ID: 1192369787

View in Genome Browser
Species Human (GRCh38)
Location X:70503875-70503897
Sequence CTCCCTCGCCTCCATACTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192369782_1192369787 5 Left 1192369782 X:70503847-70503869 CCACTGTGCTCCTTTGAAGCCAA 0: 1
1: 0
2: 1
3: 27
4: 201
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369773_1192369787 16 Left 1192369773 X:70503836-70503858 CCCCCCCCACCCCACTGTGCTCC 0: 1
1: 2
2: 26
3: 155
4: 1301
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369780_1192369787 7 Left 1192369780 X:70503845-70503867 CCCCACTGTGCTCCTTTGAAGCC 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369781_1192369787 6 Left 1192369781 X:70503846-70503868 CCCACTGTGCTCCTTTGAAGCCA 0: 1
1: 0
2: 2
3: 13
4: 180
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369779_1192369787 10 Left 1192369779 X:70503842-70503864 CCACCCCACTGTGCTCCTTTGAA 0: 1
1: 0
2: 0
3: 25
4: 308
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369783_1192369787 -5 Left 1192369783 X:70503857-70503879 CCTTTGAAGCCAACGTGCCTCCC 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369777_1192369787 12 Left 1192369777 X:70503840-70503862 CCCCACCCCACTGTGCTCCTTTG 0: 1
1: 1
2: 3
3: 38
4: 373
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369775_1192369787 14 Left 1192369775 X:70503838-70503860 CCCCCCACCCCACTGTGCTCCTT 0: 1
1: 0
2: 6
3: 75
4: 665
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369778_1192369787 11 Left 1192369778 X:70503841-70503863 CCCACCCCACTGTGCTCCTTTGA 0: 1
1: 0
2: 3
3: 19
4: 290
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369776_1192369787 13 Left 1192369776 X:70503839-70503861 CCCCCACCCCACTGTGCTCCTTT 0: 1
1: 0
2: 5
3: 74
4: 741
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1192369774_1192369787 15 Left 1192369774 X:70503837-70503859 CCCCCCCACCCCACTGTGCTCCT 0: 1
1: 3
2: 3
3: 126
4: 996
Right 1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192369787 Original CRISPR CTCCCTCGCCTCCATACTGG AGG Exonic