ID: 1192375392

View in Genome Browser
Species Human (GRCh38)
Location X:70555097-70555119
Sequence TAGAATCAATAATAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192375392_1192375395 21 Left 1192375392 X:70555097-70555119 CCCTGCTGCTATTATTGATTCTA 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1192375395 X:70555141-70555163 GCTTCTTGTGAACTTTCAACTGG 0: 1
1: 0
2: 1
3: 13
4: 84
1192375392_1192375397 26 Left 1192375392 X:70555097-70555119 CCCTGCTGCTATTATTGATTCTA 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1192375397 X:70555146-70555168 TTGTGAACTTTCAACTGGGCTGG 0: 1
1: 0
2: 2
3: 11
4: 132
1192375392_1192375396 22 Left 1192375392 X:70555097-70555119 CCCTGCTGCTATTATTGATTCTA 0: 1
1: 0
2: 1
3: 19
4: 225
Right 1192375396 X:70555142-70555164 CTTCTTGTGAACTTTCAACTGGG 0: 1
1: 0
2: 1
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192375392 Original CRISPR TAGAATCAATAATAGCAGCA GGG (reversed) Intronic
902238270 1:15071690-15071712 TTGATCCAAGAATAGCAGCAAGG + Intronic
905073868 1:35252338-35252360 TAAAATCAATAATAAAAGCAGGG - Intergenic
907683132 1:56582830-56582852 TAAAAACTATAATATCAGCAGGG + Intronic
907901347 1:58744200-58744222 TGGAATCAACAATTGCAGAAGGG + Intergenic
908918799 1:69165258-69165280 TAGAAATAATAATAGAGGCAAGG + Intergenic
910050772 1:82971621-82971643 TAGAATAAATAATATTGGCAAGG + Intergenic
910209306 1:84777194-84777216 TAAAATAAAAAATAGCAGAAAGG - Intergenic
910337106 1:86147032-86147054 TAGAATCAAAAACAGAATCAGGG - Intronic
911229122 1:95341343-95341365 TAAAATCAATGATAGCAAGAGGG - Intergenic
919297954 1:195724644-195724666 GAGAATCAATAAAATCAGCAGGG + Intergenic
919620665 1:199861228-199861250 TAGAAGCAAAATGAGCAGCAGGG - Intergenic
921511791 1:216040470-216040492 TAGAAACAAAAATAGCAAGATGG - Intronic
922820973 1:228485594-228485616 TTGACTCAACAATATCAGCAAGG + Intergenic
923205604 1:231755897-231755919 TGGAATCAGAAATACCAGCAAGG - Intronic
923361384 1:233214838-233214860 CAGAATGAATAATAATAGCATGG - Intronic
924618409 1:245635654-245635676 TAGACAAAATAATAGCAGAAAGG - Intronic
1063442131 10:6081344-6081366 GAGAATCAGAAATAGCTGCAAGG + Intergenic
1063693062 10:8305616-8305638 TAGAATGAATAAATGCATCAAGG + Intergenic
1064565532 10:16635488-16635510 CAGAATGTATAGTAGCAGCATGG - Intronic
1066406642 10:35125799-35125821 AGGAATAAAGAATAGCAGCATGG - Intergenic
1068566640 10:58583130-58583152 TAGAATCAACAATAACAACTCGG - Intronic
1068930734 10:62586548-62586570 TAAAATATAAAATAGCAGCAGGG + Intronic
1070217764 10:74404270-74404292 TTTAAACAAAAATAGCAGCAAGG - Intronic
1071068910 10:81669304-81669326 CAGTATCAATAATAGTAGTAAGG + Intergenic
1071130130 10:82381092-82381114 TAAAATAATAAATAGCAGCAAGG + Intronic
1072545030 10:96430578-96430600 TAGAATAAAGAATAACAGCTGGG + Intronic
1074202307 10:111248810-111248832 TACAACCAATAATAGCAACATGG - Intergenic
1079511125 11:21211776-21211798 AAGAATGAATAATAACTGCACGG + Intronic
1080814461 11:35740652-35740674 CAGAATCAAAAATAGAAGCTAGG - Intronic
1085357117 11:75848573-75848595 TCGAATCTATAATAGATGCATGG - Intronic
1086151530 11:83616066-83616088 GAAAATCAATAATAGCAGATAGG - Intronic
1087069007 11:94056639-94056661 GATAATCAATAATAGCACAAAGG - Intronic
1087526608 11:99321720-99321742 TAGAATCAATAATATCATATTGG + Intronic
1088761964 11:112939637-112939659 TAAAAAAAACAATAGCAGCATGG + Intergenic
1090674343 11:128975403-128975425 TTGAATCTATAATAGCAAAATGG + Intronic
1093320628 12:17708909-17708931 TAGTATAAATAATGACAGCATGG + Intergenic
1093545701 12:20344815-20344837 TATACTCAATAATATTAGCATGG - Intergenic
1093993569 12:25617160-25617182 TAAAGTCAATATTAGCAGCTAGG - Intronic
1094537187 12:31332229-31332251 TAAAAGCAATAATAGAAGGAAGG + Intergenic
1095265395 12:40150804-40150826 TAGAATCAATAATTCCTTCAAGG - Intergenic
1097071231 12:56356353-56356375 TGGAATCATTAATGGCAGGAAGG - Intronic
1097160461 12:57043071-57043093 TCGAATCAATGAGAGCATCAAGG - Exonic
1099389224 12:82058336-82058358 CAGAATCAATATTAGAAACAAGG + Intergenic
1099431984 12:82597836-82597858 TAAAATAAATAATAGAAGCAAGG - Intergenic
1100345724 12:93728185-93728207 CGGAAACAATTATAGCAGCATGG + Intronic
1100718735 12:97333072-97333094 TAGAGTCAATTATATCAGCCAGG - Intergenic
1101485745 12:105157301-105157323 AAGAAACATTAAAAGCAGCAAGG + Exonic
1102960825 12:117092361-117092383 CAGAATGAAAAATACCAGCATGG + Intronic
1103930124 12:124445575-124445597 TAGAAGCAATGACAGCAGCGGGG + Intronic
1105969875 13:25418759-25418781 TAGAATCAAATATCGCAGAAGGG + Intronic
1108152465 13:47550708-47550730 TAAAAGCAATAATAGGATCATGG - Intergenic
1108328991 13:49366119-49366141 GAAAATCAAGAATAGAAGCATGG + Intronic
1108833587 13:54510565-54510587 TAGAATCAATGGCAGGAGCAGGG + Intergenic
1109146980 13:58791145-58791167 GAGAATGAAGAATAGTAGCATGG - Intergenic
1109358325 13:61263154-61263176 TAGAATTAAAAATAACAACATGG - Intergenic
1110037078 13:70701253-70701275 TGGAATCAATACTTGCAGAAAGG - Intergenic
1110408598 13:75178952-75178974 TAGAATCATGAACAGCAGGAAGG + Intergenic
1110966441 13:81704201-81704223 TAGAATTAAATATAGCTGCATGG - Intergenic
1112388810 13:98964171-98964193 CAGAATGAATGACAGCAGCAGGG + Intronic
1114326143 14:21590733-21590755 TAAAAACAATAATAGCTGCCAGG + Intergenic
1115053507 14:29093804-29093826 TATAACCTATCATAGCAGCAAGG - Intergenic
1115198175 14:30824626-30824648 AAAAATAAATAATAGCAACAAGG + Intergenic
1116130458 14:40849788-40849810 AAGAAAAAAAAATAGCAGCAGGG + Intergenic
1116580278 14:46632046-46632068 ATGAATCAATAATAACAGAATGG + Intergenic
1120011500 14:79420851-79420873 TAGTAGAACTAATAGCAGCAAGG + Intronic
1121404015 14:93707227-93707249 TATCATCAAAAATAGCAACAGGG - Exonic
1124465672 15:29937112-29937134 TAGAGTCTATAATAGTAGTATGG - Intronic
1127650562 15:61002447-61002469 TCGATTCAATAGAAGCAGCAGGG + Intronic
1130080030 15:80724782-80724804 CAGAATGAATAATAGGAGGAGGG - Intronic
1130327640 15:82894084-82894106 TAGAGGCAAGAATAGCAGAAGGG - Intronic
1133802524 16:9095335-9095357 TAGAACCAATAAAATTAGCAAGG + Intronic
1134478394 16:14596087-14596109 TAGAAGCAATAATATCACCTAGG + Intronic
1134626701 16:15727494-15727516 TAGAATCCAAAATATCAGCTGGG - Intronic
1139584743 16:67894619-67894641 TGTACTCAATAGTAGCAGCATGG - Intronic
1139852094 16:69956997-69957019 TAGAAACAATAATAGAGGCTGGG - Intronic
1139881065 16:70179901-70179923 TAGAAACAATAATAGAGGCTGGG - Intronic
1140371440 16:74415617-74415639 TAGAAACAATAATAGAGGCTGGG + Intronic
1143235858 17:5399363-5399385 TATAATCAAGAATAAAAGCAGGG - Intronic
1143326504 17:6101999-6102021 TAGAATCACTAACAGCAGCTGGG - Intronic
1144217658 17:13070549-13070571 GAGAAGCAATAATGGAAGCAGGG + Intergenic
1144942918 17:18953602-18953624 TAGAACCAATGGCAGCAGCAAGG - Intronic
1145049128 17:19646190-19646212 TAGAGTCAAGAGTAGAAGCAGGG + Intergenic
1150422589 17:65052046-65052068 AAGTATAAATAATAACAGCAAGG + Intronic
1155298676 18:24408968-24408990 TGGAAGCAAGAATACCAGCAAGG + Intergenic
1156242773 18:35269492-35269514 TAGAAAGAATAATATCTGCAGGG + Intronic
1161113216 19:2481315-2481337 TTGAATTAATAATAGCAGCTAGG + Intergenic
1161394964 19:4040252-4040274 TAGCATCAAAAACAGCAGCGAGG + Intergenic
1164009373 19:21185784-21185806 TACAATATATAATAGTAGCAGGG + Exonic
1167525969 19:49983986-49984008 TCATATCAATGATAGCAGCATGG - Intronic
925639306 2:5972014-5972036 AAGAGTCAAAAATGGCAGCAGGG + Intergenic
925803405 2:7625045-7625067 TGGAATGAACAATAGCAGGATGG + Intergenic
926255699 2:11195006-11195028 TAGAATCAAGATTAGAAGGATGG - Exonic
928694623 2:33836768-33836790 TATAAATAATCATAGCAGCATGG + Intergenic
928866353 2:35921638-35921660 TGGAATCACTAATTGCAGCAGGG - Intergenic
930215587 2:48693044-48693066 TATAGTTAATAATAGCACCAAGG - Intronic
931158103 2:59658267-59658289 AAAAATCAATAAAATCAGCATGG + Intergenic
931185193 2:59944137-59944159 TAAAATCAATCATACCATCATGG - Intergenic
933214996 2:79619463-79619485 TAAAATAAATAATGTCAGCAGGG - Intronic
936343374 2:111657027-111657049 CAGAAGTAAGAATAGCAGCAAGG - Intergenic
938192406 2:129295739-129295761 CAGGATCAATAAAAACAGCATGG + Intergenic
940781851 2:157941603-157941625 TAGACTCAATAAAAGCAGTGGGG + Intronic
942645573 2:178107243-178107265 CAGATTCAGTAATAGCAGGAAGG + Intronic
942710143 2:178825260-178825282 TAGAAATAATACTAGCAGCCAGG + Intronic
943059942 2:183031801-183031823 TAGAATCAATAAGACTAGCAAGG + Intronic
943298713 2:186171108-186171130 TAGTAACAAAAACAGCAGCAAGG - Intergenic
943420726 2:187665300-187665322 AAGAATAAATAATAGCCACAGGG + Intergenic
946030152 2:216697170-216697192 TAAAACAAAAAATAGCAGCAAGG + Intergenic
946068641 2:217011898-217011920 TAGAATTTATAGTAGCAGCCGGG + Intergenic
946834617 2:223760626-223760648 TAGATTCCATAAAACCAGCATGG - Intronic
1169644371 20:7793018-7793040 TAGAATGAATAAGAGCAAAAAGG + Intergenic
1169891439 20:10457079-10457101 TAGAATTAATAAGTTCAGCAAGG - Intronic
1171749286 20:29032233-29032255 TATAAACAATAGTAGCATCATGG + Intergenic
1174190172 20:48734902-48734924 TAGACTCAAGAAGAGCAGCCTGG + Intronic
1180393690 22:12309400-12309422 TATAAACAATAGTAGCATCATGG - Intergenic
1180406059 22:12555352-12555374 TATAAACAATAGTAGCATCATGG + Intergenic
1180904498 22:19399224-19399246 AAGAAACAAACATAGCAGCAAGG + Intronic
1183340283 22:37276509-37276531 TAGGATCAAAAATAGCAAGAGGG + Intergenic
1183519382 22:38287763-38287785 TGGAGTCAATGTTAGCAGCATGG + Intergenic
1183735852 22:39644435-39644457 TAGCAGCAATAATAGTAGCAGGG - Intronic
1184363331 22:44031792-44031814 TAAAATCCATACTCGCAGCAGGG - Intronic
949487522 3:4554041-4554063 TAAAATTAATAATAGTAGTAAGG - Intronic
951662952 3:25090794-25090816 TAGAATGAATAATTGCTGTATGG + Intergenic
951860371 3:27245131-27245153 TAGAATGAAGTATAGCAGCCTGG - Intronic
952368349 3:32695022-32695044 TCAAATCAATAATATCAGCATGG - Intronic
952613275 3:35237280-35237302 CAGATTCAATAATAACAGCAGGG - Intergenic
955065627 3:55531490-55531512 TAGCATGAAAAATGGCAGCAAGG - Intronic
955324208 3:57997208-57997230 TAGAAACAAAAATAGCAGTTGGG - Intergenic
956354740 3:68378488-68378510 TAAAATCAAGAATGGCAGAAGGG + Intronic
959034366 3:101343506-101343528 CAAAATCAATAATGACAGCATGG - Intronic
959850124 3:111075569-111075591 AAGAATCACTAATACCAGCCTGG - Intronic
960062944 3:113341875-113341897 AAGAATCAATAATAGAAAAAGGG - Exonic
961846128 3:129765095-129765117 TAGAATCAATAATACAAGCTAGG - Intronic
962205004 3:133427149-133427171 CAGAATCAATAAAACCAGCATGG - Intronic
964424971 3:156542867-156542889 TATAATAAATAATAACAGCTCGG + Exonic
966462187 3:180189065-180189087 GTGAATCAATAATAGGAGAATGG - Intergenic
969831384 4:9800332-9800354 TTTAATTAATAATATCAGCAAGG - Intronic
972144561 4:36006474-36006496 TAGAACTAATAATTGAAGCAAGG + Intronic
973055936 4:45657372-45657394 TAAAAATAATAATAGCAGAATGG + Intergenic
973291274 4:48473216-48473238 TAGAATTTATAATAGTAGCGTGG - Intergenic
979388135 4:120094166-120094188 AAGACTTAATAATAGCAGCTAGG - Intergenic
979878119 4:125919125-125919147 TAGAAACAATAATAAAAGTAGGG - Intergenic
981189541 4:141845356-141845378 CAGAAGCAATAATGGCACCAAGG + Intergenic
981213220 4:142133212-142133234 GAGACTGAATAATAACAGCAGGG - Intronic
981382404 4:144088455-144088477 TATAAACAGTAATATCAGCATGG + Intergenic
983901910 4:173145100-173145122 TAAAATCAATAAAACCAGTATGG - Intergenic
984138480 4:175972061-175972083 AAGAATGAATAGTAGCACCATGG - Intronic
985286281 4:188339357-188339379 TAGTATAAATATTACCAGCAAGG + Intergenic
986125196 5:4878014-4878036 TAGCATCAATAATTGCAGCAAGG - Intergenic
988980173 5:36560484-36560506 TAGAACTAATAATTTCAGCAAGG - Intergenic
989415537 5:41171243-41171265 TAGAATCAAGGACAGCAGCCAGG + Intronic
989791827 5:45413412-45413434 GAGAATAAATAATAGCAATACGG + Intronic
990124756 5:52500668-52500690 TAGAATCAAAAATAGTAGAGAGG - Intergenic
991611542 5:68454743-68454765 TAGCCTCAATAATAGCATTAAGG + Intergenic
991737398 5:69640570-69640592 TAGTATCAAGAAAATCAGCACGG + Intergenic
991760795 5:69915855-69915877 TAGTATCAAGAAAATCAGCACGG - Intergenic
991786536 5:70202246-70202268 TAGTATCAAGAAAATCAGCACGG + Intergenic
991788973 5:70220296-70220318 TAGTATCAAGAAAATCAGCACGG + Intergenic
991813724 5:70495402-70495424 TAGTATCAAGAAAATCAGCACGG + Intergenic
991816854 5:70516686-70516708 TAGTATCAAGAAAATCAGCACGG + Intergenic
991840024 5:70790906-70790928 TAGTATCAAGAAAATCAGCACGG - Intergenic
991878980 5:71202631-71202653 TAGTATCAAGAAAATCAGCACGG + Intergenic
991881420 5:71220660-71220682 TAGTATCAAGAAAATCAGCACGG + Intergenic
992846646 5:80756042-80756064 TAGAATAAAAAATATGAGCATGG + Intronic
993070949 5:83162848-83162870 GAGACTCCAAAATAGCAGCAGGG - Intronic
993137879 5:83993076-83993098 TAGAATAAATAATTCCAGCAAGG + Intronic
993427643 5:87788061-87788083 TAAAACCAACAATAGCAGCATGG + Intergenic
994746855 5:103688883-103688905 TAAAGGCAATACTAGCAGCAAGG - Intergenic
994945088 5:106377389-106377411 TGGAATCAATAATTGGAGTAAGG - Intergenic
995797170 5:115953822-115953844 AAGAATAAATAGTAGCAGCTGGG - Intergenic
995939513 5:117564445-117564467 AAAAATCAATAATAAAAGCATGG - Intergenic
996758434 5:126961016-126961038 TAATATAAATAATAGAAGCATGG - Intronic
997304388 5:132827099-132827121 GAGAAGCAAGAATAGAAGCAGGG - Intronic
999349234 5:150851394-150851416 TAGCATAAATAAGAGCATCAGGG + Intronic
1005802197 6:29438399-29438421 TAGAATCAATAAAACCTGCAAGG + Intronic
1006288934 6:33119229-33119251 CAGAATTAATAATTGCAGGAAGG - Intergenic
1007060159 6:38932686-38932708 TAGAAATAATAAGAGCAGCAAGG + Intronic
1007216627 6:40245084-40245106 TATAATCAAAAGCAGCAGCAAGG + Intergenic
1008175263 6:48260977-48260999 TAGAAAAAAGAAAAGCAGCAAGG + Intergenic
1008492297 6:52099001-52099023 TAAAATAAATCATACCAGCAGGG + Intergenic
1009509647 6:64533439-64533461 CAGAAAAAATAAAAGCAGCAGGG + Intronic
1009632706 6:66219878-66219900 TATAATAAATAATACCAGGAAGG - Intergenic
1011296058 6:85827348-85827370 TAGCATCAATAGTAGTAGTAGGG - Intergenic
1011322236 6:86108347-86108369 TTGAATCAAGAATAGCATAATGG - Intergenic
1014648736 6:124008653-124008675 TAGAAGCAAGAAGATCAGCAAGG - Intronic
1015438447 6:133218609-133218631 GAGAATTAATAATTTCAGCAAGG - Intergenic
1016039900 6:139422240-139422262 AAGAGTCAATAGTAGCAACACGG - Intergenic
1016387212 6:143540145-143540167 TGGAATCAAAAATAGGAGCAAGG - Intronic
1016442942 6:144103173-144103195 TACAATTAAAAATTGCAGCACGG - Intergenic
1017292565 6:152757537-152757559 TTCAATTAATAAAAGCAGCATGG - Intronic
1018183549 6:161245138-161245160 TGGAATAAATAAATGCAGCAGGG + Intronic
1021568782 7:22043316-22043338 TAGAATCAACCATTTCAGCAAGG - Intergenic
1022833100 7:34088034-34088056 TAGAATCATTAAGGGCAGAAGGG - Intronic
1023638283 7:42235678-42235700 TAGAACTAATAATACCAGCCCGG + Intronic
1023679174 7:42666530-42666552 AAAAATAAATAAAAGCAGCATGG + Intergenic
1026077477 7:67185516-67185538 AAGAATCAAGAATAGCACCTGGG + Intronic
1026291998 7:69015678-69015700 AATAATCAATAATATCAGAATGG + Intergenic
1026484209 7:70803995-70804017 TAGAATGAATAAAACCTGCAGGG + Intergenic
1026699393 7:72626635-72626657 AAGAATCAAGAATAGCACCTGGG - Intronic
1027535495 7:79394666-79394688 TAGAATGAAGAAAAGAAGCATGG - Intronic
1029447854 7:100624473-100624495 TAGCTGCAATAAAAGCAGCATGG - Intronic
1030559823 7:111070872-111070894 TTGAATTAATAATAGTACCAAGG - Intronic
1031192830 7:118576563-118576585 TTGCATCAGTAGTAGCAGCATGG + Intergenic
1031280270 7:119791065-119791087 TAGAACAAATAATAGCCCCATGG + Intergenic
1031572092 7:123371721-123371743 CAGAATCAAGGATGGCAGCAAGG + Intergenic
1032213654 7:129939445-129939467 TAGATTCAAGAATAGCAAAAGGG + Intronic
1037343355 8:17871150-17871172 TAGAGTGTATAAGAGCAGCAAGG + Intronic
1038389894 8:27186979-27187001 GAAAATTAATAATCGCAGCAAGG + Intergenic
1038431305 8:27502413-27502435 TACACTCACTAATAGCAGAATGG - Intronic
1039292939 8:36117674-36117696 TAGAATCTATAATACTAGAATGG + Intergenic
1040885044 8:52253394-52253416 AAGAATAAATAATACCAGAAGGG - Intronic
1041429008 8:57757770-57757792 TAGCATCAGTAATGGTAGCAAGG + Intergenic
1042256693 8:66811633-66811655 TAGAAACACTTAGAGCAGCATGG + Intronic
1042998200 8:74724671-74724693 TAGAACCAAAAATGTCAGCATGG - Intronic
1043747503 8:83893805-83893827 TAGAATAAATAATAGAATAAAGG - Intergenic
1044296620 8:90535295-90535317 TAGAAACAAGCATTGCAGCACGG + Intergenic
1044809638 8:96045253-96045275 TACAATGAATAATTGGAGCAAGG - Intergenic
1045640323 8:104242993-104243015 TGGAATCAATGATATAAGCAAGG - Intronic
1046504055 8:115114520-115114542 TAGAATTCATGTTAGCAGCATGG - Intergenic
1047692030 8:127365768-127365790 TAGAATCTGTAGTAGTAGCAAGG - Intergenic
1050280217 9:4042780-4042802 TAGTGACAATAAAAGCAGCAAGG + Intronic
1051123174 9:13774074-13774096 TCAAATGAATAATAGCAGAATGG + Intergenic
1054867992 9:70022795-70022817 TGGAATCAAGAATAGCCGAATGG - Intergenic
1055624533 9:78161592-78161614 TCTAATCAACAATAGAAGCATGG - Intergenic
1055941985 9:81659226-81659248 TCCAATCAAGAATAGAAGCATGG - Intronic
1056023783 9:82469481-82469503 TCTAATAAATAATTGCAGCAAGG + Intergenic
1056682971 9:88735963-88735985 TAGAAGCGATAATAGTAGCTGGG + Intergenic
1057916241 9:99057740-99057762 TAGCAGCAATAATAGCATGAAGG + Intronic
1058015572 9:100028706-100028728 TAGCATCAATACTTGCAGAATGG + Intronic
1058383611 9:104407558-104407580 TAGAGTCAATACTAGAGGCAAGG - Intergenic
1059879629 9:118675913-118675935 TAGAAGCAATATTAGAACCATGG - Intergenic
1059996785 9:119918333-119918355 ATGAATCAATAGTAGGAGCAGGG - Intergenic
1060775801 9:126373342-126373364 TAAACTCAATAAGAGCAGCGTGG - Intronic
1061683840 9:132259050-132259072 TATAATAAATAATGGCTGCAGGG + Intergenic
1186926972 X:14344213-14344235 TAGAATCAATCATTTCACCAAGG - Intergenic
1188071322 X:25721411-25721433 TACAATGAATAATTGCATCAGGG + Intergenic
1188470002 X:30527951-30527973 TAGAAACAATAGTAGATGCAAGG - Intergenic
1190554695 X:51621984-51622006 TAGAAGAATTAATATCAGCAAGG - Intergenic
1190886006 X:54531272-54531294 TAGAATCACTAAATGTAGCAAGG + Intronic
1192375392 X:70555097-70555119 TAGAATCAATAATAGCAGCAGGG - Intronic
1193677751 X:84477533-84477555 TAAATTCAGTAATAGCAGCAAGG + Intronic
1194012858 X:88583968-88583990 CAGGATCAATAAAGGCAGCAAGG + Intergenic
1195145715 X:102014935-102014957 TAGAAACAATATCAGAAGCATGG + Intergenic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197922209 X:131607366-131607388 AAGAATCAACAGTAGGAGCAGGG - Intergenic
1199462279 X:148098027-148098049 TAGAATCAAATGTAGCAGGAAGG + Intergenic
1200386830 X:155900764-155900786 TAGAATGAAGAATAGTTGCAAGG - Intronic