ID: 1192373946

View in Genome Browser
Species Human (GRCh38)
Location X:70539930-70539952
Sequence CCAAGGGACCAGTAGTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192373942_1192373946 1 Left 1192373942 X:70539906-70539928 CCAAGAAAAGTCTGCTGTCTCTA 0: 1
1: 1
2: 16
3: 64
4: 327
Right 1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 138
1192373939_1192373946 28 Left 1192373939 X:70539879-70539901 CCAAAAAGAAAAAGAAAGAAAAA 0: 2
1: 76
2: 832
3: 16614
4: 30131
Right 1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 138
1192373941_1192373946 2 Left 1192373941 X:70539905-70539927 CCCAAGAAAAGTCTGCTGTCTCT 0: 1
1: 0
2: 18
3: 75
4: 348
Right 1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 138
1192373940_1192373946 3 Left 1192373940 X:70539904-70539926 CCCCAAGAAAAGTCTGCTGTCTC 0: 1
1: 1
2: 10
3: 57
4: 254
Right 1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 138
1192373938_1192373946 29 Left 1192373938 X:70539878-70539900 CCCAAAAAGAAAAAGAAAGAAAA 0: 7
1: 99
2: 1070
3: 16808
4: 28796
Right 1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG 0: 1
1: 0
2: 1
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192373946 Original CRISPR CCAAGGGACCAGTAGTAAAA AGG Intronic
900851792 1:5149548-5149570 CCACGGCACCAGTTGTACAATGG + Intergenic
901237234 1:7673622-7673644 CCAAGGGACCAGGAGCCACAAGG + Intronic
902956419 1:19926966-19926988 CCAGGGGGCCAGTTGCAAAATGG + Intergenic
902957006 1:19932258-19932280 CCAGGGGACCAGTTGCAAAATGG + Intergenic
904555947 1:31364392-31364414 CAAAGGGACCAGGAGTGATAAGG - Exonic
906318493 1:44802919-44802941 CCAAGGGGTCAGGAGTAAAGTGG - Intronic
907235189 1:53039984-53040006 CCAAGGAACCAGTAGGACACAGG - Intronic
908418715 1:63938491-63938513 TCAAGGGACCTTGAGTAAAAAGG - Intronic
911797968 1:102097958-102097980 CCAAGGAACAAGTAGAAAAGGGG - Intergenic
913247410 1:116882114-116882136 CTAAGGTAGCAGTAGTAGAAGGG + Intergenic
915409837 1:155691927-155691949 CCAGGGGGCCAGTTGCAAAATGG + Intronic
915410641 1:155699076-155699098 CCAGGGGGCCAGTTGCAAAATGG + Intronic
915574523 1:156767000-156767022 CCAAGGGACCCGTACGAAATTGG - Intronic
920529604 1:206692388-206692410 CCAAGGAAGCAGGAGGAAAAGGG + Intronic
921228529 1:213045213-213045235 CCAGGGGGCCAGTTGCAAAATGG + Intergenic
921228582 1:213045705-213045727 CCAGGGGGCCAGTTGCAAAATGG + Intergenic
921347958 1:214206658-214206680 CCATGTGACCAGAAGCAAAAGGG - Intergenic
923211228 1:231806280-231806302 CCAGTGTACCTGTAGTAAAAGGG + Intronic
923327624 1:232894865-232894887 CCAATGGAACAGTAGAAAATGGG - Intergenic
924748271 1:246859361-246859383 CCAGGGGAACACTAGTAAATGGG - Intronic
1062912208 10:1218678-1218700 CCAAGGGGACGGTAGTAAACTGG - Intronic
1064051297 10:12061821-12061843 TCAGGGGACCAGGAGTATAAGGG + Intergenic
1064176461 10:13079686-13079708 ACAAACGTCCAGTAGTAAAAAGG + Intronic
1065983969 10:30930940-30930962 CAAAGGAACCAGAAGAAAAATGG - Intronic
1066109022 10:32180016-32180038 CCAAGGGTGTAGCAGTAAAAAGG + Intergenic
1068724400 10:60284935-60284957 ACAGGGCACCAGTAGAAAAAAGG - Intronic
1069192027 10:65504330-65504352 CCAAGTGACCAGTTGCAGAAAGG - Intergenic
1070931846 10:80266352-80266374 CCAAGTGACCAGGAGGAAACAGG - Intergenic
1078362939 11:10683638-10683660 CCAAGGGACCAGTAGGGGATGGG + Intronic
1078965253 11:16332009-16332031 CCAAGAGAACAGTAGCCAAAAGG + Intronic
1079436272 11:20454718-20454740 CCAAGTAATTAGTAGTAAAAAGG + Intronic
1080248478 11:30206288-30206310 CAAAGGGACCAGAACCAAAAAGG - Intergenic
1091010813 11:131998732-131998754 CCAAGGCAACAGTAGAAAGAAGG - Intronic
1091093723 11:132797067-132797089 CCAAAGGACAACTATTAAAAAGG - Intronic
1092992253 12:13914190-13914212 GCAGGGGACCAGTAGTGAAAAGG - Intronic
1096861270 12:54530217-54530239 ACAAGAGACCAGTAGAAGAAAGG - Intronic
1097894624 12:64812245-64812267 CCAAGAAACAAGAAGTAAAAGGG - Intronic
1100247895 12:92782759-92782781 CCTAGGGACCAGTGGAAGAAGGG - Intronic
1103039866 12:117685937-117685959 CCAAGGTACCTGAAGCAAAAAGG - Intronic
1109247096 13:59967998-59968020 CCAAAGGACCAGCAGTACAAAGG + Intronic
1111627706 13:90810752-90810774 TCAGGGGACTAATAGTAAAATGG + Intergenic
1112468223 13:99663798-99663820 CCAGGAGAGCAGGAGTAAAACGG - Intronic
1114367144 14:22041274-22041296 CCAAAGGACCATTTGGAAAAAGG - Intergenic
1114575027 14:23705569-23705591 CCAGGGGTCCAGCATTAAAAAGG - Intergenic
1118476619 14:66123359-66123381 ACTAGAGACCAGTGGTAAAAGGG + Intergenic
1120261238 14:82188871-82188893 CCAGGGGCCCAGTAGAAAAAAGG - Intergenic
1120563920 14:86031243-86031265 CCAAGTGACCAATTGGAAAATGG + Intergenic
1126933612 15:53682168-53682190 CCAAGGATGAAGTAGTAAAATGG - Intronic
1127044539 15:55011794-55011816 CCAATGGACCTGGAGTAAAGTGG + Intergenic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1130238528 15:82162880-82162902 CCAAAGGACAAATGGTAAAATGG - Intronic
1130955944 15:88627366-88627388 GAAAGGGAACAGTATTAAAAAGG + Intronic
1131846898 15:96497657-96497679 CCAAGGCACCATTAGTTTAAAGG - Intergenic
1132219076 15:100091490-100091512 CCTAAGGACCAGCAGTAAGAAGG + Intronic
1135755983 16:25098590-25098612 CCATGGGAACAGGAGAAAAAAGG - Intergenic
1141134099 16:81454693-81454715 CCAAGGGACTCATAGTTAAATGG + Intronic
1142780974 17:2180953-2180975 CCAAGGGAGCAGGAATGAAATGG - Intronic
1143241751 17:5449345-5449367 CCAACGACCCAGTAGAAAAATGG + Intronic
1148112763 17:45155633-45155655 CCTAGGCCCCAGTAGGAAAAAGG - Intergenic
1151838134 17:76597583-76597605 ACTAGGGACCAGCAGCAAAAAGG - Intergenic
1153344353 18:4009834-4009856 CCAAGGGAACAGTAGCAGGATGG + Intronic
1156954601 18:42946967-42946989 ACTATGGACCAGTAGCAAAATGG + Intronic
1158326803 18:56321652-56321674 CCAGGGGACCAGCAGTCAACAGG + Intergenic
1159075567 18:63677877-63677899 ACGAGGGACCAGTAGTAACAGGG + Intronic
1163418380 19:17200684-17200706 CCAAGGAACCAGGAGGCAAAGGG + Exonic
1163665695 19:18603206-18603228 CCAAGGAAGCAGCAGGAAAAAGG + Intronic
1166424748 19:42667654-42667676 CCAGGGGGCCAGTTGCAAAATGG + Intronic
1168019944 19:53601903-53601925 CTACGGGACCAGGGGTAAAAAGG - Intronic
925207604 2:2020640-2020662 CCAAAAGACCAGCAGTAAACTGG - Intronic
932088355 2:68782368-68782390 TCTAGGGTCCAGAAGTAAAATGG - Intronic
933835944 2:86245635-86245657 CCAGGGGGCCAGTTGCAAAATGG - Intronic
948357485 2:237391480-237391502 GAAAGGGACCAGTAGAGAAATGG - Intronic
948822360 2:240556628-240556650 CCAGGGGGCCAGTTGCAAAATGG - Intronic
1179677482 21:42993593-42993615 CCAAGGGAGCAGGAGAAATAAGG - Intronic
1179780691 21:43698953-43698975 CCAGGGGGCCAGTGGCAAAATGG - Intergenic
1179787632 21:43738883-43738905 CCAGGGGGCCAGTGGCAAAATGG - Intronic
1181553497 22:23654247-23654269 CCAAGGGAGCAGTAGGAATTGGG - Intergenic
1182493647 22:30691386-30691408 CCAAGGGATAAGGAGTGAAAGGG - Intergenic
951627093 3:24677431-24677453 CCAAGGAACTAGTTGTAAAAAGG + Intergenic
951954996 3:28243716-28243738 CCTAGGGAACAGTAGTACATAGG + Intronic
953195030 3:40724220-40724242 CCATGGGAACAGGAGTATAATGG - Intergenic
954613961 3:51960129-51960151 GCAAGGGAGCAGTTGTAAGAGGG - Intronic
955155575 3:56413548-56413570 CTTAGAGACCAGTAGTCAAATGG - Intronic
955419777 3:58724715-58724737 CCAGGGGGCCAGTTGCAAAATGG - Intronic
957511903 3:81200371-81200393 CCAAATAATCAGTAGTAAAAGGG - Intergenic
957998050 3:87716237-87716259 CCAAGGGAAGAGGAGGAAAATGG + Intergenic
959016804 3:101143960-101143982 GAAAGGGACCTGTAGTATAAGGG + Intergenic
960579675 3:119266173-119266195 TCAATTAACCAGTAGTAAAATGG + Intergenic
961531947 3:127545302-127545324 CCAAGAGACCAGTAGGAATGGGG + Intergenic
961882705 3:130073800-130073822 CTAAGGGACCTTTACTAAAATGG + Intergenic
963233399 3:142932148-142932170 CCAAGGGAGCAGGAGTGAACAGG - Intergenic
963398100 3:144758354-144758376 CCCAGGGACAAGTACAAAAAAGG + Intergenic
965539441 3:169857762-169857784 CCCAGGGACAGGTAGTAAAGAGG - Intronic
967065459 3:185911308-185911330 AGAGGGGACCAGGAGTAAAAAGG - Intergenic
968640077 4:1709974-1709996 CCAGGGGACCAGTTGGAAAATGG - Intronic
969705138 4:8787614-8787636 CCCAGGGACCAGCAGTAAAGAGG + Intergenic
971455519 4:26840539-26840561 CCAGGGGAACAGCAGAAAAATGG - Intergenic
973740943 4:53918950-53918972 CCAAAGTACCAGGAGCAAAAAGG - Intronic
974272508 4:59669310-59669332 CCAAGGAAAGAGTAGTAAAGTGG + Intergenic
979838150 4:125400397-125400419 TCAAGAGAACAGTATTAAAAGGG - Intronic
983110603 4:163744963-163744985 CCAAGGGACCAAAAGCAAAAGGG + Intronic
985228020 4:187783646-187783668 TCAAGGGACTAGGAGTAGAATGG - Intergenic
986121578 5:4842444-4842466 CCAAGGCCCCAGAAGTAATAAGG - Intergenic
988794378 5:34638965-34638987 ACAAGGCTACAGTAGTAAAAAGG + Intergenic
993083264 5:83329425-83329447 CCAAGAAAACAATAGTAAAATGG + Intronic
1000850186 5:166330204-166330226 CCAAGGGAGAAGTATTTAAAGGG + Intergenic
1002400162 5:178987049-178987071 CCCAGGGACCAGCAGGAGAAAGG + Intronic
1004138231 6:12989674-12989696 CCAGGGGGCCAGTTGCAAAATGG + Intronic
1005354522 6:24969628-24969650 CCTAGTGACCAGTAGCAGAATGG + Intronic
1006315896 6:33291458-33291480 GCAAGGGACCAGTGGTAGAGAGG + Intronic
1006621517 6:35368048-35368070 CCAAGGAACCAGAAGCAGAAAGG - Intronic
1006972298 6:38059181-38059203 CCAAGGGATAAGGAGAAAAACGG - Intronic
1007129866 6:39460869-39460891 CCAAGGAAGCAGTATTACAAAGG - Intronic
1009964431 6:70563752-70563774 CCCAGGGAGCAGCAGTTAAATGG + Intergenic
1011605434 6:89100185-89100207 CCAAGGGACCAGCAAAAAACCGG + Intronic
1012932583 6:105332205-105332227 CCAAGGGACCTGCAGAAAAAAGG + Intronic
1014066663 6:117134920-117134942 TCAAGGGACAAATAGCAAAAAGG + Intergenic
1014526910 6:122511635-122511657 CCAGGGGGCCACTTGTAAAATGG + Intronic
1016366575 6:143325151-143325173 CCAAGGGACAAGTGGTTCAAAGG - Intronic
1018632329 6:165831828-165831850 CCAAGAAAACAGTATTAAAAAGG - Intronic
1020472016 7:8548200-8548222 CAATGGGACAAGTATTAAAAAGG + Intronic
1020535916 7:9398678-9398700 CTAAAGTAGCAGTAGTAAAAGGG - Intergenic
1028540357 7:91936784-91936806 CCAATGGACCAGAATTGAAAAGG - Intergenic
1032025491 7:128438748-128438770 GCAAGGGACCAGAAGAAACAAGG - Intergenic
1032150621 7:129426550-129426572 CCAAGGCACCTGTAGTAATTAGG - Exonic
1033345555 7:140523213-140523235 CCAAGGGCCAAGTAGGAATATGG - Intronic
1035975770 8:4309604-4309626 CCAAGGGAGTTGTACTAAAATGG - Intronic
1037850533 8:22323951-22323973 CCAAGGCACCAGTAGAATATTGG + Intronic
1037945184 8:22985188-22985210 CCAGGGGGCCAGTTGCAAAATGG + Intronic
1041923682 8:63213380-63213402 CTAGATGACCAGTAGTAAAAGGG - Intergenic
1043968724 8:86507624-86507646 CCAAGGGGCCAGGCCTAAAATGG + Intronic
1044603171 8:94026022-94026044 CCAAGGGACCAGTGATTTAAAGG - Intergenic
1047201960 8:122774836-122774858 ACAAGGGACTTATAGTAAAATGG + Intergenic
1047537103 8:125729877-125729899 CCAATAGACAAGGAGTAAAAGGG - Intergenic
1048422151 8:134287683-134287705 CCAACTGACCAGGATTAAAATGG + Intergenic
1048848341 8:138620630-138620652 CCAAGGCACCAGTAGAAAAATGG + Intronic
1052341180 9:27365841-27365863 CAAACGGACCAGTACTGAAATGG + Intronic
1059550723 9:115226168-115226190 CTAAGGGACCAGTCCCAAAAGGG + Intronic
1060080721 9:120641888-120641910 CAAAGGAACCAGTAGCAAATGGG - Intronic
1062652621 9:137586007-137586029 CCAAGGGACCAGCAGGATAGGGG - Intronic
1186728135 X:12378710-12378732 CCAATGGATCAGTAGAGAAAGGG + Intronic
1187503497 X:19859667-19859689 CCTAGGAACCAGTAGGAGAATGG - Intronic
1190556043 X:51636942-51636964 CCAGGGGGCCAGTTGCAAAATGG - Intergenic
1191264316 X:58368737-58368759 CAAAGTGACCATTAGTAGAATGG + Intergenic
1192373946 X:70539930-70539952 CCAAGGGACCAGTAGTAAAAAGG + Intronic
1195085569 X:101410599-101410621 CTAAGGCAACAGGAGTAAAATGG - Intronic
1195295233 X:103469971-103469993 CCAGGGGACCAATTGCAAAATGG + Intergenic
1198712280 X:139518193-139518215 CCAGGGGGCCAATTGTAAAATGG - Intergenic
1199719005 X:150528755-150528777 CCAAAGGAATAGTAGCAAAAGGG + Intergenic
1199898380 X:152148547-152148569 CCAAGGGACCAGACTTAAAGAGG - Intergenic