ID: 1192362863

View in Genome Browser
Species Human (GRCh38)
Location X:70450160-70450182
Sequence GCTGAAACCCAGGCCTGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192362863_1192362870 -6 Left 1192362863 X:70450160-70450182 CCCGCTCAGGCCTGGGTTTCAGC 0: 1
1: 0
2: 1
3: 38
4: 345
Right 1192362870 X:70450177-70450199 TTCAGCATTGCTGGGGGTATTGG 0: 1
1: 0
2: 2
3: 15
4: 214
1192362863_1192362871 12 Left 1192362863 X:70450160-70450182 CCCGCTCAGGCCTGGGTTTCAGC 0: 1
1: 0
2: 1
3: 38
4: 345
Right 1192362871 X:70450195-70450217 ATTGGCAACCAGCACATCCCAGG 0: 1
1: 0
2: 0
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192362863 Original CRISPR GCTGAAACCCAGGCCTGAGC GGG (reversed) Exonic
900090133 1:916627-916649 GCTGAGAGCCGGCCCTGAGCCGG + Intergenic
900124589 1:1063845-1063867 GCTGGTACCCTGGGCTGAGCTGG + Intergenic
900497443 1:2982454-2982476 GGTGGAACCCTGGCCTGATCAGG + Intergenic
900564423 1:3325333-3325355 GCTGATGCTCAGGCCTGAGCTGG - Intronic
900974927 1:6011076-6011098 GCTGAGTCCCAGGTCTGAACGGG - Intronic
901078444 1:6570080-6570102 GCTGAAACCCAGGAATGGGTAGG - Intronic
902236589 1:15061478-15061500 AGAGAATCCCAGGCCTGAGCAGG - Intronic
902501850 1:16916146-16916168 TCTGTTGCCCAGGCCTGAGCTGG - Intronic
902733564 1:18385460-18385482 GCTGCAGACCAGGCCAGAGCGGG + Intergenic
902992251 1:20196455-20196477 GCTGAGGCCCAGGCCTCAGCTGG - Intergenic
903971590 1:27122491-27122513 GCTGGCACACAGGCCTGACCCGG + Intronic
904013435 1:27403373-27403395 GACTAAACACAGGCCTGAGCAGG + Intergenic
904833492 1:33320455-33320477 GCTGAGACCCAGGACTGGGTGGG + Intronic
905170915 1:36109057-36109079 GATGAAACGCAGCCCTGCGCAGG + Intronic
905578296 1:39063482-39063504 TCTGAAACCCAGGTGTCAGCGGG - Intergenic
905887946 1:41501797-41501819 GCCACAGCCCAGGCCTGAGCTGG - Intergenic
905921478 1:41722282-41722304 GCTACATCCCAGGCCTGTGCTGG - Intronic
906151000 1:43587785-43587807 GATGAAACCCAGCCGTGGGCAGG - Intronic
906517387 1:46447825-46447847 ACAGACACCCAGACCTGAGCAGG - Intergenic
910624182 1:89288952-89288974 GCTACCACCCAGGCCTGAGAAGG - Intergenic
911059337 1:93734384-93734406 GTTGAACCTGAGGCCTGAGCTGG + Intronic
912223549 1:107704932-107704954 ACTGAAAACCAGGACTGAGCAGG + Intronic
912301858 1:108526086-108526108 ACAGAAGCCCAGGGCTGAGCTGG + Intergenic
913057999 1:115179705-115179727 CCTCAAACCCAGGCCTGCGGAGG - Intergenic
916358186 1:163936713-163936735 GCTGAAATCAAGGTCTCAGCAGG + Intergenic
917200246 1:172507070-172507092 GCAGAAAGTCAGGCCTGAGAAGG - Intergenic
917788503 1:178484864-178484886 GGTGGAACCCAGGCCTGTTCTGG - Intergenic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920235862 1:204504496-204504518 GTGGAAACCCAGGCCTGCTCAGG + Intergenic
920504746 1:206507845-206507867 GCTGCAGACCAGGCCGGAGCGGG - Exonic
922546358 1:226460243-226460265 GGTGAAACCCAGGGCTAACCTGG - Intergenic
922907185 1:229183055-229183077 GCTGAAACACAGGCCTTTGTGGG + Intergenic
922922962 1:229323410-229323432 GCTGCAACACAAGCCTGAGCTGG + Exonic
923126194 1:231036644-231036666 GCTGGAGCCCAGGGCTGAGAAGG - Intronic
923941260 1:238830129-238830151 GCTGCAATCCAGGCCTGCTCAGG - Intergenic
924775762 1:247113746-247113768 GCTCAAAACCAGGCATGGGCTGG - Intergenic
1063158940 10:3405403-3405425 AGTGGAACCAAGGCCTGAGCAGG + Intergenic
1066659052 10:37721524-37721546 GCAGACACCCAGGCCTGGGCTGG + Intergenic
1067043474 10:42970767-42970789 GCAGCCACCCAGGCCTGGGCCGG + Intergenic
1067079569 10:43205506-43205528 CCTGGAGCCCAGGGCTGAGCTGG - Intronic
1069862636 10:71481118-71481140 GCTGCCACCCAGGCCACAGCTGG - Intronic
1070930844 10:80259587-80259609 GCAGAAACCCACTACTGAGCTGG + Intergenic
1071486212 10:86104310-86104332 TCTGGAAGCCAGGCCTCAGCAGG + Intronic
1071909636 10:90216865-90216887 GCTAAAATCCAGGCGTCAGCAGG - Intergenic
1072800357 10:98388495-98388517 GCTCAATCACAGGCCTGTGCGGG + Exonic
1073707538 10:106001935-106001957 GCTAAAACCCAGGTGTCAGCAGG - Intergenic
1075212241 10:120501048-120501070 GCTGGAACCCTGGCAGGAGCTGG - Intronic
1075572783 10:123557635-123557657 GCTGAGCCCCAGGCCAGGGCAGG + Intergenic
1075650213 10:124123037-124123059 ACTGAAACCAAGGCTTGAGGAGG + Intergenic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076241717 10:128913651-128913673 TGTGAAACCCAAGGCTGAGCTGG - Intergenic
1076701572 10:132275870-132275892 GCAGACACCCAGGCCTGTGTCGG + Intronic
1076991930 11:279978-280000 GAGGAAACTGAGGCCTGAGCAGG + Intronic
1077115059 11:880395-880417 GCGGGAGCCCAGGCCTGTGCTGG + Intronic
1077209804 11:1364596-1364618 TCTGAAACCCAGGCTTGTGATGG + Intergenic
1077300818 11:1846152-1846174 GGTGAAGCCCAGCCCTGATCCGG - Intergenic
1077549333 11:3193124-3193146 GCTGAGCCACAGGCCTTAGCCGG - Intergenic
1078507989 11:11966266-11966288 GCTCAACCCCAGGCCTTTGCTGG - Intronic
1078754542 11:14196646-14196668 GGGGAAACCCAGCACTGAGCTGG - Intronic
1083632630 11:64103719-64103741 CCTGGCACCCAGCCCTGAGCAGG - Exonic
1083882216 11:65554232-65554254 GCTCAGGCCCCGGCCTGAGCAGG - Exonic
1083921937 11:65786083-65786105 GCTGAACCTCAGCCCTGGGCAGG + Intergenic
1083927249 11:65815385-65815407 GCCGCAGCCCAGGTCTGAGCCGG + Intergenic
1084681248 11:70667721-70667743 ACAGGAAGCCAGGCCTGAGCTGG + Intronic
1085267701 11:75246955-75246977 GCTCAGACCCAGGGCAGAGCAGG - Intergenic
1087948073 11:104189034-104189056 GCTGAAAACCAGGCAAAAGCAGG - Intergenic
1088437121 11:109826708-109826730 GCTGAAGCCCAGGTCAGAGATGG + Intergenic
1089169867 11:116504499-116504521 TCTGAAACCCAGATCTCAGCGGG + Intergenic
1089966623 11:122658919-122658941 GCTGAAATCAAGGCATCAGCAGG + Intronic
1092055331 12:5504117-5504139 GCAGAAACCCAGCCCTGGGTTGG - Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092915856 12:13188441-13188463 CCTGGAACTCAGGCTTGAGCTGG + Intergenic
1094222950 12:28013817-28013839 GCTGATACACAGGCCAGAACAGG - Intergenic
1095487436 12:42699693-42699715 GCTGAAATCAAGGCATCAGCTGG + Intergenic
1096679761 12:53247820-53247842 GCTGAAGCCCAGGACTGGGCTGG + Intergenic
1096680437 12:53252171-53252193 GCTGGAACCCGAGCCGGAGCCGG + Intronic
1096775407 12:53960828-53960850 GCTGAGACCCAGAGCAGAGCAGG + Intergenic
1097155812 12:57011533-57011555 TCTGGACCCCAGGCCTGAGTGGG - Intronic
1099164185 12:79281899-79281921 GCTGAAATCAAGGCGTCAGCAGG + Intronic
1102568884 12:113815385-113815407 CTTGACACCCAAGCCTGAGCCGG + Intergenic
1103568035 12:121826872-121826894 GCTGGACACCAGGCCTGAGATGG + Intronic
1104811135 12:131621073-131621095 GCTGGGACCCAGGCCTGCCCTGG + Intergenic
1104917987 12:132275943-132275965 GCTGGATCCCAGGCCTGAGAAGG + Intronic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1105029694 12:132874112-132874134 GCTAAAATCCAGGTCTGAACAGG - Intronic
1105345178 13:19564950-19564972 GCAGAAGCCCAGGCCTCGGCTGG + Intergenic
1105656863 13:22451327-22451349 GCTGCAACCCAGCCCTAAGGAGG + Intergenic
1106509637 13:30401777-30401799 GCCGAAACCCAGGCAAGAGAAGG + Intergenic
1110811164 13:79811870-79811892 GCTGAAACCAAGGTCAGAGCTGG + Intergenic
1112520989 13:100095007-100095029 TCTGAAATCAAGGCATGAGCAGG + Intronic
1113123786 13:106954098-106954120 GCTGAAATCAAGGCATGAGCAGG + Intergenic
1113600375 13:111564012-111564034 GCTGGCACCCAGGACTGTGCCGG + Intergenic
1113899942 13:113791151-113791173 GCTGCAACCCAGCCCTGGGCAGG - Intronic
1113928128 13:113952422-113952444 CTTGGAACCCAGCCCTGAGCAGG - Intergenic
1115777504 14:36731845-36731867 GCTGAAAGCCAGGGGAGAGCAGG - Intronic
1118835634 14:69475853-69475875 GGGGAAACCCAGTCCTGCGCAGG + Intergenic
1119705813 14:76781958-76781980 GCTGAAAGACAGTCCTGAACTGG - Exonic
1119892692 14:78194788-78194810 GCTGAAATGCTGGCCTGACCAGG - Intergenic
1120039681 14:79738475-79738497 GCTGAAACCAAGACATCAGCAGG - Intronic
1121173981 14:91876732-91876754 GCTGAAATCCAGGTGTCAGCAGG - Intronic
1121659547 14:95624527-95624549 GCTGAAACTTAGGCCAGACCAGG + Intergenic
1122297169 14:100712162-100712184 GGGGAAACCGAGGCCTGGGCGGG + Intergenic
1123027999 14:105437666-105437688 GCTGAATCCCAGGCCTGTGCGGG + Intronic
1124651456 15:31477126-31477148 GCAGTTACCCAGCCCTGAGCCGG + Exonic
1125510710 15:40291086-40291108 GCTGAAAGACAGGCTGGAGCTGG - Exonic
1125760660 15:42093699-42093721 CCTGAGACCCAGGCCCAAGCTGG - Intronic
1126009487 15:44288958-44288980 GCAGAAGCCCAGGCCTCGGCTGG - Exonic
1127329108 15:57921640-57921662 GCAGAAACCCAGGCATGGGTGGG - Intergenic
1127871633 15:63079028-63079050 GCTGGAGTCCAGGCCGGAGCAGG - Intergenic
1128999341 15:72319812-72319834 GCTGAAACCCAGGCGCGGGCCGG + Exonic
1129152563 15:73698120-73698142 GCTGCAGGTCAGGCCTGAGCTGG - Intronic
1129170950 15:73807479-73807501 GCAGAAACCCAGTCCCCAGCAGG - Intergenic
1129189218 15:73927688-73927710 GCGGAGACCCACGCCTGGGCTGG + Exonic
1129710771 15:77819341-77819363 GCGGGAACCGAGGCCGGAGCGGG - Intronic
1131232819 15:90671904-90671926 GCTCACACCCAGGCCTTAGCGGG - Intergenic
1132366880 15:101264292-101264314 CCTTAAAGCCAGGCCTGGGCTGG - Intergenic
1132669797 16:1097915-1097937 GCTGCAGGCCAGGCCTGAGTGGG + Intergenic
1132832668 16:1936698-1936720 GCTTGAACCCAGGCGTGAGACGG + Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133465500 16:6023187-6023209 GCTGAAACATGGGTCTGAGCGGG + Intronic
1135113880 16:19710101-19710123 TCTGAAAACCAGGCCTGAGAGGG + Intronic
1135812124 16:25597537-25597559 GCTGAACCCCATGCCTCAGTAGG - Intergenic
1138373147 16:56543250-56543272 GCTGGAACCCTGGCCTGCTCAGG + Intergenic
1140646535 16:77037812-77037834 AGTGAAACCCAGGGCTGTGCTGG - Intergenic
1142045675 16:87923622-87923644 GCTGACACCCAGCCCTCAGCTGG - Intronic
1142158672 16:88545960-88545982 GCTGAGGTCCAGGCGTGAGCAGG - Intergenic
1142375976 16:89707354-89707376 GCTGCACCCCAGGCCCCAGCCGG + Exonic
1143135660 17:4710934-4710956 GCAGAAAGCGAGGCCTGAGGGGG + Intronic
1143624937 17:8104272-8104294 GGTGAGCCCCAGTCCTGAGCTGG - Intronic
1144221575 17:13104674-13104696 GTTGAATCCCAGGTCTGGGCAGG - Intergenic
1144766059 17:17733153-17733175 GCAGGAACCCAGGTCTAAGCAGG - Intronic
1146054850 17:29575898-29575920 TCTGAAACCCAGGGCAGCGCTGG + Exonic
1146476320 17:33165371-33165393 GAGAAAACCAAGGCCTGAGCTGG + Intronic
1146815706 17:35940334-35940356 GCTGATTCCCAGGCTGGAGCAGG + Intronic
1148087247 17:45001607-45001629 GCTGAAAGCCTGACTTGAGCTGG + Intergenic
1148441170 17:47712288-47712310 GCAGTCACCCAGCCCTGAGCAGG + Intergenic
1150379991 17:64712900-64712922 GGTGGAACCCACGCCTGAGAAGG + Intergenic
1151332662 17:73420075-73420097 GCTGAGCCCCAGGCAGGAGCAGG + Intronic
1151457039 17:74232520-74232542 TCTGCCTCCCAGGCCTGAGCTGG - Intronic
1152310816 17:79548606-79548628 GGAGAAACTGAGGCCTGAGCTGG - Intergenic
1152633403 17:81420694-81420716 GCTGCAAACCCGGCCTGGGCCGG + Intronic
1152697965 17:81805731-81805753 GCTGACTCCAAGGCCTGAGAAGG + Intronic
1152849004 17:82620489-82620511 GCTGAGTCCCAGGAGTGAGCGGG + Intronic
1153812321 18:8762876-8762898 GCTGCTTCCCAAGCCTGAGCCGG - Intronic
1156004004 18:32418969-32418991 GCTGAAATCAAGGCGTCAGCTGG + Intronic
1156453416 18:37279399-37279421 GCTGAGCCCCTGACCTGAGCTGG - Intronic
1157302311 18:46487898-46487920 CCTGAAACCCAATCCTAAGCTGG - Intronic
1157506506 18:48230353-48230375 GCTGGAAGCAAGGCCTGAACAGG + Intronic
1160207780 18:76850323-76850345 GCTGAAAGTCAAGCCTGAGATGG - Intronic
1160307288 18:77751687-77751709 TCTGAAACCAAGGCCTCAGAAGG - Intergenic
1160730282 19:638962-638984 GGGGAAACCGAGGCCTGAGAGGG - Intergenic
1160745901 19:710474-710496 TCTGACAGCCAGGCCTGGGCAGG + Intronic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1160988577 19:1851521-1851543 GCAGAAAACCAGGCAGGAGCTGG + Intergenic
1160990522 19:1858529-1858551 GCTGTATACCAGGCCTGTGCTGG - Intronic
1161196215 19:2987974-2987996 GGTGAGACCCAGGCCCGAGCTGG + Exonic
1161300368 19:3539543-3539565 TCTGAAATCCAGGCCTGTGCGGG + Intronic
1161681356 19:5681250-5681272 GGGGAAACTGAGGCCTGAGCGGG + Exonic
1161932454 19:7349958-7349980 GCTGACAACCAGCCCTGAGAAGG + Intronic
1162554165 19:11375976-11375998 GCTTGAACCCTTGCCTGAGCTGG - Exonic
1162582840 19:11540884-11540906 GCTGAGAGCCAGGGCTGAGGTGG - Intronic
1162740830 19:12772702-12772724 GCTGAGACCCAGGGGTGAGGTGG + Intronic
1163382117 19:16976016-16976038 GCCGGAACCCAGACCTGAGCAGG + Exonic
1163580325 19:18134991-18135013 GCTCAAACCCAGGCCCGTGGAGG - Intronic
1163666925 19:18607583-18607605 GCCGGGACCCAGGCCTGCGCGGG + Intronic
1164044068 19:21519376-21519398 GCTGCAATCCAGGCCTGCTCAGG - Intronic
1164047582 19:21555755-21555777 CTTGAAACCCAGGGCTGTGCTGG + Intronic
1164585866 19:29475692-29475714 GCAGCAACCCAGGCCTCAGGAGG + Intergenic
1165326889 19:35119159-35119181 GGTGAAACTCGGGCCTGAGGCGG - Exonic
1165733612 19:38162270-38162292 GCTGAGAGCCTGGCCTGGGCAGG - Exonic
1166120086 19:40681134-40681156 GCTGAAATCCAGTCCTGAACAGG + Intronic
1167009600 19:46798351-46798373 GCTGAAACCAAAGCGTTAGCAGG + Intergenic
1167083243 19:47291456-47291478 GGTGAGACCCAGGGCTGTGCTGG + Intronic
1167508018 19:49881340-49881362 GCTCCAAGCCAGGCCTCAGCTGG + Exonic
1168359821 19:55730091-55730113 ACAGACACCCAGGCCTGAACAGG + Intronic
1168523663 19:57071798-57071820 GCAGAAAAACAGGCCTGTGCGGG + Intergenic
1168615337 19:57832999-57833021 GGTGAAACCCAGTGCTGTGCTGG - Intronic
1168621448 19:57882448-57882470 GGTGAAACCCAGTGCTGTGCTGG + Intronic
925195132 2:1916958-1916980 ACTAGAACCCAGGCCTGTGCAGG + Intronic
925422575 2:3724860-3724882 GCTGAGTCCCAGGGCAGAGCTGG + Intronic
926147279 2:10404458-10404480 GCAGAAAGCCTGGCCTGTGCTGG + Intronic
927658435 2:24971688-24971710 GCTGAGACCCGGGCCTGCTCGGG + Intronic
930026999 2:47034978-47035000 GCTGATAACCAGGCATTAGCTGG + Intronic
933362198 2:81302512-81302534 GCTGAAACCAAGGCATTGGCTGG + Intergenic
933686658 2:85147230-85147252 GCTGCAACCTTGGCCTGAGGTGG - Intronic
933722293 2:85405834-85405856 CCTGTGACTCAGGCCTGAGCTGG + Intronic
935223485 2:101034538-101034560 GCTACAGCCCAGGCCTCAGCGGG + Intronic
937440401 2:121910508-121910530 CCTTAATCCCAGGCCTGAGCAGG - Intergenic
939028261 2:137040006-137040028 TCTGAAAGCCTGGCCTGAGCAGG - Intronic
941363484 2:164581598-164581620 GCTGAAATCCAGATCTCAGCGGG - Intronic
942537866 2:176984539-176984561 GTTGAAACTCAGTCCTGAGGTGG + Intergenic
944390720 2:199216460-199216482 TCTGAAATCAAGGCCTCAGCAGG - Intergenic
944563713 2:200966395-200966417 GCTGGAATCCAGGCCTGAAAGGG + Intergenic
945940562 2:215945338-215945360 GCTGGAACCCAAGCCTCAGTAGG + Intronic
947907388 2:233775382-233775404 GCTCATAGCCAGGCCTGCGCTGG + Intergenic
948017093 2:234699709-234699731 TCTGCTACCCAGGCCTGAGCAGG - Intergenic
948098908 2:235358328-235358350 GCTCAAACCCGAGCCTGAGCAGG - Intergenic
948250982 2:236528790-236528812 ACTGAAACCCAGGCCCATGCAGG - Intergenic
948659026 2:239495397-239495419 GCGGGAACACAGGCCTGTGCAGG + Intergenic
948794365 2:240394671-240394693 TCTGAAACCCAGGTGTGGGCGGG + Intergenic
948980649 2:241492809-241492831 GGTAAAACCAAGGCCTCAGCTGG + Exonic
1169650303 20:7859339-7859361 GCTAAACCCCAGGCATGAGTTGG - Intergenic
1170609245 20:17898745-17898767 GCTGAAACCCAGTCCCTGGCTGG - Intergenic
1170981972 20:21222635-21222657 TCTGAAATCCAGGCGTCAGCAGG + Intronic
1171354843 20:24536171-24536193 GCTGTCATCCAGGCCTGAGCTGG + Intronic
1173027637 20:39324411-39324433 GCTGCAACCCAGGGCGGAGAGGG - Intergenic
1174862415 20:54103458-54103480 GCTGAAATCCAGGTGTGGGCTGG + Intergenic
1175564488 20:59962337-59962359 TCTGAAACCAAGGCGTCAGCAGG + Intronic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1176106395 20:63391579-63391601 GCTGTGACAGAGGCCTGAGCTGG + Intergenic
1176111024 20:63410780-63410802 AATGAAGCCCAGGCCTGAGCTGG - Intronic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1178492056 21:33058682-33058704 GCTGGAACCCAGCCCAGGGCAGG + Intergenic
1179629775 21:42669206-42669228 GCTGAAATCCAGGTGTGGGCAGG + Intronic
1179803073 21:43820717-43820739 GCTGAAACCAAGGTGTGGGCAGG - Intergenic
1180393077 22:12303034-12303056 TCTGAAGCCATGGCCTGAGCTGG - Intergenic
1180941071 22:19659687-19659709 GCTGACACACAGGCCTCAGGTGG + Intergenic
1180941187 22:19660142-19660164 GTTGACACCCAGGCCTCAGGTGG + Intergenic
1181021397 22:20105308-20105330 TCTGAAATCAAGGCCTCAGCAGG - Intronic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1181413762 22:22745146-22745168 GCTGTACCCCAGGCTAGAGCTGG - Intronic
1182413396 22:30205589-30205611 GCTGGAAGGCAGGGCTGAGCCGG + Intergenic
1182755267 22:32674023-32674045 GCTGAAACCCAGGCAAGAGATGG + Intronic
1183376099 22:37466341-37466363 GGTGGAGCCCAGGCCTGAGGAGG + Intergenic
1183828393 22:40405515-40405537 GCTGGAACCCAGGCCTTCCCTGG - Intronic
1184240007 22:43207025-43207047 GCTGCTGCCCAGGGCTGAGCTGG + Intronic
1185083752 22:48724739-48724761 GGTTAGACCCAGGCCTGAGAAGG - Intronic
1185373972 22:50473847-50473869 GCTGACTGCCTGGCCTGAGCCGG - Intronic
949778155 3:7655077-7655099 GGTCACAACCAGGCCTGAGCTGG - Intronic
950077765 3:10199378-10199400 GAGGAAACTGAGGCCTGAGCAGG - Intronic
950362888 3:12462343-12462365 GCTGGAGGCAAGGCCTGAGCAGG + Intergenic
950526626 3:13528299-13528321 TCTGAACCCCAGGTCTGGGCGGG + Intergenic
953008439 3:39000005-39000027 GCTGAGAGCCAAGCCTGAGGGGG - Intergenic
953376817 3:42435812-42435834 TCTGAAACCGAGGCCTGAGGAGG - Intergenic
953975099 3:47376470-47376492 GTAGAAACCCAGGCCTGGACTGG - Intergenic
954109108 3:48424422-48424444 GCTGCAGCCCAGGGCTCAGCTGG + Exonic
954693256 3:52407037-52407059 GGTGAAACCCCAGCCAGAGCCGG + Intronic
955885630 3:63595355-63595377 ACTGAAAGCCAGGCCTGCTCAGG - Intronic
956034813 3:65079462-65079484 GATGAAACACAGGGCAGAGCAGG - Intergenic
957721093 3:84000297-84000319 GATGAATCCCAGGGCTGCGCAGG + Intergenic
959448185 3:106466683-106466705 GGTGAAACCCAATCCTGTGCTGG - Intergenic
960367422 3:116789696-116789718 GCTGAAACACAGGACTGAGAAGG + Intronic
960404251 3:117239389-117239411 GGTGAAACCCAGTGCTGTGCTGG + Intergenic
961373304 3:126445784-126445806 GTTGTCCCCCAGGCCTGAGCAGG + Intronic
961879685 3:130052589-130052611 GCTGAAACAGAGGGCAGAGCAGG + Intergenic
962622232 3:137191387-137191409 GCTAAGCCTCAGGCCTGAGCTGG + Intergenic
962835587 3:139185738-139185760 GCTGAGACTGGGGCCTGAGCTGG - Intronic
963168945 3:142231924-142231946 GCTCAACCCCAGGCCTGTTCAGG - Intergenic
963543966 3:146631522-146631544 GCAGCAACCCAGGCCTGAGTAGG - Intergenic
965622737 3:170656884-170656906 CCTGAAACCCAGGCCTCCCCTGG - Intronic
965869374 3:173248302-173248324 GCAGAAACCAAGGCTTCAGCAGG + Intergenic
967036666 3:185653172-185653194 ACTCAAACCCTGGGCTGAGCAGG + Intronic
967301817 3:188021660-188021682 TCTGAAACCAAGGCGTCAGCAGG - Intergenic
968884744 4:3321751-3321773 TCTGAGGCCCAGGCCTGGGCAGG + Intronic
969281298 4:6172450-6172472 GAAGAAACCCAGGCCAGAGCTGG - Intronic
969304724 4:6319036-6319058 GCTGAAACCAAGGTGTGGGCAGG + Intergenic
969350736 4:6596644-6596666 GCTGAAACGCATGCCTGTCCTGG + Intronic
969573596 4:8024166-8024188 TCTGAACCCCTGGCCTGAGAAGG - Intronic
970473069 4:16395697-16395719 GCAGGAACCCAGGCCTGAGAGGG - Intergenic
971418028 4:26451458-26451480 GCTGAAATGCAGGCCTGACTTGG - Intergenic
972651768 4:41024774-41024796 GCTGCAGCCCAGGCCTGCTCAGG - Intronic
973861400 4:55068830-55068852 GCTGAAGGACAGGCCTGAACAGG + Intergenic
975504007 4:75117948-75117970 GCTGAGACCCAGTACTGTGCTGG + Intergenic
980828276 4:138098137-138098159 GGTGAATCCAAGGCCTGATCTGG - Intergenic
981880564 4:149606121-149606143 GGTGAAACCCAGTTCTGTGCTGG + Intergenic
983038863 4:162900765-162900787 CCTGAAACCCAAGGCTGAGATGG + Intergenic
985609801 5:881077-881099 GCATAAAGCCAGCCCTGAGCGGG + Intronic
985969026 5:3360779-3360801 GCTGAAGTCCAGGCATCAGCAGG - Intergenic
986048280 5:4062386-4062408 GCTGAAATCCAGTACTGACCAGG - Intergenic
986338047 5:6769423-6769445 GCTGCATCCCAGGGCTGAGGAGG + Intergenic
988020587 5:25615046-25615068 GTGGACACCCAGGCCTGAGGAGG + Intergenic
988538333 5:32088055-32088077 GCTGTCACCCAGGCCTGATAGGG - Exonic
988608524 5:32703472-32703494 GGTGAAACCCAGGGCTATGCTGG - Intronic
991953061 5:71965489-71965511 GCAGCAACCCTGGCCTGAGAAGG - Intergenic
992566027 5:77995968-77995990 GCTGACAGCAACGCCTGAGCTGG + Intergenic
992962687 5:81971927-81971949 GCTGAGACCCAGGCCGGGACTGG - Intergenic
995136346 5:108683920-108683942 GCTGAAATCAAGGCATCAGCAGG - Intergenic
995841017 5:116443330-116443352 GCTCAAACCCAGCCTGGAGCAGG - Intergenic
995950957 5:117713473-117713495 GCTGCAATCCAGGCCTGCTCAGG - Intergenic
996910929 5:128656078-128656100 GCTGAAACCCAGGGCTCTGGTGG + Intronic
999649662 5:153753112-153753134 GCTGAAGCCAAGGCATTAGCTGG - Intronic
999758031 5:154679799-154679821 GTCCAAACCCAGGCCTCAGCAGG - Intergenic
1000097991 5:157987675-157987697 GCTGCCACCCAAGCCAGAGCGGG - Intergenic
1000509517 5:162164589-162164611 GCTGAATCCAGGGCCTGGGCAGG + Intergenic
1001426067 5:171623559-171623581 CCTGAGAGCCAGGGCTGAGCGGG - Intergenic
1001677736 5:173532370-173532392 ATTGGAACCCAGGCCTGAGTTGG - Intergenic
1001888328 5:175316498-175316520 GCTGAAATCCAGACTTCAGCTGG - Intergenic
1001981789 5:176043333-176043355 GCTGACACCCAGGCCTCAGGTGG - Intergenic
1001981988 5:176044180-176044202 GCTCACACCCAGGCCACAGCTGG - Intergenic
1002019991 5:176357604-176357626 ACTGGAACACAGACCTGAGCCGG + Intronic
1002235677 5:177800727-177800749 GCTGACACCCAGGCCTCAGGTGG + Intergenic
1002334479 5:178468525-178468547 GCTCACACCCAGGCCTCACCCGG + Intronic
1002523622 5:179804359-179804381 GCTGAAGTCCAGGCCTGGGGAGG + Intronic
1003626697 6:7747607-7747629 GCTGAAAACCAGGTGTCAGCAGG - Intronic
1003897298 6:10619788-10619810 GCTGAAATCCAGGCATTGGCTGG + Intronic
1004741080 6:18461842-18461864 TCTAAAATCCAGGCCTGAGACGG + Intronic
1005015149 6:21368284-21368306 GCTCAAAGCCAGGGCTGAGAGGG + Intergenic
1005809141 6:29502965-29502987 TCTGAAATCCAGGTCTGGGCAGG + Intergenic
1005828614 6:29652309-29652331 GCTGAAAACCAGTCCTGGGGAGG - Intergenic
1006902551 6:37512517-37512539 GGCTAAAGCCAGGCCTGAGCAGG - Intergenic
1007377928 6:41469127-41469149 GAAGAAACCTAGGCCTGCGCAGG + Intergenic
1008660637 6:53664329-53664351 CCTGATACCCAGCCCTGATCAGG - Intronic
1010469970 6:76216315-76216337 GCTGAAACCCAGGTGTCTGCTGG + Intergenic
1011043816 6:83059918-83059940 TCTGAAACCCCATCCTGAGCTGG - Intronic
1011063151 6:83294512-83294534 GCTGCAATGCTGGCCTGAGCAGG - Intronic
1011504970 6:88031435-88031457 GCTGCAGCCCAGGCCTGCTCAGG - Intergenic
1013369298 6:109455757-109455779 GCTGGCAACCAGGTCTGAGCGGG + Exonic
1013532190 6:111030178-111030200 GCTGGAACCCAGGGCTGCACAGG + Intergenic
1015896338 6:138020563-138020585 GCTGAAATCAAGGTCTGGGCAGG + Intergenic
1015912525 6:138183187-138183209 GAGGACACCCAGGACTGAGCAGG + Intronic
1016702561 6:147069941-147069963 GGTGAAAACCTGGCCTCAGCTGG - Intergenic
1017205247 6:151798072-151798094 GCCGAAAGCGAGGCCTGAGAAGG + Intronic
1017815218 6:158011295-158011317 GCTGAAATCCAGGCATCAGCAGG - Intronic
1018176579 6:161183225-161183247 GCTGACACCCAGGGCTGCACAGG + Intronic
1018435076 6:163752075-163752097 AAGGAAACGCAGGCCTGAGCTGG - Intergenic
1018688101 6:166319088-166319110 GCTGAAATCCAGGAGTGGGCTGG - Intergenic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1018750267 6:166798290-166798312 GCTGTAACTCATCCCTGAGCTGG - Intronic
1019487597 7:1296468-1296490 GCTGTGGGCCAGGCCTGAGCTGG + Intergenic
1019645465 7:2126482-2126504 GCTGCCCCCCAGGCCTGAGGGGG - Intronic
1019761576 7:2816655-2816677 GAGGAAACCCTGGCATGAGCTGG - Intronic
1020319434 7:6929196-6929218 GCTGAATCCCATCCATGAGCCGG - Intergenic
1020519887 7:9172799-9172821 GGTGAGACCCAGGGCTGTGCTGG - Intergenic
1020560928 7:9728076-9728098 GCCGGAACCCAGACCTGAGCAGG - Intergenic
1021087903 7:16445386-16445408 ACAAAAACCCAGGGCTGAGCAGG + Intergenic
1023224055 7:37950652-37950674 GCAGAAAACCAGCCCTGAACAGG - Exonic
1024082639 7:45867717-45867739 GCTGCAAGCCAGTCCTGAGCAGG - Intergenic
1025800166 7:64779713-64779735 GGTGAAACCCAGTGCTGTGCTGG - Intergenic
1027247006 7:76374214-76374236 GCTGAAGCCCAGGTTTGAGAAGG + Intergenic
1028033501 7:85949581-85949603 GGTGAAACCCAGTACTGTGCTGG - Intergenic
1029028180 7:97440129-97440151 GCTGCAATCCAGGCCTGCTCAGG + Intergenic
1030719646 7:112855421-112855443 GCTGAAACCAAGGTGTCAGCTGG + Intronic
1034282241 7:149862429-149862451 GCTGAAACGCCGGCCTGAGGAGG - Exonic
1034327274 7:150248083-150248105 GCTGAAACCCTGGCAGGGGCAGG - Intronic
1034765935 7:153721374-153721396 GCTGAAACCCTGGCAGGGGCAGG + Intergenic
1034858629 7:154577321-154577343 CCTGAGAGCCAGGCCTGTGCAGG + Intronic
1039733772 8:40307747-40307769 GTAGAAACCATGGCCTGAGCTGG + Intergenic
1041786533 8:61640100-61640122 GCTGAAAACCTGCCCTGATCTGG - Intronic
1042216701 8:66435322-66435344 GCTGAAGCCAAGGTGTGAGCAGG + Intronic
1045473047 8:102529338-102529360 GCTGAATCCCACCTCTGAGCTGG + Exonic
1045995008 8:108352248-108352270 GGTGAGACCCAGGGCTGTGCTGG + Intronic
1046778926 8:118194557-118194579 GCTGACACCCAGACTTGTGCAGG - Intronic
1047539057 8:125746403-125746425 CCTGAAACCCAGATCTGAGAAGG - Intergenic
1048357688 8:133667030-133667052 GCTGGAACACAGGGCTGTGCTGG - Intergenic
1048357951 8:133668839-133668861 GCTGACACTCTGGGCTGAGCTGG + Intergenic
1048426674 8:134329719-134329741 GCTGAAATCCAGGTGTTAGCAGG - Intergenic
1048883478 8:138889189-138889211 GCTGAAACCTAGGCCTCTTCTGG + Intronic
1049000770 8:139824449-139824471 GAGGAAACCCACGTCTGAGCAGG + Intronic
1052715607 9:32112668-32112690 ACTGCAACCCTGGCCTGAGAAGG + Intergenic
1053057153 9:35000092-35000114 GCTAATCCCCTGGCCTGAGCAGG + Intergenic
1053122347 9:35556462-35556484 GCAGAGTCCCTGGCCTGAGCTGG - Intronic
1053167240 9:35853443-35853465 CCTGGAACCCAAGCCAGAGCTGG - Intronic
1053413786 9:37933331-37933353 GGGGAAACCAAGGCCTGAGAAGG - Intronic
1055228513 9:74031117-74031139 GCTAAAACCAAGGTCTCAGCAGG + Intergenic
1060050913 9:120377539-120377561 TCTGAAACCCAGGTGTCAGCAGG + Intergenic
1060475407 9:123983073-123983095 GCAGAGACCAAGGCCTGAGTGGG - Intergenic
1060785785 9:126450841-126450863 CCCAAAACCCAGCCCTGAGCAGG - Intronic
1060881076 9:127118516-127118538 ATTGAAACCCAGACCTGTGCTGG - Intronic
1061138710 9:128751557-128751579 CTTGGGACCCAGGCCTGAGCTGG + Intronic
1061328741 9:129879469-129879491 GCTGACCCCCAGGCCTGGGGCGG + Intronic
1061452079 9:130673164-130673186 GCTGAGACTCAGGCCTGGCCTGG - Intronic
1062448786 9:136606918-136606940 GCTGACTCCCAGGGCGGAGCCGG - Intergenic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1186551476 X:10510540-10510562 GCTGAAACCCAGGCCGGGCGTGG + Intronic
1187023940 X:15413244-15413266 GCTGTGACCCAGGCCAGAGAAGG + Intronic
1188715719 X:33457031-33457053 GGTGAGACCCAGGGCTGTGCTGG + Intergenic
1189265991 X:39716436-39716458 TCTGCAATCCAGGCCTGGGCAGG - Intergenic
1190708848 X:53050954-53050976 GCTGCAAGCCAGGCCTCTGCTGG - Intronic
1191857606 X:65639808-65639830 GCTGAAGGCTAGGCCTGATCTGG + Intronic
1192239385 X:69317373-69317395 ACTTAACCCCAGGCCTGAACTGG + Intergenic
1192362863 X:70450160-70450182 GCTGAAACCCAGGCCTGAGCGGG - Exonic
1192822314 X:74658087-74658109 GGTGAAACCCAGTGCTGTGCTGG - Intergenic
1193047382 X:77067339-77067361 GATGAAACTGAGACCTGAGCTGG - Intergenic
1193772116 X:85599980-85600002 GCTGAAATCAAGGTCTTAGCAGG - Intergenic
1194274719 X:91865461-91865483 GGTGAGACCCAGTGCTGAGCTGG - Intronic
1194340572 X:92700393-92700415 GCTAAAACCCAGTGCTGTGCTGG - Intergenic
1195559329 X:106265755-106265777 GGTGAAACCCAGCACTGTGCTGG - Intergenic
1195979933 X:110566959-110566981 GCTGCAATCAAGGCCTCAGCTGG + Intergenic
1196877632 X:120169620-120169642 GGTGAGACCCAGTCCTGTGCTGG - Intergenic
1197139225 X:123097373-123097395 GGTGAAACCCAGTTCTGTGCTGG + Intergenic
1198593656 X:138212214-138212236 GCTGCAACAAAGGCCTTAGCTGG - Intergenic
1198612938 X:138422065-138422087 GGTAAAACCCAGACCTTAGCTGG + Intergenic
1199009180 X:142739027-142739049 GCAGCAATCCAGGCCTGAACAGG - Intergenic
1200591962 Y:5086862-5086884 GGTGAGACCCAGTGCTGAGCTGG - Intronic
1200648926 Y:5817131-5817153 GCTAAAACCCAGTGCTGTGCTGG - Intergenic