ID: 1192363556

View in Genome Browser
Species Human (GRCh38)
Location X:70453762-70453784
Sequence GGGAGCTGCGCAGGGGAGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 415}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192363545_1192363556 13 Left 1192363545 X:70453726-70453748 CCTTCATCCTGGCAGGAGGCCCA 0: 1
1: 0
2: 1
3: 36
4: 283
Right 1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG 0: 1
1: 0
2: 0
3: 41
4: 415
1192363546_1192363556 6 Left 1192363546 X:70453733-70453755 CCTGGCAGGAGGCCCAGCTGACC 0: 1
1: 9
2: 6
3: 37
4: 380
Right 1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG 0: 1
1: 0
2: 0
3: 41
4: 415
1192363551_1192363556 -7 Left 1192363551 X:70453746-70453768 CCAGCTGACCTGAGTGGGGAGCT 0: 1
1: 0
2: 5
3: 22
4: 231
Right 1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG 0: 1
1: 0
2: 0
3: 41
4: 415
1192363550_1192363556 -6 Left 1192363550 X:70453745-70453767 CCCAGCTGACCTGAGTGGGGAGC 0: 1
1: 0
2: 5
3: 26
4: 166
Right 1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG 0: 1
1: 0
2: 0
3: 41
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192363556 Original CRISPR GGGAGCTGCGCAGGGGAGAC CGG Exonic
900113522 1:1019551-1019573 GGGAGCTGCGGCGCGGAGGCGGG - Intergenic
900298967 1:1967284-1967306 GGGAACTGGGCCGGGTAGACAGG + Intronic
900314650 1:2050721-2050743 GGGAGCGGCGCGGGTGAGGCAGG + Intronic
900327644 1:2116955-2116977 GGGAGTTGCGGGGGGCAGACAGG + Intronic
900525419 1:3126178-3126200 GGGAGCTGGGCCGGGAAGAGCGG - Intronic
900757090 1:4443522-4443544 GTGAGGTGCGCAGGTGAGATGGG - Intergenic
900951053 1:5858491-5858513 GGCAGCGGGGCAGGGGAGGCTGG - Intergenic
901014266 1:6218937-6218959 GGCGGCTGTGCAGGGGAGGCTGG - Intronic
901192715 1:7422129-7422151 GGGAGCTGGACAGGGCAGATTGG + Intronic
901627418 1:10631926-10631948 GGGAGCTGCGGTGGGCAGACAGG + Intergenic
901821744 1:11834765-11834787 GGGGGCAGGGCAGGGGACACGGG + Intronic
902209435 1:14894145-14894167 CAGAGCTGGGCAGGGGAGATGGG - Intronic
902480254 1:16707854-16707876 GGGCGGTGCGGAGGGGAGACGGG - Intergenic
902566816 1:17316783-17316805 GGGCGCGGGGCAGGGGAGACGGG - Intronic
902580385 1:17404191-17404213 GGGAGGAGGGAAGGGGAGACAGG - Intergenic
902874130 1:19330855-19330877 GGGGACAGGGCAGGGGAGACTGG - Intergenic
903015151 1:20356732-20356754 TGGGGCTGGGCAGGGGAGCCAGG - Intergenic
903121139 1:21217763-21217785 GGTAGCTCTGCAGAGGAGACAGG - Intronic
903468581 1:23568984-23569006 GGGCGCTGGGCAGGGAAGTCTGG + Intergenic
903646894 1:24901491-24901513 GGAAGCTGGGCTGGGGGGACTGG + Exonic
903706496 1:25289636-25289658 GCAAGCTGCTCAGGGGAGACTGG + Intronic
903720743 1:25403722-25403744 GCAAGCTGCTCAGGGGAGACTGG - Intronic
904287255 1:29460626-29460648 TGGAGGTGGGCAGTGGAGACAGG - Intergenic
904298653 1:29540227-29540249 GGTAGCTGGGTAGGGGAGGCAGG + Intergenic
904417776 1:30373624-30373646 TGGAGGTGGGCAGTGGAGACGGG + Intergenic
904807350 1:33141249-33141271 GGGAGGTGCTCAGAGGAGAAGGG - Intergenic
905449367 1:38046894-38046916 GGGGGCCGGGCAGGGGAGGCGGG - Intergenic
905959981 1:42035594-42035616 CGGAGCTGCGGAGGCCAGACGGG + Intronic
906543292 1:46604372-46604394 GCGAACTGCGCAGGCGTGACAGG + Intronic
906649503 1:47502841-47502863 GGGAGCAGCAAAGGGGAGGCTGG + Intergenic
907855759 1:58301990-58302012 GGGAGCTAAGCAGGGAAGTCTGG + Intronic
908487291 1:64607217-64607239 GGGAGCTGAGAAGGGCAGTCAGG + Intronic
909878884 1:80847891-80847913 GGGACCAGCACAGGAGAGACAGG + Intergenic
912437145 1:109669593-109669615 GGGAGTAGGGAAGGGGAGACTGG - Intronic
915287978 1:154864941-154864963 GGGATCTTCTCAGGGGAGGCTGG - Intronic
916107964 1:161444321-161444343 GGGACCCGCGCCGGCGAGACTGG - Intergenic
916109549 1:161451703-161451725 GGGACCCGCGCCGGCGAGACTGG - Intergenic
916111132 1:161459108-161459130 GGGACCCGCGCCGGCGAGACTGG - Intergenic
916112722 1:161466494-161466516 GGGACCCGCGCCGGCGAGACTGG - Intergenic
916390068 1:164321506-164321528 GAGAGCTGCGCAGGGCGGTCTGG + Intergenic
917041233 1:170808438-170808460 GGGAGCTGCACAGGGTAGGCAGG + Intergenic
917853241 1:179082577-179082599 GGGGGGTGCGCAGGGGACGCGGG - Intronic
918181613 1:182089461-182089483 GTGGGCTGCTCAGGGGAGGCTGG - Intergenic
918282889 1:183023322-183023344 GGGAGTTGCTGAGAGGAGACAGG + Intergenic
918332558 1:183473111-183473133 GGGAACCGCGGAGGGCAGACAGG + Intronic
919806638 1:201384556-201384578 GAGAGCTGCTCAGAGGAGGCAGG - Intronic
919893618 1:201994150-201994172 AGGAGCTGGGCAGAGGAGTCAGG - Intronic
920252870 1:204633742-204633764 GAGAGCTGGGCAGCGGGGACTGG - Intronic
920455276 1:206096492-206096514 GGCAGCTGCACAAGGAAGACTGG - Intronic
920497882 1:206468365-206468387 GGGAGTTGGGCAGAGGAGAGGGG - Intergenic
920679356 1:208060632-208060654 GGGAGCTTCAGAGTGGAGACTGG - Intronic
920692643 1:208158735-208158757 GGAAGCTGCGCTGGGAAAACAGG + Intronic
922230812 1:223684114-223684136 GGGAGATGTGGAGGGGAGAGTGG - Intergenic
922603206 1:226872181-226872203 AGCAGCTACGGAGGGGAGACAGG - Intronic
923714525 1:236413513-236413535 GGGAGCTGAGCAGGGGTTAGGGG + Intronic
1063631579 10:7739174-7739196 GGGAGCTGCCCCGGGGAAATGGG + Intronic
1063918813 10:10911584-10911606 GGGATTTGTGCATGGGAGACCGG + Intergenic
1063981034 10:11451924-11451946 GGGAGCTGCGTTGGGGAGAAAGG - Intergenic
1067467505 10:46511784-46511806 GGCAGCTGGGAAGGGGAGAGAGG - Intergenic
1067544326 10:47181883-47181905 GGGAGCGAGGAAGGGGAGACAGG - Intergenic
1067619681 10:47872821-47872843 GGCAGCTGGGAAGGGGAGAGAGG + Intergenic
1068855989 10:61797961-61797983 GGGGCCTGCGCAGGGGAGGATGG - Intergenic
1070745206 10:78929595-78929617 GGGATCTGGGCAGGCAAGACTGG + Intergenic
1070747452 10:78942934-78942956 GGGATCTGGGCAGGAGAGAGAGG + Intergenic
1070751890 10:78968707-78968729 GGGAGCTGGCCAGGGGAGGCAGG + Intergenic
1070914504 10:80144390-80144412 TGGCGCTGGGCAGGCGAGACAGG + Intronic
1070956849 10:80469517-80469539 GGTAGCTGAGCAGGAGAGTCAGG - Intronic
1071136767 10:82462593-82462615 GGGAGCTGAGAAGAGGAGATGGG + Intronic
1071572789 10:86707177-86707199 TGGAGCTGGGCAGGGAAGGCAGG + Intronic
1071617993 10:87094271-87094293 GGGAGGGCCGCAGGGGAGGCAGG + Intronic
1071771055 10:88728979-88729001 GGCAGCTGTGCAGGGGAGCATGG + Intronic
1072630292 10:97140718-97140740 GGGGGCAGCCCAGGGGAGAACGG + Intronic
1072693254 10:97585045-97585067 GGGAGAGGAACAGGGGAGACTGG + Intronic
1072790642 10:98315300-98315322 GGGGGCTGGCCAGGGGAGAGGGG + Intergenic
1074051624 10:109886051-109886073 GGGAGCTGGGGAGGGGAGTGAGG - Intronic
1074801474 10:117005114-117005136 GGGAGCGGCGCGGGGCACACAGG + Exonic
1074869342 10:117564750-117564772 GTGAGGTCCACAGGGGAGACAGG + Intergenic
1076667643 10:132102242-132102264 TGGAGCTGGAAAGGGGAGACAGG + Intergenic
1076738043 10:132467494-132467516 GTGAGCTGAGCAGGGGAGGAGGG + Intergenic
1076743909 10:132503205-132503227 GGGTGCGGCGCAGTGGAGCCAGG - Intergenic
1076798141 10:132808678-132808700 GGGAGCTGGGGATGGGAGCCGGG + Exonic
1076854848 10:133111080-133111102 GGGAGCTGCCCATGGCAGGCAGG - Intronic
1077143394 11:1034657-1034679 GGGCATTGCCCAGGGGAGACCGG - Intronic
1077194738 11:1273674-1273696 GGGATTTGGGCAGGGGAGGCGGG + Intergenic
1077395030 11:2316441-2316463 GGGAGCTGCTCTGGTGTGACAGG + Intronic
1077475517 11:2788510-2788532 GGGAGCTGCCGAGGAGAGGCAGG - Intronic
1078011556 11:7576541-7576563 GGGAGCAGTGCTGGGTAGACAGG - Intronic
1079129498 11:17738982-17739004 GGGAGCTGAGGAGGGCAGAGCGG + Intronic
1080784978 11:35466979-35467001 GGGAACTGCTCAGGGGCTACTGG + Intronic
1081567831 11:44270688-44270710 TGGGGCTGCACAGTGGAGACAGG - Intronic
1081872967 11:46391618-46391640 GGGAGCTGGGCAGAGGCGGCGGG - Intergenic
1082683251 11:56205732-56205754 GGGAGCTGAGCAGGTGACAGAGG + Intergenic
1083285453 11:61655977-61655999 TGGAGTTGGGCAGGGGAGAAGGG - Intergenic
1083770462 11:64864187-64864209 GGTAGCAGTGCAGGGGAGCCGGG + Intronic
1083835004 11:65260911-65260933 GGGAGCTCGGCTGGTGAGACAGG + Intergenic
1083912587 11:65718958-65718980 GGGAGGCAGGCAGGGGAGACAGG + Exonic
1084321853 11:68377667-68377689 GGGATCTGCGCAGTGGACAGTGG + Intronic
1084392953 11:68890612-68890634 GGGAGCTACCCAGGTGAGAAGGG - Intergenic
1084410813 11:69005064-69005086 GGGAGCCGGGCAGGGGCCACAGG + Exonic
1084557956 11:69886027-69886049 GAGAGCTTCCCAGAGGAGACAGG - Intergenic
1085529563 11:77183398-77183420 GGGCACTGAGCAGGGGAGGCCGG + Intronic
1087324956 11:96710447-96710469 GTGAGCTCAGCAGAGGAGACAGG - Intergenic
1087548435 11:99614598-99614620 GGGAGATGCACAGTGGATACTGG - Intronic
1089129310 11:116199562-116199584 GGGGGCTGCAAAGGGGAGAGGGG + Intergenic
1089217136 11:116841212-116841234 GGTGACTGAGCAGGGGAGACAGG + Intergenic
1089296226 11:117469976-117469998 GGGAGCTGAGCAGGGTAGCGGGG + Exonic
1089300764 11:117497431-117497453 GGGGGCTGCGGCGGGGAGCCTGG + Intronic
1089383435 11:118052349-118052371 GGGAGCTGCTGAGGGCAGGCTGG + Intergenic
1089657751 11:119963988-119964010 TGGAGCTTCCCAGGAGAGACAGG - Intergenic
1089983495 11:122791730-122791752 GGGAGTTGCCCAGGGGATCCAGG + Intronic
1090041485 11:123296065-123296087 AGAAGATGAGCAGGGGAGACAGG + Intergenic
1090416846 11:126546387-126546409 GGGAGCTGTCCAGGGTGGACTGG - Intronic
1090863511 11:130675001-130675023 GGGAGCTACAGAGGGGAGAAAGG + Intronic
1092810409 12:12266985-12267007 AGGAGCTGCGCGGGGGAAGCGGG - Intronic
1094123956 12:27002996-27003018 GAGAGCTGAGCTGGGGAGAAGGG - Intronic
1094834094 12:34314161-34314183 GGGACCCGCGCAGGGGATGCTGG + Intergenic
1094836325 12:34323823-34323845 GGGGCCTGCGCAGGGGATGCTGG + Intergenic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096292001 12:50351355-50351377 GGGAGCTGCCCAGGGGAGGGAGG + Exonic
1096654455 12:53079651-53079673 TTGAGCGGCGCCGGGGAGACGGG + Intergenic
1100786809 12:98087468-98087490 GGGAGCAGCGTAGGGGAGGATGG - Intergenic
1103972228 12:124679422-124679444 GGAGGCTGCACAGGGGAGACAGG + Intergenic
1104291611 12:127474394-127474416 GAGAGCTCCCCATGGGAGACAGG - Intergenic
1104674167 12:130701499-130701521 GAGAGCAGCCCAGGGGAGCCGGG + Intronic
1105415413 13:20207609-20207631 GGGAGATGCGCAGGGCAGGCAGG + Intergenic
1105829346 13:24150189-24150211 GGGAGGAGAGCACGGGAGACGGG - Intronic
1107726626 13:43305961-43305983 GGGAGCTGCGCAGGCCAGGCTGG - Intronic
1108433378 13:50377228-50377250 AGGAGCTGTGGATGGGAGACAGG + Intronic
1111942494 13:94625506-94625528 GGGAGCTGGGCAGGTAAGAATGG - Intronic
1113483588 13:110638949-110638971 GGGAGCTGGGCAGGGGTCCCCGG + Exonic
1113500543 13:110770447-110770469 GGGAGCTGCTCAGGGGTAAGGGG + Intergenic
1113731398 13:112644295-112644317 GGGAGCAGGGCAGGGAAGCCGGG - Intergenic
1113962196 13:114132352-114132374 AGGATCTGCGGAGGGGAGGCGGG + Intronic
1114527245 14:23374249-23374271 GGGAGCTTCTTAGGGGAGGCGGG + Intronic
1114627253 14:24137636-24137658 GTGAGGGGCGAAGGGGAGACTGG - Intronic
1114675156 14:24435435-24435457 TGGGGCAGGGCAGGGGAGACTGG + Intronic
1115203167 14:30874806-30874828 GGGCGCGGCGCAGAGGAGAGAGG - Intronic
1121018933 14:90567089-90567111 TGGATCTGTGCAGGGGAGAGAGG + Intronic
1122064206 14:99160252-99160274 GGCAGCTGGGCAGGGGTGGCTGG - Intergenic
1122075355 14:99231738-99231760 GGGAGGTGGGCAGGGGGCACTGG + Intronic
1122718526 14:103709163-103709185 GCCAGCTGCGCAGGGCAGTCAGG + Intronic
1122987805 14:105220638-105220660 TGGGGCTGGGCAGGGGTGACAGG - Intronic
1122994773 14:105257078-105257100 GGGGGCTGCGCTCGAGAGACAGG + Intronic
1123002228 14:105301521-105301543 GGCAGCTGCGCTGGGGGGCCTGG + Exonic
1123046301 14:105518055-105518077 GGGTGCTGAGCAGAGGAGATGGG - Intergenic
1124121637 15:26893672-26893694 TGGAGTGGCGCAGGGGAAACAGG + Intronic
1126455982 15:48862586-48862608 TGGAGATGAGCAGAGGAGACTGG - Intronic
1126879137 15:53075875-53075897 GGCAGCTGCACAGGGAAGCCAGG + Intergenic
1127801731 15:62483043-62483065 GGGAACTGGGCAAGGAAGACAGG - Intronic
1128705947 15:69837567-69837589 TGGAGCTGTGCAGGGGGGACTGG + Intergenic
1129288132 15:74541690-74541712 GGGAGGCGTGCAGGGGTGACCGG + Intronic
1129389619 15:75214030-75214052 AGGAGCTGGGAAGGGGAGAGGGG + Intergenic
1129604604 15:77018736-77018758 AGGGTCTGGGCAGGGGAGACAGG + Intronic
1131278647 15:91003346-91003368 GGGTGCTGAGGAGGGGACACTGG + Intronic
1132244273 15:100281802-100281824 GGAAGCTGGGCAGAGGGGACAGG + Intronic
1132695808 16:1201335-1201357 GGGTGCTGGGGAGGGGAGAGTGG + Intronic
1132865128 16:2089520-2089542 GGGAGCTGGGGAGGGGACCCTGG + Exonic
1133272361 16:4616438-4616460 GGGCGCTGGGCCGGGGAGGCCGG + Intergenic
1135536966 16:23302190-23302212 GGGAGGTGGCCAGGGGAGCCGGG + Intronic
1136069637 16:27780032-27780054 GGGAGCTGAGCAGAGGTGCCGGG - Exonic
1136508396 16:30721066-30721088 AGGAGCTGGGCTGGGGACACGGG + Intronic
1136551362 16:30984201-30984223 GGGTGGTGGGCAGGGGTGACAGG - Exonic
1136577547 16:31133384-31133406 GGGAGCTGCCCAGGGAGGAAGGG + Exonic
1138179140 16:54930647-54930669 GGGGGCCGCGGAGGGGAGGCGGG + Intergenic
1139390500 16:66604485-66604507 GGGAGCTCCGAAGGGGTGCCGGG + Intronic
1139446217 16:67000342-67000364 GGGAGGTGCCCAGGGCAGGCAGG + Intronic
1139655318 16:68383854-68383876 GTGAGCTGGGAAGAGGAGACAGG - Intronic
1141079619 16:81038538-81038560 AGGAGCTGCTCAGGGGCCACTGG - Intronic
1141639776 16:85334375-85334397 GGGAGCTGCGCTGGGGTTGCTGG + Intergenic
1142149576 16:88506697-88506719 GGGAGAGGCGCAGAGGAGCCTGG - Intronic
1142492695 17:289046-289068 GGGACCTGCCCACGGGACACAGG + Intronic
1142509721 17:385955-385977 GGGCGCTGCTCGGGGGAGTCGGG + Intronic
1146642349 17:34550790-34550812 GGGAGCTGCCCTGGGGAATCTGG - Intergenic
1147139914 17:38454986-38455008 GGGAGTTGCTCAGGGGACACAGG - Intronic
1147313250 17:39607044-39607066 GGGAGCTGGGCCGGGGGGCCCGG - Intronic
1147325570 17:39667977-39667999 GGGCGCTGCGAGGGGGAAACTGG + Intronic
1147465652 17:40608728-40608750 GGAAGCTTAGCAGGGGAGAAGGG + Intergenic
1148632209 17:49119920-49119942 GGGAGAGATGCAGGGGAGACAGG - Intergenic
1148698808 17:49576288-49576310 GGGAGCTGCGCAGAGGGGCGGGG + Intronic
1148768463 17:50053253-50053275 TGGAGCAGAGCAGGGGCGACTGG - Intergenic
1148907366 17:50919872-50919894 GGAAACTGCGCTGGGGAGGCTGG - Intergenic
1151911490 17:77086409-77086431 GGGAGCTGGGCTGGGCAGAATGG + Intergenic
1152091761 17:78251204-78251226 GGGACCTGCGGAGGGGAGAAAGG - Intergenic
1152299514 17:79486832-79486854 GAGAGCTGCGAAGAGGAAACTGG - Intronic
1152422910 17:80203740-80203762 GAGAGCCGAGCAGGGGAGAGTGG - Intronic
1152778364 17:82215722-82215744 GGGAGCTGGGCAGGGAAGGAGGG - Intergenic
1152828333 17:82481407-82481429 GGAAGATGCACAGAGGAGACAGG - Intronic
1152844484 17:82591392-82591414 TGGAGCAGAGCAGGGGACACAGG - Intronic
1153319679 18:3760263-3760285 GGGAACTGCGGAAGGAAGACAGG + Intronic
1155579785 18:27290272-27290294 GGGGGGTGCCCAGGGGAGGCTGG + Intergenic
1156331601 18:36129054-36129076 GGGAGCTCCTCAGGCCAGACAGG - Intronic
1156445120 18:37230950-37230972 GTGAGCTGCAGAGGGGAGAAGGG - Intronic
1157072458 18:44423946-44423968 GGGAGTTGGAGAGGGGAGACTGG - Intergenic
1157861058 18:51140437-51140459 GCTAGCTGTGCAGGGGAGAACGG - Intergenic
1158395901 18:57078185-57078207 GTGGGCTGGGCAGGGGAGACTGG + Intergenic
1158543487 18:58377066-58377088 GGAAGCTGAGCAGGAGAGACAGG - Intronic
1160672809 19:374204-374226 GGGAGCCGAGCAGTGGGGACAGG + Intronic
1160807009 19:996331-996353 GGGAGCTGGGCGGGGGCGGCAGG + Intronic
1161210205 19:3062016-3062038 GGGAGCTGGAGAGGGAAGACAGG + Intronic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1161401266 19:4067048-4067070 GCCCGCTGCGCCGGGGAGACCGG + Intergenic
1161565779 19:5001416-5001438 CGCAGCTGTGCAGGGGAGCCAGG - Intronic
1162067002 19:8131877-8131899 GGGAGATGGGGAGGGGAGAGAGG - Intronic
1163124703 19:15238671-15238693 GGGAGCTGGGAAAGGGGGACTGG - Intronic
1163368055 19:16887393-16887415 GGAAGCTGTGCAGGGGAGGCTGG - Intergenic
1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG + Intronic
1164834990 19:31350498-31350520 GGGGGATGGGCAGGGGAGCCCGG - Intergenic
1165095941 19:33410016-33410038 GGTGGCTACGCAGGGGGGACTGG + Intronic
1165306489 19:35005808-35005830 GGGAGCTGCCCAGGGGACTGTGG + Intronic
1165395999 19:35563799-35563821 GGGATCTGGGCAGGGGAGGGGGG - Intergenic
1166074444 19:40405503-40405525 GGGGGCTGAGCAGGGCAGTCTGG + Intronic
1166224521 19:41386721-41386743 TGGAGCTGCGGGGGAGAGACTGG + Exonic
1166253377 19:41586136-41586158 GGAATCTGGGCAGGGGAGAGAGG - Intronic
1166257999 19:41619707-41619729 GGGGCCTGGGCAGGGGAGAGAGG + Exonic
1166267632 19:41695021-41695043 GGGGCCTGGGCAGGGGAGAAAGG + Intronic
1166410652 19:42553871-42553893 GGGGCCTGGGCAGGGGAGAGAGG + Intronic
1167098845 19:47391663-47391685 GGGAGCCGCGGAAGGGAGGCCGG - Intergenic
1167147929 19:47694097-47694119 GGGATCTGGGCAGGGGAGGGAGG - Exonic
1167527652 19:49994947-49994969 GGGAGATGAACAGGGGAGAGAGG + Intronic
1168109433 19:54183736-54183758 GGCAGCCGCGCAAGGGAGATGGG - Intronic
1168137812 19:54363193-54363215 GGGAGCCACGGAGGGGAGAGGGG + Intronic
1168160210 19:54505440-54505462 GGGAGCCACGGAGGGGAGAAGGG - Intronic
1168416411 19:56171999-56172021 GGGAGCTGGGCCTGGGAGCCTGG - Intergenic
1168645726 19:58057892-58057914 GGGAGCTGGGCAGGGCCGCCTGG + Intergenic
1202714293 1_KI270714v1_random:33764-33786 GGGCGGTGCGGAGGGGAGACGGG - Intergenic
924998764 2:386988-387010 GGGAGCAGGGCAGAGGCGACAGG - Intergenic
925033439 2:669526-669548 GGGAGCTGCACTGGGTGGACGGG + Exonic
925146680 2:1587223-1587245 GGAACCTGCACAGTGGAGACCGG + Intergenic
925368414 2:3326433-3326455 GGGAGCAGGGCAGTGGAGGCTGG - Intronic
925832544 2:7910359-7910381 GGGAGCTGCCCATGGGAGGCAGG + Intergenic
926109279 2:10171691-10171713 GGGAGCCGAGCAGGGCAGCCGGG + Intronic
926133469 2:10320038-10320060 GGGAGCTGCAAAGGGGACTCGGG - Intronic
926809896 2:16746658-16746680 GGGAGGTGGGGAGGGAAGACGGG - Intergenic
931631563 2:64306370-64306392 GGCAGCTGCGCAGTGGTAACTGG - Intergenic
931999404 2:67870471-67870493 GGGTGCTTTGAAGGGGAGACAGG - Intergenic
932412869 2:71557559-71557581 GGGACCAGGGGAGGGGAGACTGG + Intronic
932570440 2:72935716-72935738 GGGAGCTGGGCAGGGGGGTAGGG - Intronic
932777888 2:74539411-74539433 GGGAGTTGGGAAGGGGAGAAGGG + Intronic
933917274 2:87008351-87008373 GGGAGCTCCCCAGAGAAGACAGG + Intronic
934005722 2:87761563-87761585 GGGAGCTCCCCAGAGAAGACAGG - Intronic
935768678 2:106395663-106395685 GGGAGCTCCCCAGAGAAGACAGG - Intronic
935911422 2:107900265-107900287 GGGAGCTCCCCAGAGAAGACAGG + Intergenic
935969538 2:108517105-108517127 GGGAGCTCCCCAGAGAAGACAGG + Intergenic
936133204 2:109865323-109865345 GGGAGCTCCCCAGAGAAGACAGG + Intergenic
936211493 2:110506162-110506184 GGGAGCTCCCCAGAGAAGACAGG - Intergenic
936384474 2:112016623-112016645 TGGAGCTGTGCAGGGCAGACAGG + Intronic
936420631 2:112360737-112360759 GGGAGCTCCCCAGAGAAGACAGG - Intergenic
937265359 2:120611826-120611848 GGGAGGGGAGCAGGGGAGATAGG + Intergenic
937469648 2:122164279-122164301 GGGAGCTGGGGAGGACAGACAGG + Intergenic
937870021 2:126780065-126780087 GGGTGCAGGGGAGGGGAGACAGG - Intergenic
938265238 2:129923489-129923511 TGGCGCTGTGCAGGCGAGACGGG - Intergenic
938369681 2:130761414-130761436 GGGAGGTGAGCATGGGACACAGG - Intronic
938741313 2:134235183-134235205 GGGAGCATGGCAGGGGAGACAGG - Intronic
938773793 2:134523548-134523570 GGGAGCAGCTGAGGGGAGATTGG - Intronic
940772715 2:157856294-157856316 AGGAGTTGCTCAGGGGAAACTGG - Intronic
942639308 2:178044609-178044631 GGGGGCTGGGCAGGGGATTCAGG - Intronic
945604933 2:211917349-211917371 GGGAGCTACACAGTGGAGATGGG + Intronic
946009576 2:216554089-216554111 GGGATCTGGGCAGGAGAGCCTGG - Intronic
946146570 2:217735507-217735529 GGGAGCAGTGAAGGGGAGAATGG - Intronic
946191615 2:218010587-218010609 GGGAGCCGCGCGGGGGAGGCGGG + Intergenic
946306552 2:218859815-218859837 GCGAGCTCCGCAGGAGACACAGG + Exonic
946861883 2:224007991-224008013 GGGAGCTGAGCAGAGGTGCCCGG + Intronic
948421497 2:237863183-237863205 GGGAGCTGGGAAGGGGACAGGGG + Intronic
948428426 2:237902645-237902667 GGGAGGCGTGCAGGGCAGACAGG - Intronic
948580168 2:238981675-238981697 GGGAACTGCCCAGGGGATATTGG - Intergenic
948665400 2:239531641-239531663 GGGAGCTGGGCAGGGGCTCCAGG + Intergenic
948698238 2:239744859-239744881 TGGGGCTGTGCAGGGGAGCCTGG + Intergenic
1169278441 20:4248740-4248762 CGGAGCTCCGCGGGGGAGCCGGG - Exonic
1170442482 20:16392695-16392717 GAGAGCTGAGCATGGCAGACAGG - Intronic
1171490145 20:25510946-25510968 AGGGGCTGGGCCGGGGAGACAGG + Intronic
1172056431 20:32157722-32157744 GGGGGCTGCGCAAGGGGGAGGGG - Intronic
1172865687 20:38095373-38095395 GGGAGATGAGGATGGGAGACTGG + Intronic
1172947505 20:38700744-38700766 TGGGGCTGCCCAAGGGAGACAGG - Intergenic
1173719190 20:45238503-45238525 GGGAACAGTGCAGTGGAGACAGG - Intergenic
1173860797 20:46282301-46282323 GGGAGCAGCACTGGGGAGAAAGG + Intronic
1174128579 20:48326405-48326427 GAGAGCTCCGCAGGGTGGACGGG - Intergenic
1174494722 20:50931288-50931310 GCGGGCGGCGGAGGGGAGACCGG + Intergenic
1175141056 20:56860348-56860370 GGAGGCTGCCCAGAGGAGACTGG + Intergenic
1175180366 20:57142486-57142508 GGCAGCTTCCCAGGGGAGACAGG - Intergenic
1176083146 20:63284072-63284094 TGGTACTGCGCAGGGGTGACAGG - Intronic
1178407381 21:32335750-32335772 GGGAGCTGAGCTGGGGATCCTGG - Intronic
1178699078 21:34818428-34818450 GGGAGAAGCCAAGGGGAGACGGG - Intronic
1178919696 21:36730463-36730485 GGGGGCTGGGCAGGGGACAGTGG + Intronic
1179708420 21:43195576-43195598 GGGAGGTGTGCGGGGGAGGCCGG + Intergenic
1179902643 21:44401985-44402007 GGGAGCTGGGCAGGCTAGATGGG - Intronic
1179966672 21:44810847-44810869 GGGAGGAGCGCAGAGGAGAACGG + Intronic
1180024091 21:45148779-45148801 GGGAGCTGGGCTGGGCAGCCAGG - Intronic
1180042770 21:45288423-45288445 GGGAGCCGCGCATGAGAGCCTGG + Intergenic
1180069778 21:45430515-45430537 GGGAGCTGCTGAGGAGGGACCGG + Intronic
1180122295 21:45761879-45761901 GGGAGCTGCGCTGGGCAGCTGGG - Intronic
1180185229 21:46135918-46135940 GGGTGCCGGGGAGGGGAGACTGG - Intergenic
1180891499 22:19291895-19291917 GGGATCCGCGCAGGCGGGACGGG - Intergenic
1181001474 22:19989703-19989725 GGGAGCTGAGCCAGGGAGACAGG + Intronic
1181546037 22:23603247-23603269 GGGGGCTGCCCGAGGGAGACTGG - Intergenic
1181776571 22:25164268-25164290 GGAAGCGGAGCTGGGGAGACTGG - Intronic
1182621632 22:31621584-31621606 GGGGGCTGTGCTGGGGAGGCAGG + Intronic
1183092417 22:35531839-35531861 GAGTGCTGAGCTGGGGAGACGGG - Intergenic
1183486292 22:38089238-38089260 GGGAGATGGGCAGGGGAGGGTGG + Intronic
1183698924 22:39438692-39438714 GGGAGCTGGGCAGGGCAAATGGG - Intergenic
1183732763 22:39627904-39627926 GGGAGCAGCCCTGGGGAAACTGG - Intronic
1184640803 22:45868996-45869018 GGAGGCAGGGCAGGGGAGACAGG - Intergenic
1185232235 22:49689855-49689877 GGGAACGGCTCAGGGGAGAACGG + Intergenic
1185309527 22:50146324-50146346 GGGGGCTCTTCAGGGGAGACAGG + Intronic
1185345979 22:50310979-50311001 GGGTGCTGGCCAGGGGACACAGG - Exonic
950683820 3:14602708-14602730 GCGAGCTGCGGAGCGGAGCCTGG - Intergenic
950724399 3:14907136-14907158 GGGTGCTGTGCAGAGGAGACAGG + Intronic
951076119 3:18394802-18394824 GAGAGCTGCGCAGGGGATGGAGG + Exonic
952860172 3:37806503-37806525 AGGGGCTGTGCAGAGGAGACAGG - Intronic
953452938 3:43019257-43019279 TGGAGCTGAGCAAGGGAGCCTGG + Intronic
954793443 3:53149185-53149207 AGGGGCTGCGCCGGGGAGCCTGG + Intergenic
955004904 3:54959297-54959319 GGGAGCTCCACAGGGGACTCAGG + Intronic
957497326 3:81008500-81008522 GGGAACTGCCCAAGGAAGACTGG - Intergenic
960298350 3:115970968-115970990 GGGAGCTGAGGATGGGAGAGAGG + Intronic
961369382 3:126420161-126420183 GGGGGCTGCTCAGGTAAGACGGG - Exonic
962618321 3:137150661-137150683 GGCAGCAGGGCCGGGGAGACAGG + Intergenic
962954508 3:140251961-140251983 GGCAGCTGCAGTGGGGAGACAGG + Intronic
963783370 3:149509346-149509368 GGAAGGTGGGCAGGGGAGAAGGG - Intergenic
964786298 3:160399920-160399942 GGGAGCTGCGCGCGGGAGCCCGG - Intronic
966783043 3:183601514-183601536 GGGAGCTGGACAGGGCAGAAAGG + Intergenic
967904126 3:194486849-194486871 GGGAGGTGGGCAGGGGAGGGGGG + Intronic
968088636 3:195886043-195886065 GTGAGCTGGGCAGTGGGGACCGG + Intronic
968521896 4:1037856-1037878 GGGAGCATCGCAGGGGAGGGGGG - Intergenic
968569027 4:1329689-1329711 GGGAGCTGGGCTGGGGTGGCAGG + Intronic
968900328 4:3428220-3428242 GGGCACTGCGCAGGGCAGGCGGG - Intronic
969538072 4:7768876-7768898 GGGAGCTGCCCGGGGCAGCCTGG + Exonic
969904409 4:10380659-10380681 AGGAGCTGCGAAGCAGAGACAGG - Intergenic
970845454 4:20532587-20532609 GGGAGGTGTGACGGGGAGACAGG + Intronic
973102761 4:46293381-46293403 GGGAGCTGTGCACTGGAGAAAGG + Intronic
974349560 4:60726640-60726662 ATGAGCTGAGCAGAGGAGACTGG - Intergenic
974679945 4:65147518-65147540 GGGAACTGAGCAGAGGTGACTGG - Intergenic
975026029 4:69549977-69549999 GGGTGCTGGGGAGGGGAGAAGGG - Intergenic
975630970 4:76401888-76401910 TGGAGGTGGGCAGGGGAGATGGG + Intronic
977231150 4:94452269-94452291 GGGACCAGCGTAGCGGAGACGGG + Intronic
978103579 4:104873772-104873794 GAAAGCTGAGCAGGGGAGTCTGG + Intergenic
979468730 4:121071398-121071420 GGGAGCTGCGCAGCCGGGGCCGG - Intronic
981580429 4:146244315-146244337 GAAAGCTGGGGAGGGGAGACAGG + Intergenic
981896813 4:149811605-149811627 GGGAGTGGGGCAGAGGAGACAGG - Intergenic
983772514 4:171569518-171569540 GGGAGGTGGGCAGGGAGGACAGG + Intergenic
984534783 4:180960674-180960696 TGAGGCTGCTCAGGGGAGACGGG - Intergenic
984765012 4:183393881-183393903 GGGAGCTGGGCAGTTGATACAGG - Intergenic
985230900 4:187815283-187815305 GAGAGCTGCTCAGGGAAGACTGG - Intergenic
985638597 5:1052619-1052641 AGGAGCAGGGCAGGGGAGAGAGG + Intronic
985783002 5:1880786-1880808 GGGATCTGCGCATGGGGGCCTGG - Exonic
987124826 5:14802531-14802553 GGAAGCTGTGGAGGAGAGACAGG - Intronic
992213082 5:74500079-74500101 GGCAGCTGTGCAGGGGAAGCAGG + Intergenic
992377800 5:76206359-76206381 TGGAACTGCTCAGGGGACACTGG - Intronic
995623793 5:114055671-114055693 GGGAGCTGCAGAGGAAAGACAGG - Intergenic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
998337671 5:141387888-141387910 GGGAGCGGCGCCGGGGAGCTGGG + Exonic
998338781 5:141398131-141398153 GGGAGCGGCGCCGGGGAGCTGGG + Exonic
998377650 5:141701869-141701891 GGGAGCAGCGAGGGGGAGGCAGG + Intergenic
999265595 5:150264917-150264939 GAGAGGGGCGCAGGGGAGCCAGG - Intronic
1000205142 5:159051335-159051357 GGGGGCTGGGGAGGGGAGAGAGG - Intronic
1002934368 6:1659160-1659182 GGAGGCTGGGCAGGGGACACTGG + Intronic
1004075586 6:12341545-12341567 GGGAGGGGCGGAGGGGAGAGAGG - Intergenic
1004939505 6:20540990-20541012 GAGAGATGAGCAGAGGAGACTGG + Intronic
1005320255 6:24646281-24646303 GGGAGCTGAGCAGGGGAGCTGGG - Intergenic
1005856061 6:29864107-29864129 GGGAGCTGGGGAGGGGACAGAGG - Intergenic
1005958893 6:30682825-30682847 GGGAGCATCCCAGGGGAGCCAGG - Intronic
1006047375 6:31308778-31308800 GGGAGCTGGGGAGGGGACAGAGG + Intronic
1006578052 6:35060283-35060305 GGGTGCTGCTCAGTGGAAACAGG + Intronic
1006717859 6:36131430-36131452 GGGGGCTGCCCTGGGGAGTCAGG + Intronic
1006887578 6:37395415-37395437 GGGAGAGGCCCAGGGAAGACGGG - Intergenic
1007347451 6:41242971-41242993 GGAAGCAGCACAGGCGAGACAGG + Intergenic
1007406447 6:41638563-41638585 GGGACCTGGGCAGGGGCGCCCGG + Exonic
1007925843 6:45649003-45649025 GGCAGCTGCGATGGGGAGAGTGG + Intronic
1008960726 6:57262867-57262889 GAGAGCTGTGGAGGGGAGAGGGG - Intergenic
1016597013 6:145814571-145814593 GGGAGGCCCGCAGGGGAGGCCGG - Intronic
1017071013 6:150575727-150575749 AGGAGCTGGCCAGGGGGGACTGG + Intergenic
1018340453 6:162846129-162846151 GGGAGCTGGGCAGGGCTGTCAGG + Intronic
1019151309 6:170007774-170007796 GGGGGCGGCGCAGGGGCGCCAGG + Intergenic
1019408036 7:894167-894189 GGGAGCTCTGGAGTGGAGACGGG - Intronic
1019596866 7:1862119-1862141 GGGAGCTGCTCAGGGGTGTCTGG + Intronic
1019637235 7:2082378-2082400 GGGAGCTCAGCAAGGGAGATGGG + Intronic
1019928102 7:4206380-4206402 GGGAGCTGGGATGGGGAGCCTGG - Intronic
1020037535 7:4973936-4973958 GGGTGCTGCGGAGGAGGGACCGG - Intergenic
1020141801 7:5615772-5615794 GAGAACTGGGGAGGGGAGACAGG - Intergenic
1021932574 7:25596320-25596342 GGGCCCTTAGCAGGGGAGACTGG - Intergenic
1022214438 7:28244180-28244202 GAGAGGTGGGGAGGGGAGACAGG + Intergenic
1023773721 7:43583437-43583459 GGGAGCTGGGCAGGTGAGGACGG + Exonic
1023818136 7:43965760-43965782 GGGGGCTGCTCAGGGGTGAGAGG - Intergenic
1023904668 7:44513677-44513699 GAGAGGTGGGCAGGGGACACAGG + Intronic
1026360552 7:69598435-69598457 GGGAGCTGCGCGAGGCAGGCGGG + Intergenic
1032075728 7:128835242-128835264 AGGAGCTGCGCAGGTGAGGGAGG + Intronic
1033156832 7:138964185-138964207 GGGAGCTGGCCAGGGGCCACAGG + Intronic
1033656127 7:143375916-143375938 GGGAGCTGAGAAGGGCAGACAGG - Intergenic
1033810396 7:145004939-145004961 GGGAGCAGCCCAGTGGAGAGGGG + Intergenic
1034459357 7:151190023-151190045 GGGAACAGCTCAGGGGAGAACGG - Intergenic
1034498357 7:151435123-151435145 GGGAGCTTCGGAGGGGATGCAGG - Intronic
1034989976 7:155542194-155542216 CGGAGCTGGGCAGGGGAGTCAGG + Intergenic
1034989987 7:155542230-155542252 CGGAGCTGGGCAGGGGAGTCAGG + Intergenic
1035179473 7:157078567-157078589 GGGCGCTGTGCACGGGAGTCAGG - Intergenic
1035591849 8:822290-822312 GGGAGGGGCACAGGGGTGACGGG + Intergenic
1035751087 8:1996996-1997018 GGGGGGCGCGCGGGGGAGACAGG - Intronic
1036205757 8:6804618-6804640 GGGATGTGCGCAGAGGTGACTGG + Intergenic
1037524679 8:19713215-19713237 GTGAGCCGCGCTGGGCAGACAGG + Intronic
1037659060 8:20911735-20911757 GGGACCAGCCAAGGGGAGACTGG - Intergenic
1037829104 8:22177699-22177721 GGGAGCAGCCAAGGGGAGCCTGG - Intronic
1037832649 8:22198531-22198553 TGGAGTTGAGCAGGGGAGACAGG + Intronic
1037880760 8:22572384-22572406 TGGAGCTGCGCGAGGGGGACAGG + Exonic
1038021383 8:23554368-23554390 GGAAGCTGGGCAGGAGAGACTGG + Intronic
1038198204 8:25387428-25387450 GGGAGAAGGGCAGGGCAGACAGG - Intronic
1038284715 8:26196575-26196597 GGGAGCAGGGGAGGGGACACTGG - Intergenic
1038495528 8:27999453-27999475 GTGAGCTGTGCTGGGGAGTCTGG - Intergenic
1038575838 8:28702287-28702309 GGGAGCTGGGCCTGGGAGCCAGG - Intronic
1038581681 8:28753530-28753552 GGGAGCTGCGCCGGACAGAGTGG + Exonic
1038992131 8:32879169-32879191 GGCAGCTGCCCAGGGGAGGGTGG - Intergenic
1040777040 8:51057683-51057705 GGGAGCAGCCCATGGGAGCCGGG + Intergenic
1045058001 8:98385608-98385630 GGGCACTGCGAAGGGGAGTCAGG - Intergenic
1048055882 8:130864527-130864549 GGGGGTTGGGCAGGGGACACGGG - Intronic
1048833275 8:138496670-138496692 GGGAGCCCTGCAGTGGAGACAGG - Exonic
1049391492 8:142373818-142373840 GGGAGCTAGGCAGGGGAGCGGGG + Intronic
1049409380 8:142465616-142465638 GGCAGCTGCGTAAGGGAGAGAGG + Intronic
1049437053 8:142591477-142591499 GGGAGCTGTGGTGGGGAGAAAGG + Intergenic
1049580776 8:143409580-143409602 GGGAGCTGAGCAGAGGATATGGG - Intergenic
1049786535 8:144453623-144453645 GCGAGCTGCTCAGGAGAAACAGG + Intronic
1050545791 9:6707665-6707687 GAAAGCTGCCCAGGGCAGACAGG - Intergenic
1050589236 9:7145404-7145426 GGGTGCTGCGTAGGTGAGACAGG + Intergenic
1050610459 9:7347071-7347093 GAGAGCTGCGCAAGGGAGCCTGG + Intergenic
1052135866 9:24909127-24909149 ATGAGCTGTGCAGGGCAGACTGG - Intergenic
1053173106 9:35904918-35904940 GGGAGTTCTGCAGAGGAGACAGG + Intergenic
1055321612 9:75088262-75088284 CGGAGCTGCGCAGGGGCGCGCGG - Intergenic
1055861171 9:80750957-80750979 GGGACCTGAGAAGGTGAGACAGG + Intergenic
1057195063 9:93112132-93112154 GGGGGCTGCGCAGGGGAGTGGGG - Intronic
1057509205 9:95663651-95663673 GGGAGCTGCACAGGGAACACAGG + Intergenic
1057727515 9:97578697-97578719 GGGAGGTGAGCAGGGCAGGCAGG - Intronic
1059411175 9:114133205-114133227 GGGGGCTGAGCAGAGGAGGCGGG + Intergenic
1059460956 9:114429734-114429756 GGGAGCTGCAGAGGCGAGATAGG - Intronic
1060848512 9:126856542-126856564 GGAAGCTGAACAGGGGAGGCAGG + Intergenic
1061194975 9:129102611-129102633 GGGAGGAGGGCAGGGTAGACAGG + Intronic
1061403017 9:130378534-130378556 GGGAGGTGGGAAGGGGAGGCTGG + Intronic
1061518260 9:131102256-131102278 GGCAGCTGGGCAGGGTAGGCTGG + Intronic
1061587557 9:131578725-131578747 GGGAGCTGAGAAGAGGAGGCTGG - Exonic
1062289352 9:135787583-135787605 AGGAGCTGCTCACGGGTGACTGG + Intronic
1062326914 9:136016916-136016938 GGTAGCTGGACAGGGGTGACAGG + Intronic
1203441255 Un_GL000219v1:10606-10628 GGGAGCTGCACAGGGGACTTTGG + Intergenic
1203512064 Un_KI270741v1:129514-129536 GGGAGCTGCACAGGGGACTTTGG + Intergenic
1189292853 X:39897980-39898002 GGGTGCTGAGCAGGGAAGCCAGG + Intergenic
1190108562 X:47574942-47574964 GGGAGGTGCTCAGGGAAGTCAGG + Intronic
1190215724 X:48478353-48478375 GGGTGCTCCCCAGGGGAGAGGGG + Intronic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1192807688 X:74524623-74524645 GGGAGCTGGGCAGGAGGGGCCGG - Exonic
1194252008 X:91587502-91587524 GGGAGCTGCACAGGGCAAAGGGG + Intergenic
1194481594 X:94433025-94433047 GGGAGCAGGGCAGGGGAGAATGG + Intergenic
1195129062 X:101837199-101837221 CTGAGCTGTGCAGGGCAGACAGG + Intronic
1195177195 X:102322644-102322666 CTGAGCTGTGCAGGGCAGACAGG - Intronic
1195181669 X:102364449-102364471 CTGAGCTGTGCAGGGCAGACAGG + Intronic
1195254422 X:103079022-103079044 CTGAGCTGTGCAGGGCAGACAGG + Intronic
1197130021 X:122994648-122994670 GGGAGCAGCTCAGTGGAGAGTGG - Intergenic
1199756496 X:150869868-150869890 GGAAGATGGGGAGGGGAGACTGG + Intronic
1199880962 X:151974208-151974230 GGGAGCGGCCCCGGGGTGACCGG - Intronic
1199983297 X:152932972-152932994 GTGAGCTGCCCGGGGGAGGCAGG + Intronic
1199996331 X:153028910-153028932 GGTACCTGCCCAGGGGCGACAGG - Intergenic
1200034853 X:153320539-153320561 GGTACCTGCCCAGGGGCGACAGG + Intergenic
1200045497 X:153398702-153398724 GGTACCTGCCCAGGGGCGACAGG + Intergenic
1200570939 Y:4828740-4828762 GGGAGCTGCACAGGGCAAAGGGG + Intergenic
1201160934 Y:11166764-11166786 GGGGGCTGGGGGGGGGAGACAGG - Intergenic