ID: 1192382969

View in Genome Browser
Species Human (GRCh38)
Location X:70636542-70636564
Sequence TGAGTCTGTAGGGGTTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192382969_1192382977 -2 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382977 X:70636563-70636585 CAGGCTCCAGGCCTATCCCAGGG No data
1192382969_1192382978 -1 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382978 X:70636564-70636586 AGGCTCCAGGCCTATCCCAGGGG No data
1192382969_1192382987 28 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382987 X:70636593-70636615 GCACAAGGCCCATTCCCACCTGG No data
1192382969_1192382982 13 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382982 X:70636578-70636600 TCCCAGGGGACCCAGGCACAAGG No data
1192382969_1192382980 6 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382980 X:70636571-70636593 AGGCCTATCCCAGGGGACCCAGG No data
1192382969_1192382976 -3 Left 1192382969 X:70636542-70636564 CCAGGCCAACCCCTACAGACTCA No data
Right 1192382976 X:70636562-70636584 TCAGGCTCCAGGCCTATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192382969 Original CRISPR TGAGTCTGTAGGGGTTGGCC TGG (reversed) Intronic