ID: 1192382391

View in Genome Browser
Species Human (GRCh38)
Location X:70631797-70631819
Sequence AATCAGAAGACTGTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 2, 1: 0, 2: 2, 3: 40, 4: 374}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192382388_1192382391 -3 Left 1192382388 X:70631777-70631799 CCATCATGTCACTTCCTCCGAAT 0: 2
1: 0
2: 1
3: 4
4: 124
Right 1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG 0: 2
1: 0
2: 2
3: 40
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192382391 Original CRISPR AATCAGAAGACTGTGTGTTG TGG Intronic
900465626 1:2824044-2824066 AACCAGCAGGCTGTGTGTCGGGG - Intergenic
900981434 1:6048315-6048337 AGCCAGAAGACAGTCTGTTGGGG - Intronic
904508845 1:30984462-30984484 AAACAAAATACTGTGAGTTGGGG + Intronic
905545442 1:38794677-38794699 AATCAGAAGTCTGGTTGCTGGGG + Intergenic
906842910 1:49159522-49159544 AATCTGACGATTGTGTCTTGGGG + Intronic
906993750 1:50767497-50767519 AATCTGAAGACTATGTGTCTTGG - Intronic
908647493 1:66294392-66294414 AATTAGAAAATTGTGTTTTGTGG - Intronic
909240498 1:73206631-73206653 AATCTGAAGACTATGTGTCTTGG - Intergenic
909255296 1:73413103-73413125 CAAAAGAATACTGTGTGTTGTGG - Intergenic
909380813 1:74996419-74996441 AATAATAAGACTGTGGGTAGTGG - Intergenic
910375028 1:86559008-86559030 AATCTGATGATTGTGTCTTGGGG + Intronic
911327970 1:96491469-96491491 ATTCAAAAGACAGTGTGTTGAGG - Intergenic
911705996 1:101013794-101013816 AACAAGATCACTGTGTGTTGTGG + Exonic
911944387 1:104087543-104087565 AATCAGAAGACTATGTGGTCTGG - Intergenic
912639243 1:111329305-111329327 AATCTGATGATTGTGTCTTGGGG + Intergenic
913212935 1:116596511-116596533 CATCAGCAAACTGTGTCTTGAGG + Intronic
913431000 1:118790429-118790451 AATCTGATGATTGTGTCTTGGGG - Intergenic
914835145 1:151200373-151200395 AAGCAGTAGATTGTGTGTAGGGG + Intronic
916000502 1:160610808-160610830 AAGCAGAAGTCTGTGAGTAGAGG + Intronic
916363016 1:163991820-163991842 AATCTGACGATTGTGTCTTGAGG - Intergenic
916544849 1:165794218-165794240 AATTATAATACTGTGTGATGTGG - Intronic
916674320 1:167053550-167053572 GCTCAGAAGACTGTGCCTTGTGG + Exonic
916879251 1:169003550-169003572 TATGAAAAGACTGTGTGTTCAGG + Intergenic
917091908 1:171361222-171361244 AATCCGATGATTGTGTGTTTTGG - Intergenic
917455532 1:175182673-175182695 ATTCAGAAGCCAGTGTGTGGTGG - Intronic
917821283 1:178766704-178766726 AATCGGATGACTGTGTGTCTTGG + Intronic
918272966 1:182921057-182921079 AATCTGATGACTATGTCTTGGGG - Intronic
919982524 1:202651120-202651142 AATGAGAAGAGGGAGTGTTGCGG + Intronic
920841684 1:209560777-209560799 AAGCATAAGACAGTGTGTTGGGG - Intergenic
921273567 1:213493984-213494006 AATCAGAAATCTGGGTGTAGAGG + Intergenic
921307998 1:213816489-213816511 AATCAGAAGTCAGTGTGGCGAGG - Intergenic
1063141003 10:3256623-3256645 AATCTGAACATTGTGTGTTTGGG - Intergenic
1064093071 10:12401791-12401813 AATGAGAAGACGGTCTGTTTTGG + Intronic
1064633478 10:17340900-17340922 GATATGAAGACTGTGTGTGGAGG - Intronic
1064666395 10:17656527-17656549 AATCAGAAGACTCTTTTCTGGGG - Intronic
1064913188 10:20426171-20426193 AATCCGATGACTGTGTGTCTTGG + Intergenic
1065650045 10:27878372-27878394 AAACAGAAAACTGGGTGTTTTGG + Intronic
1065829495 10:29601794-29601816 AATCAGAAGCCTGCATGGTGCGG - Intronic
1066440656 10:35435712-35435734 AATCAGAAGCTTTTGTGTTGAGG + Intronic
1068053442 10:51981771-51981793 AATCTGATGACTGTGTGTCTTGG + Intronic
1068717579 10:60205321-60205343 AATCAGACGACTTTTTGTTGCGG + Intronic
1068832997 10:61519418-61519440 AATCTGATGACTGTGTGTCTTGG + Intergenic
1068922596 10:62500298-62500320 AATCAGAAGACTGTGTGTTGTGG + Intronic
1069207217 10:65705938-65705960 TATCTGAATAATGTGTGTTGAGG + Intergenic
1069670029 10:70194505-70194527 AATCTGAGGACTATGTGTTTTGG + Intergenic
1070003234 10:72396965-72396987 AATCTGACAACTGTGTCTTGGGG - Intronic
1070200925 10:74205386-74205408 AATTAGAAGACTGGGCGTGGTGG + Intronic
1070360349 10:75682413-75682435 AACCAGAAGAGTGTGTGTGGGGG + Intronic
1071285093 10:84137220-84137242 AATAAGTAGGCTGTGTGTGGTGG - Intergenic
1072026992 10:91469286-91469308 AATCTGAGGACTGTGTGTCTTGG - Intronic
1072474133 10:95742560-95742582 AATGGGAATATTGTGTGTTGTGG + Intronic
1076645023 10:131947397-131947419 GATCAGAAGACCTAGTGTTGAGG + Intronic
1076716186 10:132365154-132365176 AATAAGAATAGTGTGTGTTCTGG + Intronic
1077259146 11:1606434-1606456 AATCAGAAGTCTGTGTAGGGAGG + Intergenic
1077280797 11:1744492-1744514 CATCAGGAGACAGTGTGTGGAGG + Intronic
1079490633 11:20985507-20985529 AATCATAAAGCTGTGTGATGAGG + Intronic
1080307255 11:30850135-30850157 TATCAGAAGACTGTGTTGTAAGG - Intronic
1080372390 11:31666294-31666316 AATCTGAAGGCTGGGTGTGGTGG - Intronic
1081293196 11:41351526-41351548 AATCTGATGACTATGTGTTTTGG - Intronic
1083635596 11:64119195-64119217 AGTAAGTAGACCGTGTGTTGGGG + Intronic
1085321534 11:75577145-75577167 AATCAGAAGGCTGGGTGCGGTGG - Intergenic
1085614446 11:77985155-77985177 AATTAGAAGACTGTAAGTTTGGG - Intronic
1085731548 11:79003334-79003356 AATATGAAGACTGTGTGTCTTGG - Intronic
1087620042 11:100530218-100530240 AATCTGATGATTATGTGTTGTGG - Intergenic
1087856282 11:103095350-103095372 AAGCAGAAGCCTGTGTGTTCTGG + Intergenic
1088944842 11:114500915-114500937 AATCAGTTGAGTGTGTTTTGTGG + Intergenic
1090754274 11:129775003-129775025 AAACAGAGGACTGGGTGTGGTGG - Intergenic
1091399059 12:171827-171849 AAGCTGAAGACTGTCTGTGGTGG + Intronic
1091808619 12:3376482-3376504 AATCAGGAGACTGAGAGTTGGGG + Intergenic
1092575719 12:9780865-9780887 AATCTAATGACTATGTGTTGAGG + Intergenic
1092754859 12:11753690-11753712 AATCAGATGACTGTGATATGGGG + Intronic
1093559919 12:20525827-20525849 AATCAGAAAACTGTGCAATGAGG + Intronic
1094024291 12:25946055-25946077 AATCTGGAGACTGTGTCTTCTGG - Intergenic
1095654029 12:44648420-44648442 AAGCAGAAGCCTGTGGTTTGAGG + Intronic
1096772774 12:53946754-53946776 ACTCAGATGAGTGTTTGTTGAGG + Intergenic
1096862791 12:54542023-54542045 AATTAGAAGCCTGTGTGCTGCGG - Intronic
1096925239 12:55136696-55136718 AATCTGATGACTATGTATTGTGG - Intergenic
1097683048 12:62667382-62667404 AATCAGAAGTCAGTTTGTTAGGG - Intronic
1097781240 12:63707488-63707510 AAACAGAAGACTGAGTGGTCTGG + Intergenic
1097847799 12:64384294-64384316 AATCAGAAGACAGTATTTTGTGG + Intronic
1098654574 12:73012011-73012033 AATCTGAAGACTATGTGATGAGG + Intergenic
1099031010 12:77525446-77525468 AATCTGAAGATTGTGTGTCTTGG - Intergenic
1099330085 12:81273772-81273794 AATAATAAGACTGTGGGATGTGG - Intronic
1099467314 12:83003823-83003845 AACCTGATGACTGTGTCTTGGGG + Intronic
1100060520 12:90569484-90569506 AATGAGATGACTGTGTGCAGTGG - Intergenic
1102621039 12:114194578-114194600 AATCAGAAGGCAGTGCGGTGTGG + Intergenic
1103663404 12:122540881-122540903 AATGAGCAGGCTGTGTGTGGTGG + Intronic
1103842353 12:123875518-123875540 AACCGGAAGACCTTGTGTTGGGG + Intronic
1103862588 12:124026464-124026486 AAGCAGAAGTCAGAGTGTTGGGG - Intronic
1104472979 12:129045504-129045526 AACCAGGAGAACGTGTGTTGAGG + Intergenic
1104492278 12:129204709-129204731 AATCTGATGATTGTGTCTTGGGG - Intronic
1105216179 13:18287110-18287132 CATCAGCAAACTGTGTCTTGAGG + Intergenic
1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG + Intergenic
1106268407 13:28130804-28130826 AATAAGAAAACTGTGTATTAGGG - Intergenic
1106443663 13:29802987-29803009 AATCTGATGACTGTGTGTCTTGG - Intronic
1107447418 13:40481309-40481331 AATCAGAAGAGTCTGTGCTGTGG + Intergenic
1108276143 13:48811696-48811718 AAAAAGAAGTATGTGTGTTGTGG - Intergenic
1108502613 13:51081889-51081911 AAGCAGAAGACAGTCTGTAGCGG + Intergenic
1109060544 13:57613180-57613202 AATCAGGAGAATGTGTGATGAGG - Intergenic
1109558705 13:64018010-64018032 AATAAGAAAACTGTGGGTGGAGG - Intergenic
1109629354 13:65024289-65024311 AATCTGATGACTATGTGTTTTGG + Intergenic
1111676421 13:91394816-91394838 AACAAGAAGATGGTGTGTTGTGG + Intergenic
1111998253 13:95186278-95186300 CATCAGAAGAATCTGGGTTGGGG + Intronic
1116736060 14:48693464-48693486 AATCAGAAGAATATGAGTCGAGG - Intergenic
1117837624 14:59823730-59823752 AATCTGATGACTGTGTGTCTTGG + Intronic
1118646464 14:67845879-67845901 AATCTGATGACTGTGTCCTGGGG + Intronic
1120283246 14:82465158-82465180 AATCTGAAGAGTATGTGTTTTGG - Intergenic
1121647383 14:95528304-95528326 TATCAAAAGACTGGGTGTGGTGG - Intergenic
1122709229 14:103643318-103643340 AATGGGATGACTGTGTGTGGAGG + Intronic
1125444788 15:39742731-39742753 AATTAGGTGAATGTGTGTTGAGG - Intronic
1126377217 15:48008345-48008367 AATCAGAAGAGAGTCTTTTGAGG + Intergenic
1126595822 15:50383464-50383486 ACACAGAAGTCTGTGTGTGGTGG + Intergenic
1127623503 15:60757582-60757604 AATCAGAAGACGGATTGTTTGGG - Intronic
1128329841 15:66748280-66748302 TATCAGAAGAGTTTGTGTGGAGG + Intronic
1128850743 15:70953578-70953600 AATCTGATGACTGTGCTTTGGGG + Intronic
1129129767 15:73483344-73483366 ACTGAGAAGACTGTGCGTTCTGG - Intronic
1130219438 15:82006744-82006766 AATCAGAAGATTTTGAGATGAGG + Intergenic
1131601185 15:93850624-93850646 AAGCAGAAGAGTGTGGGTAGGGG - Intergenic
1132244983 15:100287567-100287589 AATCTGATGACTGTGTGTCTTGG - Intronic
1132984408 16:2756783-2756805 AATGAGAAGGCTGTGTGTCTGGG + Intronic
1134249490 16:12564439-12564461 GATCAGAAAGCTGTGTTTTGGGG + Intronic
1134477408 16:14587619-14587641 AATTAGAAGGCTGGGTGTGGTGG - Intronic
1136121593 16:28139565-28139587 AATTAGAACACTGTCTGGTGGGG + Intronic
1138399202 16:56731696-56731718 AAACAGAAGACTGGGTGTGGTGG - Intronic
1140785237 16:78335087-78335109 AATCAGAAGCTTGTGGGGTGGGG + Intronic
1144270581 17:13611604-13611626 AAGCAGAAAACTCTGTGATGGGG + Intergenic
1146092247 17:29891091-29891113 AATCAGAGGAGTGTATGTTCAGG - Intronic
1146274623 17:31508854-31508876 TATCAGCAGTGTGTGTGTTGGGG + Intronic
1148271525 17:46265776-46265798 AATCAGAAGGTTGCCTGTTGAGG - Intergenic
1149133515 17:53337416-53337438 AATCTGATGACTATGTCTTGGGG - Intergenic
1149352610 17:55806432-55806454 CAAAACAAGACTGTGTGTTGGGG + Intronic
1149362916 17:55912817-55912839 AATCTGATGACTGTGTGTTTTGG + Intergenic
1149525900 17:57355565-57355587 ATTCAGGAGTCTGTGTTTTGAGG - Intronic
1152075246 17:78155449-78155471 AAAAAGAATACTGTGTGGTGGGG - Intronic
1152253235 17:79222673-79222695 AATGACAAGGCTGTGTGTGGGGG - Intronic
1152341059 17:79725197-79725219 ATTCAGAAGAATGTGCATTGTGG + Intergenic
1152854241 17:82655013-82655035 AAGTAGAAGACTGTGTGTTTGGG - Exonic
1153419152 18:4884965-4884987 AATCTGAAAATTATGTGTTGTGG + Intergenic
1153461944 18:5345141-5345163 AATCTGAAGACTATGTGTCTTGG - Intergenic
1153533884 18:6079278-6079300 ACCCAGACCACTGTGTGTTGGGG - Intronic
1155904188 18:31429383-31429405 AAGCAAACTACTGTGTGTTGGGG - Intergenic
1158100094 18:53820740-53820762 AATCAGATGACTATGTGTCTTGG - Intergenic
1158142884 18:54275170-54275192 AATCATAAGGCTGGGTATTGTGG + Intronic
1158894283 18:61898565-61898587 ATTATGAAGTCTGTGTGTTGGGG + Intergenic
1158965174 18:62616384-62616406 ACTCAGAAGGCGGTGGGTTGGGG - Intergenic
1159079604 18:63722408-63722430 AATGAGAAGTCAGTGTGCTGAGG + Intronic
1159324615 18:66898306-66898328 AATCATGAGACTGTATTTTGTGG + Intergenic
1160320984 18:77895153-77895175 GATCAGAACACTCTGAGTTGGGG + Intergenic
1162678153 19:12316121-12316143 AATCTGAAGGCTGGGTGTGGTGG + Intergenic
1162848247 19:13410852-13410874 AATCAGAAGAATGTGGGTGCTGG - Intronic
1162996947 19:14342180-14342202 AAACAGAAGGCTGAGTGTAGTGG - Intergenic
1163244333 19:16083600-16083622 AAGCAGCAGTCTGTGTGTGGTGG + Intronic
1164216180 19:23151316-23151338 AATCAAAAGGCTGTGTATGGTGG + Intergenic
1165001631 19:32768254-32768276 AATCTGAAGTCTCTGTGCTGGGG - Intronic
1165639919 19:37375833-37375855 AACCAGAAGAGTGTGGGTTCTGG + Intronic
1166908824 19:46136047-46136069 AATCTGATGACTGTGTCTTGGGG + Intergenic
1167350893 19:48974012-48974034 AACTAGAAGACTGGGTTTTGAGG - Intronic
1168449930 19:56458495-56458517 AATGAGAAGACTGTGACTGGGGG + Intronic
925005704 2:441555-441577 AATTACAGAACTGTGTGTTGAGG + Intergenic
925315462 2:2919453-2919475 CATCAAAAGACAGTATGTTGCGG - Intergenic
925500685 2:4501069-4501091 AGGCAGAAGACTGGGTTTTGTGG - Intergenic
925682908 2:6441852-6441874 AAGCCGAAGATTGTGTGTTTAGG - Intergenic
925872287 2:8281863-8281885 TTTCAGAAGATTGTGGGTTGAGG - Intergenic
926025095 2:9535223-9535245 AATGAGAAGACTCTGGGTGGTGG - Intronic
926475195 2:13313417-13313439 AATCTGAAGATTATGTGTTTTGG + Intergenic
926655769 2:15404026-15404048 AATCAGAGGGCTGTGTGTGGTGG - Intronic
928075421 2:28260181-28260203 ATTCAGAAGGCTGGGTGTGGTGG - Intronic
928081026 2:28312434-28312456 AATCAGTAGGCTTTGAGTTGGGG - Intronic
928476026 2:31628899-31628921 AATCCGATGACTGTGTGTCTTGG + Intergenic
929343365 2:40850298-40850320 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
929967712 2:46548011-46548033 ACTCAGGAGGATGTGTGTTGGGG + Intronic
931630672 2:64295729-64295751 AATCAGAAAGCTGTGGGTTGGGG + Intergenic
932747639 2:74347243-74347265 AATCAGAACACAGTGGTTTGAGG - Intronic
932844180 2:75118048-75118070 AATTAGAAGAGTGTGTGTTTTGG - Intronic
933408752 2:81897597-81897619 AAACACAAGACTGAGTGTTTAGG - Intergenic
934077153 2:88438179-88438201 AATTAGATGACTGGGTGTGGTGG + Intergenic
934298148 2:91759615-91759637 CATCAGCAAACTGTGTCTTGAGG - Intergenic
935649411 2:105369483-105369505 AATAAGCAGGGTGTGTGTTGGGG + Intronic
935724601 2:106012251-106012273 AATCAGCAGACAGTATGTCGGGG + Intergenic
935871562 2:107456101-107456123 AATCTGAGGACTGTGTCTTGGGG - Intergenic
936174106 2:110204251-110204273 AATCACAACACTCTGTCTTGAGG - Intronic
937719898 2:125081931-125081953 GATTAGAAGACTGAGTGTTATGG + Intergenic
938190766 2:129278188-129278210 ATACAGAATACTGTGTGTTATGG + Intergenic
938708000 2:133950556-133950578 AAACAAAAGGCTGTGTGATGTGG + Intergenic
939878789 2:147606753-147606775 AATCAGAAAATAATGTGTTGGGG + Intergenic
940072762 2:149707912-149707934 AAACAGGATACTGTGTGATGAGG - Intergenic
942064608 2:172258630-172258652 AATTAGAAAACCGTCTGTTGAGG - Intergenic
942162764 2:173209340-173209362 TAACAGTAGACTGTGTGTGGTGG - Intronic
942741574 2:179186659-179186681 TATCAGAAGACTGTATTTTCAGG + Intronic
943147523 2:184064590-184064612 AATCTGATGATTGTGTTTTGGGG + Intergenic
943232949 2:185279196-185279218 AATGAGAAGGTTGTGTGTTTTGG + Intergenic
944471275 2:200055723-200055745 AATCTGATGACTGTGTGTCTTGG - Intergenic
945037016 2:205712767-205712789 AACCAGAAGACTGGAAGTTGGGG + Intronic
945244102 2:207702471-207702493 AATGAGCAGACTGTGTGCTATGG - Intergenic
945267822 2:207908618-207908640 TATCAGAAAAATGTGTGTTATGG - Intronic
948053996 2:234997833-234997855 AATCAGAAGACTGGGTGCGGTGG + Intronic
948614980 2:239192636-239192658 ATTCACGAGACTGTGTGTTCAGG - Intronic
948773700 2:240268598-240268620 AATCTGATGACTATGTGTTTTGG + Intergenic
1169637870 20:7714735-7714757 AGCCAGGACACTGTGTGTTGGGG + Intergenic
1170138998 20:13106533-13106555 AATCAGGAGGCTGTGTGTTGGGG + Intronic
1170611634 20:17918519-17918541 ACGCAGAAGACTGTGTGTTGTGG + Intergenic
1170720278 20:18871860-18871882 AATCTGATGATTGTGTCTTGAGG + Intergenic
1171070475 20:22063212-22063234 AATCAGCAGCCTGTATGGTGTGG - Intergenic
1171103712 20:22411676-22411698 GATAAGAAGTCTGTGTGTGGGGG + Intergenic
1172318362 20:33974691-33974713 AATAAGAAGGCTGGGTGTGGTGG - Intergenic
1173411939 20:42819083-42819105 AATCTGATGACTGTGTGTCTTGG - Intronic
1176871659 21:14087485-14087507 ACACAGAAGACTGTGTTATGTGG + Intergenic
1178049502 21:28732503-28732525 AGGCAGAATACTGTGGGTTGTGG + Intergenic
1179253734 21:39697223-39697245 AATGAAAAGTGTGTGTGTTGGGG + Intergenic
1181260452 22:21593515-21593537 AGGCAGAAGACTGTGAGATGGGG - Intronic
1181430773 22:22880539-22880561 AATGAGAATTCTGTGTGCTGAGG + Intronic
1182509974 22:30812139-30812161 AATGAGAAGGCTGGGTGTGGTGG - Intronic
1184558054 22:45243954-45243976 AATCAAAAGGCTGTGTGCTGTGG + Intergenic
949640865 3:6034869-6034891 AATCTGACGACTGTGTGTCTTGG + Intergenic
950848771 3:16042292-16042314 AATCTGATGACTGTGTCTTGGGG + Intergenic
950948263 3:16973388-16973410 AATCTGATGACTGTGTCTTGGGG + Intronic
951724646 3:25743630-25743652 AAGCAGAACACTAAGTGTTGGGG - Intronic
953240904 3:41148568-41148590 ACTCAGAAGACTGTGTCTCCAGG + Intergenic
954329148 3:49880173-49880195 ACTCAGAAGGCTGAGTGGTGAGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
956667950 3:71659733-71659755 AATCAGAAGACTGTGGGTATAGG - Intergenic
957254872 3:77824296-77824318 AATCTGATGACTATGTGTTTTGG + Intergenic
958110621 3:89138975-89138997 AAACAAAAGAGTGTGTGTTGGGG + Intronic
958460399 3:94387151-94387173 AATCTGATGACTGTGTGTCTTGG - Intergenic
958615788 3:96492345-96492367 AATTCAATGACTGTGTGTTGGGG + Intergenic
959452879 3:106524557-106524579 AATCAGATGATTATGTGTTTTGG - Intergenic
959694645 3:109235846-109235868 AATCTGATGATTGTGTCTTGGGG - Intergenic
960353078 3:116617362-116617384 GATAAGAACACTGTGTCTTGAGG - Intronic
960754815 3:121000067-121000089 AATCTGATGACTGTGTGTTTTGG + Intronic
961054566 3:123777357-123777379 AATCAAGAAACTCTGTGTTGTGG - Intronic
962001554 3:131303809-131303831 AATCTGAGGACTGTGTCTTGGGG + Intronic
962650749 3:137487454-137487476 AATGAGAAGAATGTGTATTCAGG + Intergenic
963094753 3:141524250-141524272 AATCAGGAGACCATGTGGTGAGG - Intronic
963280777 3:143383216-143383238 CATCAGAAGTCTGTGGGTAGTGG - Intronic
964007596 3:151850727-151850749 AATCTGATGATTATGTGTTGTGG + Intergenic
964215873 3:154281437-154281459 ATTTAGAAGACTGAGTATTGAGG - Intronic
965155400 3:165046146-165046168 AAACACAAGATTGTGTGTGGGGG + Intronic
966092255 3:176154314-176154336 AATCAGAAAACTGTTTGGAGAGG - Intergenic
967718708 3:192792121-192792143 AAACTGAAGACTGTGAGGTGTGG - Intergenic
968294870 3:197568232-197568254 AAACAGAAGACTGTGGGGTTTGG - Intronic
968315870 3:197724890-197724912 GATCAGTAGACTGGGTGTGGTGG + Intronic
969802412 4:9579205-9579227 AAGCAAAAGACTGTTTGTTTGGG - Intergenic
970289950 4:14561252-14561274 AAAATGAAGACTGTGTGATGAGG - Intergenic
971096255 4:23407847-23407869 AATCTGATGACTGTGTGTTTTGG + Intergenic
971340791 4:25766845-25766867 AATCAGAAGCCGGTGGGTAGAGG + Intronic
972459007 4:39282056-39282078 AATCAAAAGAGAGTTTGTTGTGG - Intronic
975137630 4:70889971-70889993 AAACAGATGACTGGGTGTGGTGG + Intergenic
975296387 4:72739178-72739200 AATCTGATGACTGTGTCTTGGGG - Intergenic
975899992 4:79140327-79140349 ATTCTGATGACTGTGTGTTATGG + Intergenic
975909443 4:79249794-79249816 AATCTGATGACTGTGTGTCTTGG - Intronic
976506696 4:85855417-85855439 AATCTGATGACTGGGTGTGGTGG + Intronic
976683081 4:87778999-87779021 GATGAGAAGACTGAGGGTTGGGG + Intergenic
976756207 4:88500440-88500462 AAGCAGAAGCATGTGTGGTGGGG - Intronic
976850106 4:89535263-89535285 AATCTGATGACTGTGTGTCTTGG + Intergenic
976936874 4:90646961-90646983 AATGAAAAGGATGTGTGTTGGGG - Intronic
977445386 4:97125013-97125035 AATCTGATGACTCTGTGTTGTGG - Intergenic
977979332 4:103304671-103304693 AATCTGAAGACTATGTGTCTTGG + Intergenic
978205555 4:106076550-106076572 AATCTGATGACTGTGTGTCTTGG - Intronic
979211907 4:118114824-118114846 AAGGAGATGACTGTCTGTTGGGG + Exonic
979314634 4:119247315-119247337 AATGAGAAGACTTTGAGGTGGGG - Intronic
979682888 4:123481002-123481024 AATGAGAAGACTCTGTCTGGGGG - Intergenic
979723207 4:123927956-123927978 AATCTGATGACTGTGTGTCTTGG - Intergenic
981401962 4:144323404-144323426 AATCTGATGACTGTGCCTTGGGG - Intergenic
981559089 4:146027463-146027485 GATCACAAGACCTTGTGTTGTGG - Intergenic
981679139 4:147374767-147374789 AATAAGTAGACTGTATTTTGTGG + Intergenic
981893535 4:149768299-149768321 TATCAGCAGATTGTGTGATGTGG - Intergenic
982570711 4:157047972-157047994 TATCAGATGACTGTATGTGGGGG - Intergenic
982641616 4:157968876-157968898 TATGAGAAGGCTGGGTGTTGTGG - Intergenic
983229908 4:165119026-165119048 ATTCATAATGCTGTGTGTTGAGG + Intronic
983454527 4:167945942-167945964 AATCAGTAGACTGAGTGATATGG - Intergenic
984079724 4:175232252-175232274 ATACAGAATACTGTGTGTTGAGG + Intergenic
984680392 4:182601627-182601649 AATCAGATGACAGTTTGTTAAGG + Intronic
984836060 4:184022372-184022394 AATCACAGGACTGTGTGTTAGGG - Exonic
986478937 5:8165089-8165111 GATCTGAAGACTATGTGTTTTGG + Intergenic
987113266 5:14706869-14706891 CATCAGAGGACTGTGTGTGAGGG + Exonic
987528033 5:19079139-19079161 AATCTGAAGATTATGTGTTTTGG + Intergenic
987583665 5:19826410-19826432 AATCTGATGACTGTGTCTTAGGG - Intronic
987842986 5:23244790-23244812 ATTCATAAAAGTGTGTGTTGGGG - Intergenic
988858527 5:35252791-35252813 AGGCAGAGGACTGTGTGTGGGGG + Intergenic
990167969 5:53016544-53016566 AATCCGATGACTATGTGTTTTGG + Intronic
990247805 5:53880955-53880977 AATCAGAAAAATGTGTGTCCAGG - Intergenic
990322185 5:54640770-54640792 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
992220124 5:74563655-74563677 ACTCAGAGGACAGTGTTTTGTGG - Intergenic
992545977 5:77814137-77814159 AATCAGAATACAGTGGGTTAAGG - Intronic
992609930 5:78498555-78498577 AGTCTGAAGACTGTGCTTTGAGG + Intronic
992965743 5:81998070-81998092 AATCTGATTACTATGTGTTGGGG - Intronic
993743823 5:91571169-91571191 AATCAGAAGACAATTTGATGGGG + Intergenic
993778795 5:92039277-92039299 AATAAAAAGCCTGTGTGTGGCGG + Intergenic
994129565 5:96209787-96209809 AATCTGAAGACTGTGTGTCTTGG + Intergenic
994314311 5:98314560-98314582 AATCAAAAGAGGCTGTGTTGAGG - Intergenic
994314352 5:98315161-98315183 AATCAGAAGAGGCTGTGTCGAGG - Intergenic
994573108 5:101538782-101538804 AACCTGATGACTGTGTGTTTTGG - Intergenic
995268853 5:110197776-110197798 AATGAAAAGACTATGTGTTCAGG + Intergenic
995541440 5:113190055-113190077 TAACAGAAGACTGTAGGTTGAGG - Intronic
995849487 5:116530440-116530462 CATCAGAGGTCTGTGTGTTCTGG + Intronic
997065892 5:130558169-130558191 AATCTGAAGACTATGTGTGCTGG - Intergenic
997813656 5:136996074-136996096 CATCACCAGCCTGTGTGTTGTGG - Intronic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
998788332 5:145737450-145737472 AATAAGAAGACTGTGAAATGTGG + Intronic
999638036 5:153642756-153642778 AATCAGAACTCTGTGTGTACTGG - Intronic
1000608374 5:163348779-163348801 AATTAGAATACAGTGTGATGAGG - Intergenic
1000713987 5:164617554-164617576 AGTGAGAAGACTGTGCCTTGGGG + Intergenic
1001851287 5:174968912-174968934 AATCTGATGATTGTGTCTTGGGG + Intergenic
1004523442 6:16383565-16383587 AAACAGAAAAGTGTGTGTGGTGG - Intronic
1004556751 6:16705720-16705742 AATCACAGGTCTGTGTGCTGCGG - Intronic
1004739163 6:18440484-18440506 AATCAGAAAACTTTATGTTCAGG - Intronic
1005566038 6:27095665-27095687 GATCAGAAGAGTGTCTGTGGAGG + Intergenic
1005952012 6:30638718-30638740 AATCAGAAGTCTGAAAGTTGAGG + Intronic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1007133867 6:39502015-39502037 AATCTGAAGTTTGTGTCTTGGGG - Intronic
1007390915 6:41548973-41548995 ACTCAAAAAACTGTGAGTTGGGG + Intronic
1007976002 6:46101966-46101988 AAAAAGAAGTGTGTGTGTTGGGG + Intergenic
1008219756 6:48841583-48841605 AATCTGATGATTATGTGTTGTGG + Intergenic
1008409777 6:51162770-51162792 ATTCAGAAGACTGACTCTTGAGG - Intergenic
1008844715 6:55949577-55949599 ATTCTGAAGAAGGTGTGTTGAGG - Intergenic
1009247643 6:61259139-61259161 AATCTGATGACTATGTCTTGGGG + Intergenic
1009965771 6:70576442-70576464 GAACAGAAAACTGTGTCTTGGGG - Intronic
1010879711 6:81152563-81152585 AACCTGATGACTATGTGTTGAGG - Intergenic
1011722627 6:90174775-90174797 ACTCAGAACATTGTGTTTTGTGG + Intronic
1012169341 6:95999372-95999394 AATCTGATGACTGTATGTTTTGG - Intergenic
1012253986 6:97011427-97011449 AATCACAAGTATGTGTGTGGTGG + Intronic
1012540975 6:100361290-100361312 AATTAAAAGAGTTTGTGTTGGGG + Intergenic
1012859939 6:104547030-104547052 AAAAAGAAGAGTGTGTGTTTGGG + Intergenic
1013578522 6:111509026-111509048 AATGGGAACACTGAGTGTTGGGG + Intergenic
1013686884 6:112595362-112595384 AATCAACAAACTGTGTGGTGTGG - Intergenic
1013860281 6:114627318-114627340 AATCAGAACTCTGTGAGTGGGGG - Intergenic
1015754942 6:136597471-136597493 AGTTAGGAGACTCTGTGTTGTGG - Intronic
1016947544 6:149548300-149548322 AATCCTAAGACTGTGAGTTCTGG + Intergenic
1018594774 6:165467110-165467132 AATTAGAAGACTGAGAGATGTGG + Intronic
1020064743 7:5178767-5178789 GATCAGAAGACTTAATGTTGTGG + Intergenic
1021591435 7:22267821-22267843 ACTCAGAAGTTTGTGTGTTCAGG + Intronic
1022426143 7:30270656-30270678 AATCTGCAGCCTGTGTGGTGTGG + Intergenic
1022638281 7:32158086-32158108 AATAAGAAAACTGTGTGTGAAGG - Intronic
1022939827 7:35223559-35223581 AAACAGAAGACTGAGTGGTCTGG + Intronic
1024100719 7:46029824-46029846 AATAAGAAGCCACTGTGTTGTGG - Intergenic
1024445896 7:49478546-49478568 AATCTGATGACTATGTCTTGGGG + Intergenic
1024945712 7:54805704-54805726 AATCAGAAGCCCGGGTGTGGTGG + Intergenic
1025958834 7:66203390-66203412 AATCAGCTGACTGGGTGTGGTGG - Intergenic
1025972336 7:66339087-66339109 TTTCAGAAGACTAAGTGTTGGGG + Intronic
1026223045 7:68417004-68417026 AAACAGAAGTGTGGGTGTTGTGG - Intergenic
1026579038 7:71598750-71598772 AATCAGAGGTCTCTGAGTTGTGG + Intronic
1028764578 7:94538352-94538374 AATCAGAATACTGTGAGTAGTGG - Intronic
1028778453 7:94706264-94706286 AATCAGCAGGATGTGTGTGGGGG + Intergenic
1030538924 7:110804467-110804489 AATCAGAAGGCAGGGTGTTCTGG + Intronic
1031220279 7:118956870-118956892 AATCAGATGACTGTGTGCCTGGG + Intergenic
1031374354 7:121005985-121006007 ATTCAGGAGGCTTTGTGTTGTGG + Intronic
1032548333 7:132762013-132762035 AATCAGAAGACTTGGGGCTGGGG + Intergenic
1032912557 7:136450103-136450125 AATCAGAAGACAGGCTATTGGGG + Intergenic
1033000126 7:137494354-137494376 AATCTGATGACTGTGTGTCTTGG - Intronic
1033417072 7:141171610-141171632 ACTCAGAAGACAGTGTCATGCGG - Intronic
1036713159 8:11095516-11095538 ATTCAGAACAGTGTGTGCTGGGG - Intronic
1037027422 8:14056320-14056342 AAACTGAAAACTGTGTGTAGGGG - Intergenic
1037459803 8:19097402-19097424 AAGCAGTAGACTGTGTGAAGAGG - Intergenic
1038457236 8:27684396-27684418 AAACAGAAGTCTGGGTGCTGTGG + Intergenic
1040029589 8:42812675-42812697 AATCAGGAGGCTGGGTGTGGTGG + Intergenic
1040811910 8:51462829-51462851 AATCTGATGACTGTGTGTCTTGG - Intronic
1040842039 8:51794347-51794369 AATCTGATGACTGTGTGTCTTGG - Intronic
1042355850 8:67826529-67826551 AATCAGTAAACTGTATGTTTAGG + Intergenic
1042470534 8:69182582-69182604 ATGCAGAAGAATGTTTGTTGTGG + Intergenic
1042856857 8:73276463-73276485 CATCAGAAGGCTGGGTGTGGTGG - Intergenic
1043223684 8:77698160-77698182 AATCTGAAGATTATGTCTTGGGG + Intergenic
1043557947 8:81455342-81455364 AATCATAAGAGTGTATGTTTTGG + Intergenic
1043768892 8:84172183-84172205 AATCAGAAGACAGGGCGCTGTGG - Intergenic
1044056248 8:87572934-87572956 AATCAGAACTGTGTGTCTTGTGG + Intronic
1044748040 8:95390144-95390166 AGACAGAAGAGTGTGTTTTGAGG + Intergenic
1046150041 8:110211755-110211777 AGTAAGAAGACTTTGTATTGTGG + Intergenic
1046584090 8:116130013-116130035 AATCAGAAGTTTGGGAGTTGAGG + Intergenic
1046848851 8:118950474-118950496 AATCAGAATACTGATTGTTCTGG + Intronic
1046881830 8:119317675-119317697 ATCCAGAAGACAGTGTGGTGGGG - Intergenic
1047052929 8:121133200-121133222 AATTACAACACAGTGTGTTGAGG - Intergenic
1047709730 8:127539596-127539618 AATTGGAAGACTGGGTGTAGAGG + Intergenic
1048030491 8:130627078-130627100 CATCAGAAGACTGTTTATTTGGG - Intergenic
1048913921 8:139164154-139164176 AATCTGACGATTGTGTCTTGGGG + Intergenic
1053817024 9:41923014-41923036 AAAAACAAGACTGTGAGTTGGGG + Intronic
1054107281 9:61066671-61066693 AAAAACAAGACTGTGAGTTGGGG + Intergenic
1054613576 9:67264454-67264476 AAAAACAAGACTGTGAGTTGGGG - Intergenic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056426506 9:86482735-86482757 AAGCAGAAGCCTGGGTGTGGTGG + Intergenic
1056879197 9:90373782-90373804 AATTAGAAGAATGTATTTTGGGG + Intergenic
1057157046 9:92851709-92851731 AATGAAAAGACTGTATGTTTGGG - Intronic
1057172880 9:92974486-92974508 ACTCAGGAGACTGTGTGTGGTGG + Intronic
1058444939 9:105046492-105046514 CAACAAAAGACTGTGTGTGGTGG - Intergenic
1058572026 9:106357404-106357426 AATCTGATGACTGTGTGTCATGG + Intergenic
1059330249 9:113530551-113530573 AATCAGAACCCAGTGTGGTGAGG - Intronic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1060792729 9:126497122-126497144 AAGCAGAAGCCTGTGTGTCTGGG - Intronic
1060919805 9:127412331-127412353 AATCAGTAGACTGAGTGAAGCGG - Intergenic
1061041743 9:128144680-128144702 AGGCAGGAGGCTGTGTGTTGTGG + Intergenic
1186042275 X:5494102-5494124 AATCAGTAGACTGGGTGATATGG + Intergenic
1186192074 X:7076054-7076076 AATCAGAGGCCTGTGTACTGAGG + Intronic
1187661868 X:21556530-21556552 AATCAGAAGACAGAGTCTTAGGG + Intronic
1188212929 X:27444933-27444955 TATCAGGAAACTGTGTTTTGGGG - Intergenic
1188712359 X:33416080-33416102 AAGCAGAAGGCTATGTGTTTTGG + Intergenic
1188773410 X:34183650-34183672 TTTCAGAAGACTCTGTCTTGGGG - Intergenic
1188813828 X:34686546-34686568 AATCAGATGACTATGTGATTTGG + Intergenic
1189583819 X:42436363-42436385 AATCTGATGACTATGTCTTGGGG - Intergenic
1189817894 X:44842541-44842563 AATATGAAAACTGTTTGTTGGGG - Intergenic
1191974325 X:66853528-66853550 AATCAGAGGACTGGGTGCAGTGG - Intergenic
1192067515 X:67902300-67902322 AATCTGATGACTGTTTCTTGGGG + Intergenic
1192072803 X:67958869-67958891 AATAAGAATACAGTGTGTTGAGG - Intergenic
1192382391 X:70631797-70631819 AATCAGAAGACTGTGTGTTGTGG + Intronic
1192926702 X:75761362-75761384 AATCTGATGATTGTGTCTTGGGG - Intergenic
1192997890 X:76531865-76531887 AATCTGATGATTATGTGTTGTGG + Intergenic
1193398935 X:81019626-81019648 AATCTGATGACTGTGTGTCTTGG + Intergenic
1193799543 X:85918095-85918117 AATCTGATGACTGTGTTTTGGGG - Intronic
1194013164 X:88586096-88586118 AATCTGATGACTGTGTGTCTTGG - Intergenic
1194267729 X:91776427-91776449 AATCTGAAGACCGTATGCTGAGG + Intergenic
1195144743 X:102001749-102001771 AATCAGATGACTATGTGTCTTGG - Intergenic
1195515347 X:105768143-105768165 AGTTAGAAGACTGTTTGTAGAGG + Intergenic
1196244927 X:113389867-113389889 AATCTGAAGACTATGTGTCTTGG + Intergenic
1196468336 X:115995163-115995185 AATCTGATGACTATGTGTTTTGG - Intergenic
1196570415 X:117260386-117260408 AATCATAACAGTGTGTCTTGAGG - Intergenic
1197374517 X:125665270-125665292 AATCTGATGACTGTGTGTCTTGG - Intergenic
1199913156 X:152309322-152309344 AATCTGATGACTATGTGTTTTGG - Intronic
1200584940 Y:4997352-4997374 AATCTGAAGACCGTATGCTGAGG + Intergenic
1201545969 Y:15162412-15162434 AATCAGTAGACTGGGTGATATGG - Intergenic
1201676642 Y:16593598-16593620 AATCTGTAGACTGTGTGTGAGGG + Intergenic
1201959337 Y:19661527-19661549 AATCTGAAGACTATGTGTCTTGG - Intergenic