ID: 1192373958

View in Genome Browser
Species Human (GRCh38)
Location X:70540038-70540060
Sequence GCCCACTCCCTTGCTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192373957_1192373958 -3 Left 1192373957 X:70540018-70540040 CCTGGAAGTAACAAGGCTGGGCC 0: 1
1: 0
2: 3
3: 16
4: 173
Right 1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG 0: 1
1: 0
2: 0
3: 15
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192373958 Original CRISPR GCCCACTCCCTTGCTAAAGC AGG Intronic
900635409 1:3662446-3662468 GTCAACTCCCCTGCTATAGCTGG - Intronic
902488766 1:16765506-16765528 CCACACTCAGTTGCTAAAGCAGG - Intronic
902743481 1:18457104-18457126 TCCCACTCTGTTGCTAAGGCTGG + Intergenic
904338008 1:29810450-29810472 GGCCACGCCCTTGCCACAGCTGG - Intergenic
906046243 1:42832997-42833019 GCCCACTCTCTGGAAAAAGCTGG + Intronic
906299424 1:44671231-44671253 GCCCAGGCCTTTGCTAAAGCCGG - Intronic
906688751 1:47779048-47779070 CCCCACTCCCATGCTAAAGGAGG - Intronic
907894588 1:58674297-58674319 GGCCACCTCCTTTCTAAAGCTGG - Intronic
910422657 1:87083847-87083869 GCCAACACACATGCTAAAGCAGG - Intronic
911725429 1:101237086-101237108 GCCCCCTACCTCGCTCAAGCAGG - Exonic
913516435 1:119609416-119609438 GCCCATTCCCTGGCTCAACCAGG + Intergenic
915194069 1:154176149-154176171 GGCCACTGCCCTGCAAAAGCTGG - Exonic
915271542 1:154757283-154757305 CTCAACTCCCTTGCTAAAGCTGG + Intronic
917925474 1:179786077-179786099 CCCCACTCCCTTGCCAAAAAGGG + Intronic
923118191 1:230963796-230963818 TCCTACTCCCTGGCTAGAGCAGG + Intronic
923531671 1:234817018-234817040 CCACACTCAGTTGCTAAAGCAGG + Intergenic
1067187347 10:44042413-44042435 CCCTACTCCAGTGCTAAAGCTGG + Intergenic
1076740234 10:132479269-132479291 GCCCATTCCCTGGCTGGAGCAGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1078170451 11:8925444-8925466 GCCCACTCCCCTGGTATACCTGG + Exonic
1083941760 11:65899921-65899943 GCCCACGCCCCTTCTGAAGCAGG + Intronic
1084758417 11:71252853-71252875 TCCCCCTCCCTGGCCAAAGCCGG + Intergenic
1085654268 11:78298314-78298336 GCCCACCCACTTGCTCAAGCTGG - Intronic
1086088260 11:82978762-82978784 ACCCAGTCCTTTGCTAAATCTGG + Exonic
1090250308 11:125246335-125246357 ACCCACTCCCGTGATAAAGGTGG + Intronic
1091794082 12:3287449-3287471 GGCCACTCCCTTGAGAAGGCGGG - Intergenic
1091900149 12:4137893-4137915 TCCCACTACGTTGCTCAAGCTGG - Intergenic
1093969020 12:25357615-25357637 GCCCCCTCCCTTGTCAAAGCTGG + Intergenic
1117259022 14:54009799-54009821 CCCCACACACTTGCTAATGCTGG + Intergenic
1120871331 14:89339783-89339805 GGCCACTCCCCTGCAAATGCAGG + Intronic
1124493005 15:30169714-30169736 TCTCACTCCCTTGCTCAGGCTGG + Intergenic
1124750529 15:32368611-32368633 TCTCACTCCCTTGCTCAGGCTGG - Intergenic
1137938171 16:52655513-52655535 GGCCACTGCCCTGCAAAAGCTGG + Intergenic
1141144197 16:81517515-81517537 GCCCACTCTCTTGCCAGAGGAGG - Intronic
1141860088 16:86710574-86710596 GGCCTCTCCCTTGCTAAGGAAGG + Intergenic
1145973903 17:28973342-28973364 ACCCACCTCCTTGCTAAACCTGG - Intronic
1147163120 17:38579151-38579173 ACCCCCTCCCCTCCTAAAGCTGG + Intronic
1152013623 17:77735645-77735667 GCCCAGTCCCTGGCTGGAGCTGG + Intergenic
1152032813 17:77854449-77854471 CCCCACCCCCTGGCTGAAGCTGG - Intergenic
1160911571 19:1476294-1476316 TCCCACCCTGTTGCTAAAGCAGG - Intronic
1163076397 19:14895887-14895909 GTTCACTCCCTTGCTGAAGAGGG - Intergenic
1165645403 19:37431644-37431666 GCCCTCTCCTTTTCTCAAGCAGG - Intronic
1167468434 19:49662470-49662492 TCCCACTCCCTTCCCAAACCTGG - Exonic
1168000514 19:53442072-53442094 GGCCACTGCCCTGCAAAAGCTGG + Intronic
1168005010 19:53479556-53479578 GGCCACTGCCCTGCAAAAGCTGG + Intronic
927758011 2:25724120-25724142 CCCCTCTCCCTTGCCGAAGCTGG - Intergenic
927766162 2:25810425-25810447 GGCCACTGCCCTGCAAAAGCCGG - Intronic
933712806 2:85340054-85340076 TCCCACTCTCTTGCTCAGGCTGG + Intergenic
933833821 2:86230478-86230500 GCCCGCTTCCTAGCCAAAGCAGG + Intronic
935950416 2:108323810-108323832 GGCCACTCAGTTGATAAAGCCGG - Intergenic
936428058 2:112436078-112436100 GCACACTTCCTTGCAAAATCCGG + Intergenic
938815462 2:134899433-134899455 ACCCACTTCCTTCCTAAAGTAGG + Intronic
940398362 2:153220116-153220138 GCCCACTACCTGGCTAACACTGG - Intergenic
940863615 2:158795276-158795298 GCCCCCTGCCTTTATAAAGCCGG + Intergenic
942028054 2:171930642-171930664 GCTCACTCCATTGCCAAGGCTGG + Intronic
944736980 2:202575908-202575930 TCCCACTCTGTTGCTCAAGCTGG + Intergenic
947488450 2:230573680-230573702 GGCCACTGCCTTGCAAAAGCTGG - Intergenic
947908896 2:233789047-233789069 GCCCAATCCCATCCTAAACCAGG + Intronic
1168851160 20:978029-978051 GCCCACCCCCTTGCTAGAGATGG - Intronic
1170840025 20:19917165-19917187 GCCCTCTCCCTCCCTGAAGCTGG - Intronic
1172638750 20:36428139-36428161 TCCCTCACCCCTGCTAAAGCTGG - Intronic
1176374196 21:6079134-6079156 GCACACTTCCTTGCAAAATCCGG - Intergenic
1179749280 21:43459111-43459133 GCACACTTCCTTGCAAAATCCGG + Intergenic
1182853183 22:33494024-33494046 GCCCACTCCGTGGCTAACACAGG + Intronic
951221330 3:20071765-20071787 GCCCTCTTCATTTCTAAAGCTGG + Intronic
951340888 3:21485285-21485307 GCTCACTTACTTGATAAAGCTGG + Intronic
952331920 3:32371337-32371359 CCCCACTCTGTTGCTCAAGCTGG - Intergenic
953150743 3:40322226-40322248 ACCCACTCCCTTCATACAGCTGG - Intergenic
957567480 3:81903801-81903823 GACCACTCCATTGCTAATGTGGG + Intergenic
959050599 3:101521210-101521232 GTGGACTCCCTTGCTACAGCAGG - Intergenic
961227998 3:125271329-125271351 GCCCACTCCATTGTGAAATCCGG + Intronic
961509980 3:127394971-127394993 TGCCTCTCCCTTGGTAAAGCTGG - Intergenic
961832734 3:129632520-129632542 GGTCTCTCCCTTTCTAAAGCTGG + Intergenic
962928731 3:140018379-140018401 GCCAACCCCCGTGCTCAAGCAGG - Intronic
964513024 3:157474694-157474716 GCCCACTCATTTGCTAAGGCAGG - Intronic
966230449 3:177645900-177645922 TCCCACTTCCTTGTCAAAGCAGG + Intergenic
966944678 3:184769510-184769532 GCCCCCTCCCCTGCTTTAGCTGG + Intergenic
967924720 3:194637217-194637239 GCTCACTCTCCTGCTAAAGCAGG + Intergenic
967929374 3:194679656-194679678 GTCCACTTCCTTCCTAAAGAGGG + Intergenic
968895698 4:3401831-3401853 GCCCATTCTCTTCCTAAAACCGG - Intronic
968968745 4:3782515-3782537 GCTCACTCACTCGCTCAAGCAGG - Intergenic
969497152 4:7532774-7532796 GTCCTCTCTCTTCCTAAAGCAGG + Intronic
971198059 4:24488065-24488087 GCCCACTCCTGTGCCAGAGCTGG - Intergenic
972253810 4:37332689-37332711 TCCCTCTCCTTTTCTAAAGCAGG - Intronic
979515869 4:121609435-121609457 GGCTGCTCCCTTGCTAAGGCTGG - Intergenic
981984104 4:150832797-150832819 CCCCACTCCATTGCTCAGGCTGG + Intronic
982430877 4:155320617-155320639 GCCCTCTCACTGGCTAAATCCGG + Intergenic
984921871 4:184771756-184771778 GCCCCTTCCTTTCCTAAAGCTGG + Intronic
985124306 4:186676654-186676676 AAGCACTCCCTTGCTAAAGAAGG + Intronic
986614373 5:9601566-9601588 GCCCACTCCGTTGCCAAGGCTGG - Intergenic
988194230 5:27980749-27980771 GCCCACTTCCTTTTTAAGGCTGG + Intergenic
995841410 5:116446681-116446703 GCGTACGCCCTCGCTAAAGCCGG - Exonic
997810010 5:136957810-136957832 GCTGACTCCCTTGCTATGGCAGG - Intergenic
998763412 5:145457334-145457356 ACCTACTCCCTTGCCAAAGATGG - Intergenic
1002637110 5:180613977-180613999 GCCCAGTCCCTTACTCCAGCAGG + Intronic
1004370992 6:15051890-15051912 ATCCACACTCTTGCTAAAGCTGG + Intergenic
1006483185 6:34315154-34315176 CCCCACTCCCTTTTTAAACCTGG - Intronic
1008479949 6:51975811-51975833 GACCACTCCATTGCCAAAGGAGG + Intronic
1009718444 6:67430601-67430623 TCTCACTCCATTGCCAAAGCTGG + Intergenic
1011740657 6:90356200-90356222 CCCCAGGCCCTTGCTGAAGCTGG + Intergenic
1019998954 7:4743820-4743842 ACCCACTCCCAGGCTAAGGCGGG - Intronic
1022081228 7:27023945-27023967 GACCACTGCCCTGCAAAAGCTGG + Intergenic
1023864070 7:44230504-44230526 GCCCCCTCCCTTGCTCACCCAGG - Intronic
1026775869 7:73230718-73230740 TCTCACTCCCTTGCTAAGGCTGG + Intergenic
1027016727 7:74784090-74784112 TCTCACTCCCTTGCTAAGGCTGG + Intronic
1027051075 7:75021611-75021633 CCCCAAACCCTTGCTAAGGCTGG - Intronic
1027071301 7:75161846-75161868 TCTCACTCCCTTGCTAAGGCTGG - Intergenic
1029606878 7:101604542-101604564 GTCTGCTCCCTTGCTAAAGAGGG + Intergenic
1031018399 7:116600102-116600124 GCCCACTTCCCCGCTACAGCTGG - Intergenic
1037943634 8:22973256-22973278 TCTCACTCCCTTGCCCAAGCTGG + Intronic
1041183310 8:55271521-55271543 ACTGACTCCCTTGCTACAGCAGG - Intronic
1042373450 8:68019288-68019310 TCCCACTCCCTTCTCAAAGCTGG - Intronic
1042440130 8:68816196-68816218 GCACTCTCCCTTGCTAAGGTGGG + Intronic
1043768273 8:84164373-84164395 GGCCACTGCCCTGCAAAAGCTGG - Intergenic
1047031321 8:120884570-120884592 TCCCACACCCTTGCTAAACTAGG + Intergenic
1048715264 8:137261640-137261662 GCCCCTTCCTTTGCAAAAGCTGG + Intergenic
1049507812 8:143013211-143013233 GCCCACTCCTTTTCCAAAGAGGG - Intergenic
1053444729 9:38143327-38143349 GCTCACTCCCTTTCAAGAGCGGG + Intergenic
1055749863 9:79493270-79493292 GACTACTCCTTTGCTAAAGTTGG + Intergenic
1057750771 9:97791011-97791033 GTCCACTCCCTTGCTGGAGCAGG - Intergenic
1058429765 9:104907742-104907764 GCCCAGTCCTTAGCTAAAGCTGG - Intronic
1062094828 9:134697733-134697755 TCCCACTCCCTTGCCATAGGTGG + Intronic
1185839784 X:3378309-3378331 GCCCATTCCCTTCCTGGAGCAGG + Intergenic
1189093434 X:38112328-38112350 GCCCACTTCCTTACTGAAGGTGG + Intronic
1192373958 X:70540038-70540060 GCCCACTCCCTTGCTAAAGCAGG + Intronic
1193365240 X:80623604-80623626 CCCCACTCCCTAGCCAAAACAGG - Intergenic
1195941265 X:110169835-110169857 GCCCACACCCCTTCTAAAGAGGG - Intronic
1201743145 Y:17344600-17344622 GCACACTTCCCAGCTAAAGCAGG - Intergenic