGGTCTCCAGGCCTGTGATGG - Intergenic
1010605908 6:77889713-77889735 CTAGGACTCCAGGCCTGTGATGG - Intronic
1010611827 6:77962866-77962888 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1010645886 6:78387075-78387097 CTGGTCCTCCAGGCCTGTGATGG + Intergenic
1010978371 6:82341563-82341585 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1011041116 6:83031731-83031753 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1011110585 6:83833455-83833477 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1011218926 6:85033777-85033799 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1011461995 6:87614356-87614378 CTAGGTCTCCAGGCTTGTGATGG + Intronic
1011772120 6:90685093-90685115 CTAGTTCTCCAGTACACAGATGG - Intergenic
1011867914 6:91854287-91854309 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1011876230 6:91965803-91965825 CCAGGTCTCCAGGCCTATGATGG - Intergenic
1012005382 6:93707505-93707527 CTAGGCCTCCAGGCCTACGATGG - Intergenic
1012068266 6:94577558-94577580 CTAGGTCTCCAGGCTTGTGATGG + Intergenic
1012070261 6:94604932-94604954 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1012078711 6:94727923-94727945 CTAGTCCTCTAGGCCTGTGATGG + Intergenic
1012194217 6:96318448-96318470 CTAGGTCTCAAGGCCTATGATGG + Intergenic
1012254394 6:97015791-97015813 CTAGGCCTCCATGCCTCTGATGG - Intronic
1012691597 6:102319841-102319863 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1012780124 6:103546981-103547003 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1012830764 6:104201370-104201392 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1013086601 6:106863011-106863033 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1013338628 6:109191526-109191548 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1013503079 6:110771511-110771533 CTAGGACTCCAGGCCTGTGATGG + Intronic
1013918118 6:115366573-115366595 CTGGGTCTCCAGGCCTGTGATGG - Intergenic
1013925223 6:115464110-115464132 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1014143661 6:117971859-117971881 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1014161894 6:118179247-118179269 CTAGTTCTCCAGCTTGCAGATGG - Intronic
1014407424 6:121068907-121068929 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1014525930 6:122501677-122501699 CTAGACCTCCAGGCCTATGATGG + Intronic
1014562981 6:122913704-122913726 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1014771752 6:125465465-125465487 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1015713164 6:136163474-136163496 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1016122718 6:140363958-140363980 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1016185337 6:141191863-141191885 CTAGGTCTCCAGGCCTGTTATGG + Intergenic
1016587682 6:145708365-145708387 CTGCTTCTCCAGGCCTGTGATGG - Intronic
1017525434 6:155237840-155237862 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1017654483 6:156614218-156614240 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1017670229 6:156763610-156763632 CTCGAACTCCTGGCCTCAGATGG - Intergenic
1018502085 6:164422311-164422333 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1018516153 6:164581802-164581824 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1018554532 6:165036211-165036233 CTAGGACTCCAGGCCTGTGATGG - Intergenic
1019150464 6:170002016-170002038 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1020172698 7:5857409-5857431 CTAGTTCTGCAAGTCTCAAAAGG + Intergenic
1021519638 7:21526612-21526634 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1021646790 7:22796638-22796660 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1021776206 7:24057727-24057749 CATGCTCTCCAGGCCTCTGAGGG + Intergenic
1023188590 7:37555702-37555724 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1023602058 7:41889962-41889984 ATAATGCTACAGGCCTCAGAAGG - Intergenic
1023650560 7:42364604-42364626 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1024229851 7:47355456-47355478 CTGATTCTCCAGGGCTCTGACGG - Intronic
1024415950 7:49107586-49107608 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1024487124 7:49931789-49931811 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1025038520 7:55619064-55619086 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1025843437 7:65173460-65173482 GTTCTTTTCCAGGCCTCAGATGG + Intergenic
1025879607 7:65522507-65522529 GTTCTTTTCCAGGCCTCAGATGG - Intergenic
1025893830 7:65680081-65680103 GTTCTTTTCCAGGCCTCAGATGG + Intergenic
1025909074 7:65812925-65812947 CTCGATCTCCTGACCTCAGATGG + Intergenic
1026348934 7:69498833-69498855 CTAGTTCTCCAGCTTGCAGATGG - Intergenic
1027369532 7:77493966-77493988 CTAGATCTCCAGGCCTGTGATGG - Intergenic
1027390815 7:77701870-77701892 CTGGAACTCCTGGCCTCAGATGG + Intronic
1027395292 7:77747374-77747396 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1027586727 7:80066850-80066872 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1027695491 7:81404820-81404842 ATAGGTCTCCAGGCCTGTGATGG + Intergenic
1027798410 7:82721408-82721430 CCTGTTCTTCAGGTCTCAGAAGG - Intergenic
1028143782 7:87299166-87299188 CTAGGTCTCTGGGCCTGAGATGG + Intergenic
1028516318 7:91681245-91681267 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1028668394 7:93372647-93372669 CTAGGCCTCCAGGCCTGAGATGG + Intergenic
1030023572 7:105299671-105299693 CTAGAACTCCTGACCTCAGATGG - Intronic
1030144726 7:106341526-106341548 CTAGGTCTCCATGCCTGTGATGG + Intergenic
1030415438 7:109238004-109238026 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1030527692 7:110673361-110673383 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1030807204 7:113932568-113932590 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1030986247 7:116245049-116245071 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1031158137 7:118135216-118135238 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1031396960 7:121285295-121285317 CTAGTCCTCCAGTCCTGTGATGG + Intronic
1031435650 7:121728892-121728914 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1031573074 7:123383269-123383291 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1031608198 7:123794435-123794457 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1032179256 7:129661212-129661234 CTAGGTCTCCAGGCCTATGATGG + Intronic
1032454004 7:132058191-132058213 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1033072805 7:138220449-138220471 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1033737600 7:144238906-144238928 CTTGTTCCCCAAGCTTCAGATGG + Intergenic
1033745456 7:144312051-144312073 CTTGTTCCCCATGCTTCAGATGG - Intergenic
1033760032 7:144427758-144427780 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1034071523 7:148190640-148190662 CTGGTTCTCCAGGTTGCAGACGG - Intronic
1034728893 7:153366101-153366123 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1034740051 7:153465595-153465617 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1034751288 7:153571374-153571396 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1034874565 7:154713730-154713752 CTAGGTCTCCAGACCTGTGATGG + Intronic
1034876193 7:154726585-154726607 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1035951854 8:4030579-4030601 CTAGACCTCCAGGCCTGTGATGG + Intronic
1036452917 8:8883976-8883998 CTTGATCTCCTGGCCTCAAATGG - Intronic
1037205967 8:16320637-16320659 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1038008540 8:23455809-23455831 CAAATTCTCCAGGTCTAAGACGG + Intronic
1038051700 8:23820190-23820212 CTGGTTCTCCAGCTTTCAGAGGG - Intergenic
1039082379 8:33745607-33745629 CTAGATCTTCAGGCCTGTGATGG + Intergenic
1039107453 8:34004500-34004522 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1039121903 8:34157275-34157297 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1039776766 8:40744838-40744860 CTAGTTCGGCAGCCCTTAGAAGG + Intronic
1040966024 8:53082009-53082031 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1041119249 8:54569926-54569948 CTCGTCCTCCAGGTCTCAGGTGG - Intergenic
1041849819 8:62378482-62378504 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1043065773 8:75568120-75568142 CTAGGCCTCCAGGCCTGGGATGG + Intergenic
1043266325 8:78271224-78271246 CTAGGTCTCCTGGCCTGTGATGG + Intergenic
1043426061 8:80150027-80150049 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1043518513 8:81019387-81019409 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1043776683 8:84278377-84278399 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1044055900 8:87569543-87569565 CTAGTTCTCTAGGCCTATAAGGG - Intronic
1044066608 8:87706496-87706518 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1044188399 8:89283691-89283713 CTAGATCTCCAGTCCTGTGATGG - Intergenic
1044220484 8:89663675-89663697 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1044303892 8:90616380-90616402 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1044326872 8:90868916-90868938 CTAGGCCTCCAGGCCTATGATGG - Intronic
1044504705 8:93004428-93004450 CTAGGCCTCCAGGCCTGAGATGG + Intronic
1045050537 8:98320225-98320247 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1045053648 8:98349884-98349906 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1045207367 8:100056470-100056492 CTAGGCCTCCAGGCCTATGATGG - Intronic
1045588222 8:103563058-103563080 CTAAATCTCCAGGCCTGTGATGG + Intronic
1045617931 8:103939489-103939511 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1045849246 8:106673664-106673686 CTAAGTCTCCAGGCCTGTGATGG - Intronic
1045884463 8:107079072-107079094 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1046004164 8:108458703-108458725 CTAGGACTCCAGGCCTGTGATGG + Intronic
1046226381 8:111285759-111285781 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1046243805 8:111532377-111532399 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1046257713 8:111722388-111722410 CAAGGTCTCCAGGCCTGTGATGG + Intergenic
1046300214 8:112276983-112277005 CTAGACCTCCAGGCCTGTGATGG + Intronic
1046400381 8:113697383-113697405 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1046686381 8:117232172-117232194 CTAGTGCCCCAGGCAACAGATGG + Intergenic
1046735119 8:117768561-117768583 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1047378221 8:124325657-124325679 CTATTTTTCCAGGCCTGAGATGG - Intronic
1048236203 8:132693124-132693146 CTGGTTCTGCAGTCATCAGAGGG - Intronic
1049076260 8:140398882-140398904 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1049489676 8:142888676-142888698 CTAGGTCTCCAGGCCTGTGATGG + Intronic
1049821102 8:144634142-144634164 CTAGAACTCCAGGCCTCTGCAGG + Intergenic
1050121525 9:2313677-2313699 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1050332410 9:4558586-4558608 CTTGTACTCCAGGACTCAGCTGG - Intronic
1050529677 9:6577442-6577464 CTGGTTCTCCTGATCTCAGAGGG - Intronic
1051464723 9:17364925-17364947 ATAGTTCTCCAGCCCTAGGATGG - Intronic
1051914994 9:22198012-22198034 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1052079115 9:24180789-24180811 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1052187828 9:25620310-25620332 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1052294523 9:26882291-26882313 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1052625037 9:30963250-30963272 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1052969466 9:34368220-34368242 CTAGGCCTCCAGGCCTGTGATGG + Exonic
1053571905 9:39318612-39318634 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1053780238 9:41599817-41599839 CTAGGTCACCAGGCCTGTGATGG - Intergenic
1053882701 9:42611734-42611756 CTAGGTTTCCAGGCCTATGATGG + Intergenic
1053889968 9:42682568-42682590 CTAGGTTTCCAGGCCTATGATGG - Intergenic
1054093459 9:60877323-60877345 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1054114942 9:61153243-61153265 CTAGGTTTCCAGGCCTGTGATGG - Intergenic
1054125240 9:61300399-61300421 CTAGGTTTCCAGGCCTGTGATGG + Intergenic
1054168180 9:61809974-61809996 CTAGGTCACCAGGCCTGTGATGG - Intergenic
1054221728 9:62419202-62419224 CTAGGTTTCCAGGCCTATGATGG + Intergenic
1054228986 9:62489971-62489993 CTAGGTTTCCAGGCCTATGATGG - Intergenic
1054592814 9:67029291-67029313 CTAGGTTTCCAGGCCTGTGATGG + Intergenic
1054669348 9:67770844-67770866 CTAGGTCACCAGGCCTGTGATGG + Intergenic
1054897394 9:70329100-70329122 CTAGATCGCCAGGCCTGTGATGG + Intronic
1055363933 9:75524615-75524637 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1055669964 9:78594994-78595016 CCAGCTCTCTAGGCCTGAGATGG - Intergenic
1056048398 9:82742981-82743003 CTAGTTCTCCAGATTGCAGATGG - Intergenic
1056064226 9:82916469-82916491 CTAGCCCTCCAGGCCTGTGATGG + Intergenic
1056527358 9:87455633-87455655 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1056778471 9:89531812-89531834 CAAGGACTCCAGGCCCCAGAGGG - Intergenic
1056915103 9:90739329-90739351 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1058323039 9:103658306-103658328 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1058499077 9:105592055-105592077 CTACGTCTCCAGGCCTGTGATGG + Intronic
1059069548 9:111120719-111120741 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1059110821 9:111557012-111557034 CTAGGCCTCCAGGCCTTTGATGG + Intronic
1059416963 9:114168349-114168371 CAAGTTCTCCAGGCCTAGCAGGG - Exonic
1060622667 9:125082078-125082100 CTAGACCTCCAGGCCTGTGATGG - Intronic
1061043880 9:128154039-128154061 CCAATTCCCCAGGACTCAGAGGG + Intergenic
1061366603 9:130175260-130175282 CTTGTTCTCCCGCCCCCAGATGG + Intronic
1062243711 9:135552789-135552811 CTGGTCCTTCAGGCCTCACAGGG + Intergenic
1062670054 9:137703200-137703222 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1186313725 X:8346633-8346655 CTGGGTCTCCAGGCTGCAGAAGG + Intergenic
1188155511 X:26737000-26737022 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1188449531 X:30294812-30294834 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1188781762 X:34294783-34294805 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1189071346 X:37866876-37866898 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1189656437 X:43249624-43249646 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1189782004 X:44524027-44524049 CTAGTTTGCCAAGCTTCAGATGG + Exonic
1189901301 X:45709614-45709636 CTAGCTCTCCAGGCCACAAATGG - Intergenic
1190189893 X:48268434-48268456 CTGGTTCTCCCAGCCTTAGAAGG + Intronic
1190799585 X:53775153-53775175 CTGGTTCTCCAGGCCTCTCATGG + Intergenic
1191784046 X:64898026-64898048 TTAGGTCTCCAGGCCTTTGATGG + Intergenic
1192132666 X:68567525-68567547 CTAGGCCTCCAGGCCTGTGAGGG + Intergenic
1192309385 X:69997660-69997682 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1192335581 X:70216766-70216788 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1192362639 X:70449247-70449269 CTAGTTCTCCAGGCCTCAGAAGG - Intronic
1192841889 X:74865624-74865646 CTAGGCCTCCAGGCCTTTGATGG - Intronic
1193008092 X:76643754-76643776 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1193188335 X:78539337-78539359 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1193221268 X:78929299-78929321 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1193406396 X:81107197-81107219 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1193412661 X:81183337-81183359 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1193459771 X:81776113-81776135 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1193506271 X:82348328-82348350 CTAGTCCTCCAGGCCTGTGATGG + Intergenic
1193520103 X:82519068-82519090 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1193529894 X:82643417-82643439 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1193662549 X:84274557-84274579 CTAGGTCTCCAAGCCTGTGATGG + Intergenic
1193813780 X:86082195-86082217 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1193938535 X:87652209-87652231 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1193996020 X:88366544-88366566 CTAGGCCTCCAGGCCTATGATGG + Intergenic
1194082950 X:89490407-89490429 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1194254013 X:91613922-91613944 CTAGGACTCCAGGCCTGTGATGG + Intergenic
1194256878 X:91645965-91645987 CTAGACCTCCAGGCCTGTGATGG - Intergenic
1194501718 X:94690168-94690190 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1194518547 X:94890167-94890189 CTAGTTCTTCAGGTTCCAGATGG - Intergenic
1194534295 X:95086317-95086339 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1194578517 X:95642176-95642198 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1194944143 X:100048375-100048397 CTAAGTCTCCAGGCCTATGATGG - Intergenic
1196012663 X:110904966-110904988 CTAGGTCTCCAGGCCTGTGATGG + Intergenic
1196173604 X:112616744-112616766 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1196366807 X:114932752-114932774 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1196390688 X:115204268-115204290 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1196750242 X:119109460-119109482 CTAGTGCGCCATTCCTCAGAGGG - Intronic
1196973913 X:121138167-121138189 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1197092521 X:122556034-122556056 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1197223091 X:123932206-123932228 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1197299772 X:124763906-124763928 CTAATTCTCCAGGACATAGAAGG - Intronic
1197466163 X:126806931-126806953 CTGGGTCTCCAGGCCTGTGATGG - Intergenic
1197486537 X:127057743-127057765 CTAGTTCTCCAGCTTGCAGAGGG + Intergenic
1197536137 X:127691230-127691252 CTAGGTCTCCAGGCCTGTAATGG - Intergenic
1197642847 X:128985953-128985975 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1198274626 X:135089276-135089298 CTAGGCCTCCAGGCCTATGATGG - Intergenic
1198389859 X:136162982-136163004 TTAGTTCTCCAGCCTCCAGAGGG + Intronic
1198569732 X:137942178-137942200 CTAGACCTCCAGGCCTATGATGG - Intergenic
1198694948 X:139325514-139325536 GAAGTTCCCCAGGCCTCAGCTGG - Intergenic
1198912787 X:141633398-141633420 CTAGGCCTCCAGGCCTGTGATGG - Intronic
1198947091 X:142027260-142027282 CTAGGCCTCTAGGCCTCTGATGG + Intergenic
1198966839 X:142236770-142236792 CTAAGCCTCCAGGCCTCTGATGG - Intergenic
1199027936 X:142961426-142961448 CTATTCCTCCAGGCCTATGATGG + Intergenic
1199070443 X:143469343-143469365 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1199106540 X:143875586-143875608 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1199134434 X:144234152-144234174 CTAGGTCTCCAGGCTTGTGATGG - Intergenic
1199346538 X:146747152-146747174 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1199357131 X:146875581-146875603 CTAGGCCTCCAGGCCTCTGAGGG - Intergenic
1199389367 X:147261991-147262013 CTAGGCCTCCAGGCCTGTGATGG - Intergenic
1199776162 X:151013588-151013610 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1200039972 X:153358046-153358068 CTAGCCCTCCAGGCCTGTGATGG - Intronic
1200295414 X:154914265-154914287 CTAGGCCTCCAGGCCTGTGATGG + Intronic
1200380677 X:155834396-155834418 CTAGGTCTCCAGGCCTGTGATGG - Intergenic
1200435601 Y:3146280-3146302 CTAGGCCTCCAGGCCTGTGATGG + Intergenic
1200572799 Y:4853499-4853521 CTAGGACTCCAGGCCTGTGATGG + Intergenic
1200575596 Y:4885232-4885254 CTAGACCTCCAGGCCTGTGATGG - Intergenic