ID: 1192386401

View in Genome Browser
Species Human (GRCh38)
Location X:70675946-70675968
Sequence TCCACGGATTTGACTACTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1343
Summary {0: 1, 1: 2, 2: 33, 3: 332, 4: 975}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192386396_1192386401 5 Left 1192386396 X:70675918-70675940 CCGCATCCGGCCCATTCTACTTT 0: 1
1: 0
2: 4
3: 67
4: 573
Right 1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG 0: 1
1: 2
2: 33
3: 332
4: 975
1192386395_1192386401 8 Left 1192386395 X:70675915-70675937 CCACCGCATCCGGCCCATTCTAC 0: 1
1: 0
2: 20
3: 173
4: 1356
Right 1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG 0: 1
1: 2
2: 33
3: 332
4: 975
1192386397_1192386401 -1 Left 1192386397 X:70675924-70675946 CCGGCCCATTCTACTTTCATTCT 0: 1
1: 0
2: 2
3: 35
4: 493
Right 1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG 0: 1
1: 2
2: 33
3: 332
4: 975
1192386398_1192386401 -5 Left 1192386398 X:70675928-70675950 CCCATTCTACTTTCATTCTCCAC 0: 1
1: 0
2: 5
3: 32
4: 393
Right 1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG 0: 1
1: 2
2: 33
3: 332
4: 975
1192386399_1192386401 -6 Left 1192386399 X:70675929-70675951 CCATTCTACTTTCATTCTCCACG 0: 1
1: 0
2: 5
3: 90
4: 884
Right 1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG 0: 1
1: 2
2: 33
3: 332
4: 975

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192386401 Original CRISPR TCCACGGATTTGACTACTCT AGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900999125 1:6139048-6139070 TCCACGAGGTTGACTACTCTGGG - Intronic
901162379 1:7188513-7188535 TGTATGGATTTGACTACTCCAGG + Intronic
901393775 1:8965449-8965471 TCTAAGAATTTGACTATTCTAGG + Intronic
901771601 1:11533181-11533203 TCCATGAATTTGACAACTCTGGG + Intronic
901901180 1:12364263-12364285 TCTATAAATTTGACTACTCTAGG + Intronic
902180183 1:14682173-14682195 TCTATGGATTTCACTGCTCTGGG + Intronic
903268814 1:22175142-22175164 TCTATGAATTTGACTACTCTAGG - Intergenic
903269848 1:22180870-22180892 TCTATGAATTTGACTACTCTAGG - Intergenic
903784505 1:25849457-25849479 TCTACAGATTTGCCTATTCTGGG + Intronic
904112545 1:28137681-28137703 TCTACAAATTTGACTACTCTGGG + Intergenic
904333081 1:29778128-29778150 TTTATGAATTTGACTACTCTAGG + Intergenic
904765047 1:32839181-32839203 TTTATGAATTTGACTACTCTAGG + Intronic
904913760 1:33954748-33954770 TCAATGAGTTTGACTACTCTAGG - Intronic
905119928 1:35673794-35673816 TCTGTGAATTTGACTACTCTAGG - Intergenic
905246592 1:36619009-36619031 TCTATGAATTTGACTACTCTAGG - Intergenic
905264419 1:36741112-36741134 TCTACGGATTTGCCTATTCTGGG + Intergenic
905679882 1:39862071-39862093 TCTATGAATTTGACTACTCTAGG - Intronic
905930286 1:41782249-41782271 TCTATGAATTTGACTACTCTAGG - Intronic
906064178 1:42968392-42968414 TCTGTGAATTTGACTACTCTAGG + Intergenic
906083846 1:43112980-43113002 TTTATGAATTTGACTACTCTTGG + Intergenic
906763061 1:48396706-48396728 TCTATGAATTTGACTACTCTTGG - Intronic
907160136 1:52363645-52363667 TCCATGAATATGACTACTCTAGG + Intronic
907169592 1:52449828-52449850 CCTATGAATTTGACTACTCTAGG + Intronic
907200683 1:52724275-52724297 TCTATGAATTTGACTACTCTAGG - Intergenic
907279290 1:53335020-53335042 TTTATGAATTTGACTACTCTAGG + Intergenic
907390864 1:54157382-54157404 TCCATGGATTGCACTACTCAAGG + Intronic
907394982 1:54183364-54183386 GCCAAGGATTTGAAGACTCTTGG + Intronic
907517782 1:55004052-55004074 TCTATGGATTTGACTATTCCAGG + Intronic
907528888 1:55072994-55073016 TCCATGAATTTGACTACTCTAGG - Intronic
907532877 1:55119356-55119378 TCTAAGGATTTGACGACTCTAGG - Intronic
907669714 1:56463794-56463816 TCCACAAATTTGAGTTCTCTGGG + Intergenic
907931449 1:59004854-59004876 TCTATGAACTTGACTACTCTAGG - Intergenic
907950123 1:59174914-59174936 TTCATGAATTTGACTACTATAGG + Intergenic
908110214 1:60889095-60889117 TCTATGAATTTGGCTACTCTAGG + Intronic
908162994 1:61429857-61429879 TCTATGAATTTGACTACTCTAGG - Intronic
908462802 1:64362285-64362307 TCTATGAATTTGACTACTCCAGG - Intergenic
908709474 1:66998778-66998800 TCTATGAATTTGACTACACTAGG - Intergenic
908714599 1:67055697-67055719 TCTGTGAATTTGACTACTCTAGG + Intergenic
908771420 1:67600226-67600248 TCTATGAATTTGACTGCTCTAGG + Intergenic
908776005 1:67640732-67640754 TCTATGAATTTGACTACTCTAGG - Intergenic
910305398 1:85756994-85757016 TCTATGAATTCGACTACTCTAGG - Intronic
910340312 1:86179691-86179713 TCTATGAATTTGTCTACTCTAGG + Intergenic
910563389 1:88617279-88617301 TCTATGAATTTGACTACTATAGG - Intergenic
910599887 1:89019696-89019718 TCTATTAATTTGACTACTCTAGG - Intronic
911105105 1:94123673-94123695 TCAATGAACTTGACTACTCTTGG + Intergenic
911140488 1:94496290-94496312 TCTATGAATTTGACTGCTCTAGG + Intronic
912315352 1:108662892-108662914 TCTATGAATTTGGCTACTCTAGG - Intergenic
912346081 1:108964391-108964413 TTTATGAATTTGACTACTCTAGG + Intergenic
912404898 1:109428933-109428955 TCTATGAATTTGACTATTCTAGG - Intergenic
912648422 1:111416832-111416854 TCTGTGAATTTGACTACTCTAGG - Intronic
912781638 1:112554919-112554941 TCTATGAGTTTGACTACTCTAGG - Intronic
912908296 1:113730953-113730975 TCTATGATTTTGACTACTCTGGG - Intronic
912918664 1:113843471-113843493 TCTATGAATTTGACTACTGTAGG - Intronic
913094159 1:115500567-115500589 TTTACGAATTTTACTACTCTAGG - Intergenic
913429447 1:118774691-118774713 TCTACAAATTTGACTATTCTAGG + Intergenic
913665633 1:121045964-121045986 TCTATGACTTTGACTACTCTAGG - Intergenic
914017031 1:143829235-143829257 TCTATGAATTTGACTACTCTAGG - Intergenic
914160755 1:145131763-145131785 TCTATGAATTTGACTACTCTAGG + Intergenic
914655640 1:149737777-149737799 TCTATGACTTTGACTACTCTAGG - Intergenic
914865599 1:151425555-151425577 TCTATGAATTTGACTACTCTAGG + Intronic
914973908 1:152339934-152339956 TCAATGAATTTGACTACTCTAGG - Intergenic
915224241 1:154400709-154400731 TCTATTAATTTGACTACTCTAGG + Intergenic
915235547 1:154477995-154478017 TCTATGAATTTGACTACTCTGGG + Intronic
916486247 1:165261815-165261837 TCACTGAATTTGACTACTCTAGG - Intronic
917102236 1:171458342-171458364 TCTATGAATTTGACTACCCTAGG - Intergenic
917129359 1:171725129-171725151 TCTATGAAATTGACTACTCTAGG + Intronic
917412400 1:174772787-174772809 TCTATGAATTTGGCTACTCTAGG + Intronic
917902661 1:179558281-179558303 TCTATGAATTTGACTACTCTAGG + Intronic
917985779 1:180317287-180317309 CCTATGAATTTGACTACTCTAGG - Intronic
917992482 1:180396084-180396106 TCTGTGAATTTGACTACTCTAGG - Intronic
918056697 1:181027438-181027460 TCTATGAATTTTACTACTCTGGG + Intergenic
918096251 1:181336772-181336794 TCTCTGAATTTGACTACTCTGGG + Intergenic
918278929 1:182983753-182983775 TGCATGAATTTGACTACTCCAGG + Intergenic
918441164 1:184568427-184568449 TCCATGAATTTGACTACTCCAGG + Intronic
919125386 1:193386700-193386722 TCCACAGAATTATCTACTCTGGG + Intergenic
919662035 1:200256799-200256821 TCCATGAATTTGCCTATTCTAGG - Intergenic
919787352 1:201268113-201268135 TCTATGAATTTGACCACTCTAGG - Intergenic
919858544 1:201722305-201722327 TCTATGAATTTGACTACTCTAGG + Intronic
920102188 1:203523838-203523860 TCTGTGAATTTGACTACTCTGGG + Intergenic
920728145 1:208456798-208456820 TCAATGGATGTGATTACTCTAGG + Intergenic
920894205 1:210028108-210028130 TCTATGAACTTGACTACTCTGGG + Intronic
921218556 1:212957073-212957095 TCTATGACTTTGACTACTCTGGG + Intronic
921469404 1:215530724-215530746 TCTCTGAATTTGACTACTCTGGG - Intergenic
921493288 1:215805369-215805391 TCTATGAATTTGACTACTCTAGG - Intronic
921584216 1:216928894-216928916 TCTATGAATTTGACTACTCTGGG - Intronic
922050102 1:221980548-221980570 TCTACGAATTTGACTACTCTAGG + Intergenic
922064056 1:222118804-222118826 TCTATGAATTTGACTATTCTAGG + Intergenic
922300694 1:224297413-224297435 TTAATGAATTTGACTACTCTCGG - Intronic
922443959 1:225680582-225680604 TCTAAGAATTTGACTATTCTAGG - Intergenic
922667507 1:227485303-227485325 TCTATAAATTTGACTACTCTAGG - Intergenic
922911257 1:229219677-229219699 TCTATGAATTTGACTACTCTAGG - Intergenic
923017960 1:230141493-230141515 TTCATGAATTTGACTCCTCTAGG + Intronic
923070957 1:230564012-230564034 TCTATGCATTTGACTTCTCTAGG - Intergenic
923077588 1:230623747-230623769 TCTATGCATTTGACTCCTCTGGG + Intergenic
923138077 1:231135719-231135741 CCTATGAATTTGACTACTCTAGG + Intergenic
923184295 1:231555342-231555364 TCTATGATTTTGACTACTCTGGG - Intronic
923207079 1:231769549-231769571 TCTATGAATTTGACTCCTCTAGG - Intronic
923619596 1:235567513-235567535 TCTATGAATTTGACTCCTCTAGG + Intronic
923757584 1:236806790-236806812 TCTATGAATTTGACTATTCTAGG + Intronic
923952524 1:238974743-238974765 TCTATGAATGTGACTACTCTAGG + Intergenic
924003141 1:239576028-239576050 GTCATGAATTTGACTACTCTAGG + Intronic
924540569 1:244977075-244977097 TCCATGAATTTGACTTCTCTAGG - Intronic
924862776 1:247942925-247942947 TCTATGAATTTCACTACTCTGGG + Intronic
924866277 1:247984934-247984956 TCTATGAATTTGACTACTCTGGG + Intronic
924870079 1:248032558-248032580 TCTATAAATTTGACTACTCTGGG + Intronic
1062790335 10:300434-300456 TCTATGAATTTGACTACTCTAGG - Intronic
1063392295 10:5658498-5658520 TCCATGAATTTGACTACTCGAGG - Intronic
1063475402 10:6324248-6324270 TCTATGAATTTGACTACTCTGGG - Intergenic
1063521587 10:6746280-6746302 TCTATGAATTTGACTACACTAGG + Intergenic
1063554834 10:7068507-7068529 TCTACGATTTTGACTACTCTAGG + Intergenic
1063836268 10:10017384-10017406 TTTATGAATTTGACTACTCTAGG - Intergenic
1064007594 10:11710876-11710898 TCTGTGAATTTGACTACTCTGGG - Intergenic
1064099730 10:12453053-12453075 TCTATGTATTGGACTACTCTAGG + Intronic
1064102433 10:12475329-12475351 TCCACGAATTTGACTACTCTAGG + Intronic
1064198691 10:13266250-13266272 TCTGTGAATTTGACTACTCTAGG + Intergenic
1064365674 10:14705653-14705675 TCTATGCATTTGACTACTCTAGG - Intronic
1064368082 10:14726291-14726313 TCCCCGGATTTGACTGCTTTTGG - Intronic
1064457554 10:15502533-15502555 TCTATGAATTTGACCACTCTAGG + Intergenic
1064516167 10:16151159-16151181 TCTATGGATTTGCCTATTCTGGG - Intergenic
1064549913 10:16489759-16489781 TCTATGAATTTGACTACTCTAGG + Intronic
1064691998 10:17927878-17927900 TCTATGACTTTGACTACTCTAGG + Intergenic
1064735739 10:18380006-18380028 TCTATGAATTTGACTACACTGGG + Intronic
1064972129 10:21076798-21076820 TCTATGAATTTGACTACTCTAGG - Intronic
1065070585 10:22020148-22020170 TCTATGAATTTGACTACTCTAGG - Intergenic
1065488612 10:26258583-26258605 TCTACGAATTTTACTACTATGGG + Intronic
1065633421 10:27706080-27706102 TCTATGAATTTGACTATTCTAGG + Intronic
1065704843 10:28463327-28463349 TCTATGAATTTGACTACTCCAGG - Intergenic
1065709919 10:28506099-28506121 TCTATGAATTTGACTACTATAGG + Intergenic
1065873033 10:29972304-29972326 TCCATGAATTTGACCACTTTAGG + Intergenic
1066050395 10:31629748-31629770 TCTATGAATTTGACTACTCTAGG + Intergenic
1066079781 10:31919162-31919184 TTTATGAATTTGACTACTCTAGG - Intronic
1066117149 10:32250687-32250709 TCTGTGAATTTGACTACTCTAGG - Intergenic
1066201765 10:33148732-33148754 TCTATGAATTTGACTACTGTAGG - Intergenic
1066453493 10:35552307-35552329 TCTATGAATCTGACTACTCTTGG - Intronic
1067052930 10:43034831-43034853 TCTGTGGATTTGACTACTCTAGG - Intergenic
1067063796 10:43092258-43092280 TCCACGAATTTGACGACTGCAGG - Intronic
1067064895 10:43098285-43098307 TCTGTGAATTTGACTACTCTAGG + Intronic
1067145551 10:43691058-43691080 TCTAGGAATTGGACTACTCTAGG + Intergenic
1067245502 10:44538434-44538456 TCTAAGAGTTTGACTACTCTAGG + Intergenic
1067407697 10:46038058-46038080 TCTATGATTTTGACTACTCTAGG - Intronic
1067856882 10:49802022-49802044 TCTATGCATTTGACTACTGTAGG + Intergenic
1068742416 10:60488615-60488637 TCTACAGATTTGCCTATTCTGGG + Intronic
1068897557 10:62224136-62224158 TCTATGAATTTCACTACTCTAGG - Intronic
1069088236 10:64167300-64167322 TCTACAAATTTGACTACTGTAGG + Intergenic
1069266022 10:66458630-66458652 TCTACGGATTTAACTATTCTAGG + Intronic
1069683902 10:70304739-70304761 ACCATGAATTTGACTACTCTAGG + Intronic
1069699471 10:70411276-70411298 TTCATGAATTTGACTACTCTAGG + Intronic
1069719851 10:70542480-70542502 TCAATGGATGTGACTACTCTAGG + Intronic
1069965557 10:72112361-72112383 TCTATGAATTTGACTACTCTAGG - Intronic
1070254194 10:74800063-74800085 TCTATGAATTTGACTACTCTAGG - Intergenic
1070311088 10:75274428-75274450 TCTCTGAATTTGACTACTCTAGG + Intergenic
1070313443 10:75290048-75290070 TCTATGAATTTGACTACTTTAGG + Intergenic
1070315360 10:75305714-75305736 TCTATGAATCTGACTACTCTAGG + Intergenic
1070608536 10:77917058-77917080 TCTAGGAATTTGACTACTTTAGG - Intronic
1070691231 10:78527924-78527946 TTTATGAATTTGACTACTCTGGG + Intergenic
1071698885 10:87907766-87907788 TCTATGTATTTGACTATTCTAGG + Intronic
1072136488 10:92551646-92551668 TCTGTGAATTTGACTACTCTAGG - Intronic
1072217203 10:93297430-93297452 TCTATAAATTTGACTACTCTAGG + Intergenic
1072724599 10:97804449-97804471 TGTATGAATTTGACTACTCTAGG + Intergenic
1073182201 10:101590827-101590849 TCTATGAATTTGACTGCTCTAGG + Intronic
1073222289 10:101885563-101885585 TCTATGAATTTGACTATTCTAGG - Intronic
1073310600 10:102537605-102537627 TCTATGAATGTGACTACTCTGGG + Intronic
1073398098 10:103235021-103235043 TCCATACATTTGACTGCTCTAGG - Intergenic
1073690370 10:105801217-105801239 TCTATGAATTTGGCTACTCTAGG + Intergenic
1074775935 10:116768289-116768311 TCTATGGATTTGCCTACTCCAGG - Intergenic
1074809580 10:117090345-117090367 TCTATGAATCTGACTACTCTAGG - Intronic
1074926380 10:118076404-118076426 TCTATGAATTTGACTCCTCTAGG + Intergenic
1074950029 10:118324630-118324652 TCCATGAATTTGACTGCTATGGG - Intronic
1075168765 10:120093579-120093601 TCTATGAATTTGACTACTTTAGG + Intergenic
1075203880 10:120429906-120429928 TCTATGAATTTGACTAGTCTAGG + Intergenic
1075340992 10:121646754-121646776 GCCATGGATTTGCCTATTCTGGG - Intergenic
1075423797 10:122326385-122326407 TCTACGAATTTGATGACTCTAGG + Intronic
1075854845 10:125620829-125620851 TCTGTGAATTTGACTACTCTGGG + Intronic
1076005664 10:126946619-126946641 TCTCTGAATTTGACTACTCTAGG + Intronic
1076060543 10:127410860-127410882 TCCAGCGATTTGAATATTCTCGG + Exonic
1076121840 10:127942658-127942680 TCTACAAATTTGACTACTCTAGG - Intronic
1076277048 10:129209690-129209712 TCCATGGATTTCACTCCTCATGG - Intergenic
1077388808 11:2289721-2289743 TCTATGGATTTGACCACCCTAGG - Intergenic
1078092372 11:8272945-8272967 CCTATGAATTTGACTACTCTAGG - Intergenic
1078547243 11:12255372-12255394 TCTACGATTTTGACTACTCTAGG + Intronic
1078601852 11:12739484-12739506 TCTGTGAATTTGACTACTCTAGG + Intronic
1079058986 11:17231118-17231140 TCTATTGATTTGACTACTCCAGG + Intronic
1079274466 11:19021422-19021444 CCTATGGATTTGTCTACTCTGGG + Intergenic
1079418507 11:20263754-20263776 TCCATGGATTTGCCTATTCTGGG - Intergenic
1080273206 11:30472699-30472721 TCAATGAATATGACTACTCTAGG - Intronic
1081225996 11:40522751-40522773 TTCACATATTTGACTACTCTAGG + Intronic
1081446672 11:43137570-43137592 TCCATGATTTTGACTACTCTAGG - Intergenic
1081507150 11:43730490-43730512 TCCATGGTTTTGACTTCTCAGGG + Intronic
1081948770 11:47023658-47023680 TCTAGGAATTTGACTACTCTAGG + Intronic
1082056654 11:47823397-47823419 TCTATAAATTTGACTACTCTAGG + Intronic
1082063056 11:47876988-47877010 TCTATGCATTTGACTATTCTAGG - Intergenic
1082109925 11:48263214-48263236 TCTATGAATTTGACTATTCTAGG + Intergenic
1082728375 11:56764898-56764920 TCTATGAATATGACTACTCTAGG + Intergenic
1082822735 11:57555422-57555444 TCTATGAATTTGACTATTCTGGG - Intronic
1082935935 11:58656637-58656659 CCTATGGATTTGACTACTCTAGG + Intronic
1083206938 11:61156939-61156961 TCTACGAATTGGACTACTCTAGG + Intronic
1083410064 11:62486157-62486179 TGTATGAATTTGACTACTCTAGG - Intronic
1084353587 11:68622168-68622190 TCTATAGATTTGACAACTCTAGG - Intergenic
1084446779 11:69208354-69208376 TCTGTGGATTTGACTTCTCTGGG + Intergenic
1084540000 11:69780253-69780275 TCTACGAATTTGACTACTTAGGG + Intergenic
1084552091 11:69850525-69850547 TCTATAAATTTGACTACTCTGGG + Intergenic
1084570590 11:69957239-69957261 TCTATGGATTTGCCTATTCTGGG + Intergenic
1084619629 11:70260624-70260646 TTTATGGATTTGACTACTCTGGG + Intergenic
1084658039 11:70530672-70530694 TCTGTGGATTTGGCTACTCTAGG - Intronic
1084677469 11:70644379-70644401 GTGACGGATGTGACTACTCTAGG + Intronic
1084704487 11:70807950-70807972 TCCATGAATCTGACTGCTCTCGG - Intronic
1084753578 11:71220711-71220733 TCCATGGATTTCCCCACTCTAGG - Intronic
1085164982 11:74390892-74390914 TCTATGAATTTGACTAATCTAGG - Intronic
1085362895 11:75908126-75908148 TCTATGATTTTGACTACTCTAGG + Intronic
1085499179 11:77002882-77002904 TCTATGAAGTTGACTACTCTAGG - Intronic
1085563902 11:77495826-77495848 TCTATGAATTTGACTGCTCTAGG - Intergenic
1085708347 11:78806900-78806922 TCTATGAATTTGACTACTCTAGG + Intronic
1085746427 11:79118603-79118625 TCCATGAATTTGACTACTCTAGG + Intronic
1087052662 11:93902106-93902128 TCTATGAATTTGACTACTCTAGG - Intergenic
1087233347 11:95691051-95691073 TCTAGGAGTTTGACTACTCTAGG - Intergenic
1087425073 11:97975276-97975298 TCCACTGATGTGGCTACCCTCGG + Intergenic
1087785812 11:102352750-102352772 TCTATGAATTTGACTACTCTAGG + Intronic
1087952325 11:104238291-104238313 TCTATGAATTTGACTAATCTAGG + Intergenic
1088457501 11:110048512-110048534 TCTAGGAATTTGACTACTCTAGG - Intergenic
1089070219 11:115693979-115694001 TCTCTGAATTTGACTACTCTTGG + Intergenic
1089332209 11:117697641-117697663 TCTAGGAATTTGAGTACTCTAGG + Intronic
1089577662 11:119458109-119458131 TCTATGAATTTGACTACTCTAGG - Intergenic
1089744612 11:120607966-120607988 TCACCTGATTTGACTCCTCTCGG - Intronic
1089776575 11:120841317-120841339 TGTATGGATATGACTACTCTAGG + Intronic
1089904442 11:122023982-122024004 TCTGTGAATTTGACTACTCTAGG - Intergenic
1090030958 11:123205840-123205862 TCTATGAATTTGACTACTCTGGG - Intergenic
1090127428 11:124102031-124102053 TCCATGAATGTGACTACCCTAGG + Intergenic
1090218792 11:124996752-124996774 TTCATGAATTTGATTACTCTCGG + Intronic
1090573179 11:128069829-128069851 TCTAAGAATTTGACTACTCTAGG + Intergenic
1090940774 11:131386257-131386279 TCCATGAATTTGCCTACCCTAGG - Intronic
1091261306 11:134236750-134236772 TCTATGAATTTGACTGCTCTGGG - Intronic
1091336972 11:134778943-134778965 TCTATGGATTTGACTATTCTAGG - Intergenic
1091564239 12:1636380-1636402 TCCATGGATTTGCCTATCCTGGG + Intronic
1091608659 12:1982424-1982446 TGTATGAATTTGACTACTCTAGG + Intronic
1091630086 12:2153518-2153540 TCTATGAATTTGACCACTCTGGG + Intronic
1091919342 12:4291891-4291913 TCTACGAATTTGACTATTCCAGG - Intronic
1092634714 12:10430830-10430852 TCCATGGGTTTGACTGTTCTTGG + Exonic
1092635755 12:10446262-10446284 TCCATGGGTTTGACTGTTCTTGG + Exonic
1093241065 12:16675278-16675300 CCCACTGATGTGACTACTGTAGG + Intergenic
1094209583 12:27874933-27874955 TTCCCGAATTTGACTGCTCTAGG + Intergenic
1094299839 12:28950719-28950741 TCTATGAATTTGACTTCTCTAGG + Intergenic
1095577085 12:43752670-43752692 TCTATGGATTAGACAACTCTAGG - Intronic
1095614177 12:44168908-44168930 TCTAGGAATTTGACTACACTAGG + Intronic
1095725974 12:45453682-45453704 TCTATGATTTTGACTACTCTTGG - Intergenic
1096133671 12:49181660-49181682 TCTATGAATTTGACTATTCTAGG - Intergenic
1097411697 12:59262370-59262392 TCTATGAATTTGAATACTCTAGG - Intergenic
1097615300 12:61878088-61878110 TCAACGAATTTGACTATTCTAGG - Intronic
1097669149 12:62515408-62515430 TCTATGAATTTGACTACTCAAGG - Intronic
1098343917 12:69480329-69480351 TCTACAAATTTGACTATTCTAGG + Intronic
1098517035 12:71389043-71389065 TTTATGAATTTGACTACTCTAGG + Intronic
1098889250 12:75992092-75992114 TCTAGGAATTTGACTACTGTAGG + Intergenic
1099215014 12:79842996-79843018 TCTATGAATTTGACTATTCTAGG + Intronic
1099714260 12:86270466-86270488 TCTATGAATTTGACTACTCTAGG + Intronic
1099847088 12:88041148-88041170 TCTATGAATTTGACTACTCTAGG + Intronic
1100285189 12:93158483-93158505 TCTATGAATTTGACTACTCTAGG + Intergenic
1100365266 12:93914811-93914833 TCTAAGAATTGGACTACTCTAGG - Intergenic
1100400911 12:94228616-94228638 TCTATGAATTTGACTACTCTAGG + Intronic
1100634904 12:96426261-96426283 TCCATGGGTTTGACTACTCTAGG + Intergenic
1100672327 12:96829928-96829950 TCTACGAATTTGTCTATTCTAGG + Intronic
1100996790 12:100309432-100309454 TCTATGAATTTGACTACTCTAGG + Intronic
1101208900 12:102516541-102516563 TCTATGAATTTGACTACTCTAGG - Intergenic
1101210726 12:102533117-102533139 TCTATGAATTTGACTACTATAGG - Intergenic
1101458899 12:104868924-104868946 TCTTCGGATTTGCCTATTCTGGG - Intronic
1101760441 12:107653990-107654012 TCTATGAATTTGACTACTCAAGG + Intronic
1101922201 12:108942046-108942068 TCTATGAATTTGATTACTCTAGG + Intronic
1101927773 12:108987147-108987169 TCTATGAATTTGACTCCTCTAGG + Intronic
1101930973 12:109013889-109013911 TCTATGGATTTGACTGCTCTAGG + Intronic
1101964392 12:109272492-109272514 TCTATGAATTTGACTACTCTAGG + Intergenic
1102214151 12:111148316-111148338 TCTGTGGATTTGACTACTCTAGG - Intronic
1102429534 12:112871396-112871418 TCTGTGGTTTTGACTACTCTAGG + Intronic
1102600934 12:114029872-114029894 TCCAGGGCTTTGACTTCACTGGG - Intergenic
1102796090 12:115689954-115689976 TCTATGAATTTTACTACTCTAGG - Intergenic
1103550157 12:121731010-121731032 TCTACGAATTTGACTACTCTAGG - Intronic
1103580455 12:121910972-121910994 TCTATGAATTTGACTACTCCAGG + Intronic
1103734137 12:123048319-123048341 TCTATGAATTTGACTACTTTAGG - Intronic
1103747502 12:123135564-123135586 TCTATGAATTTGACTACTCTAGG + Intronic
1103840253 12:123857911-123857933 TCTACAAATTTGACTACTCTAGG + Intronic
1103840365 12:123858866-123858888 TCTACGGATTTGCGTATTCTGGG - Intronic
1105454946 13:20531799-20531821 TCTATGAATTTGACGACTCTAGG - Intergenic
1105593596 13:21816068-21816090 CTCATGAATTTGACTACTCTGGG + Intergenic
1105731957 13:23226693-23226715 TCTATGAATTTGACTACTCTAGG - Intronic
1105738433 13:23296630-23296652 TCTGTGGATTTGACTAATCTGGG + Intronic
1105810114 13:23987809-23987831 TCTATGAATTTGGCTACTCTAGG + Intronic
1105820219 13:24074219-24074241 TCTATGAATTTGCCTACTCTAGG + Intronic
1105835222 13:24204650-24204672 TCTACAAATTTGACTTCTCTAGG + Intronic
1106034649 13:26032839-26032861 TCTATGAATTTGACTACTCTAGG - Intergenic
1106111218 13:26778922-26778944 TCTATGGATTTGACTACTCTAGG + Intergenic
1106139048 13:26995474-26995496 TCTATGAATCTGACTACTCTAGG + Intergenic
1106158496 13:27179572-27179594 TCTATGAATTTGACTACTCTAGG - Intergenic
1106163721 13:27223426-27223448 TCTATGCATTTAACTACTCTAGG - Intergenic
1106200254 13:27530313-27530335 TCTATGAATTTGACTACTCTGGG + Intergenic
1106382265 13:29251653-29251675 TCTATGAATTTGCCTACTCTAGG + Intronic
1106520671 13:30494848-30494870 TCTATGAATTTGACTACTCTAGG + Intronic
1106772439 13:32974846-32974868 TCTATGAATTTGACTACTCTAGG + Intergenic
1106882414 13:34146017-34146039 TCTATGAATTTGGCTACTCTAGG + Intergenic
1107463925 13:40631701-40631723 TCTATGAATTTGACTACTTTAGG - Intronic
1107599381 13:41997644-41997666 TCTGTGAATTTGACTACTCTAGG + Intergenic
1107640461 13:42437953-42437975 TCTATGAATTTGACTACTCTAGG + Intergenic
1107747420 13:43525311-43525333 TCTATGAATGTGACTACTCTAGG + Intronic
1107820334 13:44280136-44280158 TCGATGAATTTGACTACTCTAGG + Intergenic
1108068062 13:46599039-46599061 TCTATGAATTTGACTACCCTAGG + Intronic
1108198448 13:48018557-48018579 TCTATGAATTTGCCTACTCTAGG + Intergenic
1108349181 13:49575007-49575029 TCCATGAATTTGACTGTTCTAGG - Intronic
1108419093 13:50230456-50230478 TCTATGAATTTGACTACTCTAGG - Intronic
1108508302 13:51133259-51133281 TCTATGAATCTGACTACTCTAGG - Intergenic
1108568902 13:51730032-51730054 TCTATGAATTTGACTAGTCTAGG + Intronic
1108578453 13:51808874-51808896 CCTATGAATTTGACTACTCTAGG + Intergenic
1110313573 13:74079173-74079195 TCTACGAATTTGACTGCTTTAGG - Intronic
1110551944 13:76820480-76820502 TCAATGGATTTTACTACTCTAGG - Intergenic
1111744906 13:92255142-92255164 TCCACGGATTTTGATATTCTTGG + Intronic
1111809846 13:93086372-93086394 TCTATGAATTTAACTACTCTAGG - Intergenic
1111859824 13:93688708-93688730 TCTACGAATTTGCCCACTCTAGG - Intronic
1111911917 13:94322415-94322437 TCCAGGGATTTGTCTAGTCCTGG - Intronic
1112100491 13:96183714-96183736 TCCATGAATTTGACTATTCCAGG - Intronic
1112321263 13:98409804-98409826 TCTATGAATTTGCCTACTCTAGG + Intronic
1112370542 13:98789193-98789215 TCTATGAATTTGCCTACTCTAGG + Intergenic
1112552293 13:100432836-100432858 TCTATGAATTTGACTACTGTGGG + Intronic
1112568565 13:100572336-100572358 TGTATGAATTTGACTACTCTAGG - Intronic
1112607232 13:100918933-100918955 TCTATGAATTTGACTATTCTAGG - Intergenic
1112714327 13:102166133-102166155 TCTCTAGATTTGACTACTCTAGG + Intronic
1112741116 13:102473573-102473595 TCTATGAATTTGACTACTTTAGG - Intergenic
1113583233 13:111443828-111443850 TCCAGAAATTTGACTACTCTAGG + Intergenic
1113853173 13:113429371-113429393 TCTCCGGATGTGACTGCTCTGGG + Intronic
1113951529 13:114074327-114074349 TCTGTGGATCTGACTACTCTGGG + Intronic
1114660865 14:24343365-24343387 TCTATGAATTTGACTATTCTAGG - Intergenic
1115783690 14:36800522-36800544 TCCATGAGTTTGACTACTCTAGG - Intronic
1116486446 14:45454594-45454616 TCTCTGAATTTGACTACTCTGGG + Intergenic
1116614527 14:47117685-47117707 TCTATGAATTTGACTACTTTAGG - Intronic
1116803962 14:49473167-49473189 TCTATGAATTTGACTACTGTAGG - Intergenic
1116906594 14:50409640-50409662 TCTATGAATTTGACTACTATAGG + Intronic
1117427437 14:55615427-55615449 TTTATGAATTTGACTACTCTGGG + Intronic
1117702744 14:58430940-58430962 TCTATGAATTTGACTACCCTAGG + Intronic
1117758646 14:59003125-59003147 TCTATGAATTTGACTATTCTGGG - Intergenic
1117839500 14:59844524-59844546 TTCATGAATTTGACTACTCTAGG - Intronic
1118185753 14:63536810-63536832 TCTATGAATTTGACTACTCTAGG - Intronic
1118601651 14:67474763-67474785 TCTATGAATTTGACTACTCTGGG + Intronic
1118755525 14:68840571-68840593 TCCATGGTTTTGACTACTCTAGG - Intergenic
1118768182 14:68924058-68924080 GTCTCTGATTTGACTACTCTAGG - Intronic
1118772242 14:68949894-68949916 TCTATGAATTTGACTACTCTAGG - Intronic
1118794086 14:69124024-69124046 TCTATGGATTTGTCTACTCTAGG + Intronic
1119314901 14:73685317-73685339 TTTACGAATTTAACTACTCTAGG + Intronic
1119596311 14:75937570-75937592 TCTATGAATTTGACTACTCTAGG + Intronic
1120868230 14:89313923-89313945 TCTACGAATTTGACTACTCTGGG - Intronic
1120918520 14:89731608-89731630 TCTATGAATTTGACTACTCTAGG + Intergenic
1121247129 14:92469848-92469870 TCTATAGATTTGACTATTCTGGG - Intronic
1121300692 14:92868328-92868350 TCTATGCATTTGACTATTCTAGG - Intergenic
1121700494 14:95950276-95950298 TCTACAATTTTGACTACTCTAGG + Intergenic
1121800716 14:96771921-96771943 TCTATGAATTTGACTACTATTGG - Intergenic
1122017017 14:98804928-98804950 TCTATGAATCTGACTACTCTAGG - Intergenic
1122158463 14:99765426-99765448 TCTATGAATTTGACTGCTCTAGG + Intronic
1122254309 14:100465409-100465431 TCTATGATTTTGACTACTCTGGG + Intronic
1122295374 14:100702650-100702672 TCTACGAGTTTGACTACTCTGGG + Intergenic
1122404876 14:101494472-101494494 TCTATGAATTTGACTATTCTAGG - Intergenic
1122679982 14:103452415-103452437 TCTATGAATTTGACTACTCTTGG + Intronic
1122873888 14:104654149-104654171 TCTGCGGTTTTGACTGCTCTGGG - Intergenic
1123889907 15:24766644-24766666 TCTATGAATTTGACTACCCTAGG - Intergenic
1123980599 15:25598596-25598618 TCCGTGAATTTGACTACTCTAGG - Intergenic
1123988135 15:25663041-25663063 TCCCTGAATCTGACTACTCTGGG + Intergenic
1123989338 15:25671887-25671909 TGCACAAGTTTGACTACTCTAGG + Intergenic
1124594949 15:31084412-31084434 TCTATGGATTTGCCTATTCTGGG + Intronic
1124608505 15:31191373-31191395 GCTATGGATTTGACTACTCGAGG - Intergenic
1124621716 15:31277791-31277813 TCTGTGGATTTGGCTACTCTGGG - Intergenic
1124692134 15:31832649-31832671 TCTATGAATTTGACGACTCTAGG + Intronic
1125275579 15:37986653-37986675 TCTATGAATTTGACTACTTTAGG + Intergenic
1125456034 15:39859750-39859772 TCTACGAATTTGACTACTTTAGG - Intronic
1125735594 15:41923201-41923223 TCTATGAATTTGACTACTCTAGG + Intronic
1125771677 15:42171805-42171827 TCCATGAATCTGCCTACTCTAGG + Intronic
1125865355 15:43042466-43042488 TCTATGAATTTGACTACTCTAGG - Intronic
1125871798 15:43108918-43108940 TCTATGAATTTGACTACTCTAGG - Intronic
1125873735 15:43125539-43125561 TCTGTGAATTTGACTACTCTAGG + Intronic
1126427507 15:48545508-48545530 TCTATGAATTTGACTGCTCTGGG - Intronic
1126461036 15:48914950-48914972 TCTTTGGATTTGACTACTGTAGG + Intronic
1126461667 15:48921248-48921270 TCTATGGATTTGACTGGTCTAGG - Intronic
1126640032 15:50814936-50814958 TCTATGAATTTGACTACTTTAGG + Intergenic
1126646316 15:50878228-50878250 TCTATGAATTTGACTATTCTAGG - Intergenic
1127312403 15:57764174-57764196 TCCATGAATTTGACTGCTCTAGG + Intronic
1127315050 15:57787225-57787247 TCTATGAATTTTACTACTCTAGG - Intergenic
1127331711 15:57946320-57946342 TCTATGAATTTGACTACTCTAGG + Intergenic
1127442556 15:59024875-59024897 TCTATGAATTTGACTACTCTGGG + Intronic
1127710304 15:61590820-61590842 ACTATGAATTTGACTACTCTAGG - Intergenic
1128287349 15:66448228-66448250 TCTATGAGTTTGACTACTCTAGG + Intronic
1128416868 15:67454605-67454627 TCCATGGATTTCCCTATTCTAGG + Intronic
1128643331 15:69356687-69356709 TCTAGGAATTTGACTACTCCAGG + Intronic
1128897549 15:71389331-71389353 TCTCTGAATTTGACTACTCTAGG + Intronic
1128899216 15:71404292-71404314 TCCATGGATTTGAATATTCTGGG + Intronic
1129042235 15:72698439-72698461 TCTATGAATTTGACTATTCTAGG + Intronic
1129279170 15:74470196-74470218 TCCATGATTTTAACTACTCTAGG - Intergenic
1129602147 15:77005691-77005713 TCTATGGATTTGCCTATTCTAGG + Intronic
1129765975 15:78167710-78167732 TCTATGAATTTGACTACTCTAGG + Exonic
1129860398 15:78856209-78856231 TCGATGAATTTGACTATTCTAGG - Intronic
1130114763 15:80997153-80997175 TCTATGAATTTGACTACCCTAGG - Intergenic
1130164647 15:81441027-81441049 TCTATGAATTTGACTACTCTAGG - Intergenic
1130338862 15:82981790-82981812 TTTATGAATTTGACTACTCTAGG - Intronic
1130533380 15:84765120-84765142 TCTATGAATTTGCCTACTCTAGG + Intronic
1130616010 15:85408528-85408550 TCTATGGATTTGACTATTCTGGG + Intronic
1130636531 15:85626454-85626476 TCTATGAATTTGACTGCTCTAGG + Intronic
1130731738 15:86500701-86500723 TCTACGGATTTTTCTATTCTGGG + Intronic
1131006779 15:88984923-88984945 TCTACAGATTTGCCTAGTCTGGG - Intergenic
1131123686 15:89839998-89840020 TCTCTGAATTTGACTACTCTGGG - Intronic
1131159717 15:90097608-90097630 TCTATGAATTTGACTATTCTAGG - Intronic
1131451320 15:92542610-92542632 TTTACGGATTTGCCTATTCTAGG - Intergenic
1132007554 15:98243052-98243074 TCTATGAATTTGACTACTCCAGG - Intergenic
1132241152 15:100257956-100257978 TCTACGAATCTGACTACTGTAGG + Intronic
1132301370 15:100778127-100778149 TCTATGGATTTGCCTATTCTGGG + Intergenic
1132476378 16:140717-140739 TCTATGGATTTGCCTATTCTGGG - Intergenic
1133160211 16:3906689-3906711 TCTATGAATTTGACTCCTCTAGG - Intergenic
1134004961 16:10812686-10812708 TGTATGCATTTGACTACTCTAGG - Intronic
1134323613 16:13186769-13186791 TCTATGAATTTGACTACTCCAGG + Intronic
1135055648 16:19229997-19230019 TCTATGAGTTTGACTACTCTAGG - Intronic
1135068044 16:19327538-19327560 TCTATGAATTTGACTACTCTGGG + Intergenic
1135146177 16:19964722-19964744 TCTATGAATTTGACTACTCTAGG + Intergenic
1135199687 16:20426695-20426717 TCTATGAATTTGACTACTCTTGG - Intronic
1135219015 16:20596915-20596937 TCTATAAATTTGACTACTCTTGG + Intergenic
1135337813 16:21618575-21618597 TCTATGAATTTGACTATTCTGGG + Intronic
1135346414 16:21692479-21692501 TCTATGAATTTGACTGCTCTAGG - Intronic
1135377585 16:21962125-21962147 TCTACAAATTTGACTACTCCAGG + Intronic
1135510524 16:23079005-23079027 TCTGTGAATTTGACTACTCTTGG - Intronic
1135606225 16:23827338-23827360 TCTATGAATTTGACTACTCCAGG - Intergenic
1135702843 16:24647922-24647944 TCTATGAGTTTGACTACTCTAGG + Intergenic
1135768863 16:25200894-25200916 TCCATGAATTTGACTACTTTAGG - Intergenic
1135770585 16:25215166-25215188 TCTATGAATTTGACTAGTCTAGG + Intergenic
1136094097 16:27941887-27941909 TCTATGAATTTGACTACTTTGGG - Intronic
1136129220 16:28209122-28209144 TCTATGAATTTGACTACTTTAGG - Intronic
1137779193 16:51083044-51083066 TCTATGAATTTGACTACTCTAGG - Intergenic
1137912725 16:52394653-52394675 TCTATGAATTTGATTACTCTAGG - Intergenic
1137963146 16:52905767-52905789 TCAGTGAATTTGACTACTCTAGG - Intergenic
1138123636 16:54421181-54421203 TTCATGAATTTGACTACTCTAGG + Intergenic
1138407046 16:56804494-56804516 TCTGTGAATTTGACTACTCTAGG - Intronic
1138618385 16:58191159-58191181 TCTATGAATTTGACTACTCCAGG - Intronic
1138625191 16:58246204-58246226 TCTATGAATTTGACTACTCTAGG - Intronic
1138628910 16:58277863-58277885 TCTATGAATTTGACTACTCTGGG - Intronic
1138636530 16:58343383-58343405 TCTGTGAATTTGACTACTCTAGG + Intronic
1139142032 16:64277199-64277221 TCTAGGAATTTGACTACTCTAGG + Intergenic
1139142317 16:64281465-64281487 TCTTTGAATTTGACTACTCTAGG + Intergenic
1140184601 16:72756235-72756257 TCTATGCATTTGACTACTCTAGG + Intergenic
1140331070 16:74057464-74057486 TCCAAGGATTTGACTCCTCGAGG - Intergenic
1140390357 16:74581429-74581451 TCTGTGAATTTGACTACTCTAGG - Intronic
1140862797 16:79033765-79033787 TCTATGAATTCGACTACTCTTGG + Intronic
1141162645 16:81639454-81639476 TCTAAGAATTTGTCTACTCTAGG + Intronic
1141729931 16:85815241-85815263 TCTACGAATTTGACTAGTCTAGG + Intergenic
1141732412 16:85831530-85831552 GCTACGATTTTGACTACTCTAGG + Intergenic
1141858921 16:86703482-86703504 TCCATGAATCTGACTACTCTAGG - Intergenic
1142471879 17:169293-169315 TCTATGGATTTGACTATTCTAGG - Intronic
1142475869 17:189528-189550 TCTACGAATTTGCCTATTCTAGG - Intergenic
1142820448 17:2462265-2462287 TCTATGAACTTGACTACTCTAGG - Intronic
1142985686 17:3694281-3694303 TCTATGGATTTGCCTATTCTGGG - Intronic
1143384593 17:6520924-6520946 TCCATGAATTTGACTTCTCTAGG - Intronic
1143671985 17:8403280-8403302 TCTACGATTTTGACTGCTCTAGG - Intergenic
1143715500 17:8765304-8765326 TCTATGAATTTGATTACTCTAGG + Intergenic
1143849145 17:9796444-9796466 TCTATGGTTGTGACTACTCTGGG - Intronic
1143852522 17:9823388-9823410 TCTATGAATTTGACTACTCTAGG + Intronic
1143910128 17:10241589-10241611 TCTATGAATTTGCCTACTCTAGG + Intergenic
1143930326 17:10416156-10416178 TCTGTGAATTTGACTACTCTAGG + Intronic
1143931043 17:10425392-10425414 TCTATGGATTTGCCTATTCTGGG - Intergenic
1144009088 17:11128294-11128316 TCTATGAATTTGACTACTCTAGG - Intergenic
1144337423 17:14284114-14284136 TCTAGGAATCTGACTACTCTGGG - Intergenic
1144511035 17:15876954-15876976 ACTATGAATTTGACTACTCTAGG + Intergenic
1144566248 17:16362039-16362061 TCTACTGATTTGACTACTCTAGG - Intergenic
1144681328 17:17197436-17197458 CTCACAGATTTGCCTACTCTGGG - Intronic
1144805309 17:17962187-17962209 ACTATGAATTTGACTACTCTAGG - Intronic
1145175193 17:20694641-20694663 ACTATGAATTTGACTACTCTAGG + Intergenic
1145304367 17:21665061-21665083 TCTATGGATTTGACTACTCTAGG + Intergenic
1146023109 17:29295514-29295536 TCTACGAACTTGACTATTCTAGG + Intergenic
1146452981 17:32989540-32989562 TCCATGAATTTGACTATTCTAGG - Intronic
1146606401 17:34261837-34261859 TCTATGAATTTGACTACTTTAGG + Intergenic
1147475203 17:40704789-40704811 TCTGTGAATTTGACTACTCTAGG - Intergenic
1148035012 17:44653739-44653761 TCTATGAATTTGACTACTCTAGG - Intergenic
1148709566 17:49668026-49668048 TCTAGGAATTTCACTACTCTAGG - Intronic
1148829620 17:50422807-50422829 TCTAAGAATTTGACTACTCTAGG + Intergenic
1149398781 17:56272354-56272376 TCTATGAATTTGACTACTCTAGG + Intronic
1149417223 17:56471828-56471850 TGCATGGATTTGCCTATTCTGGG - Intronic
1149510382 17:57236389-57236411 TGTAGGAATTTGACTACTCTGGG + Intergenic
1149526854 17:57363290-57363312 TCTATGGATTTGACTGCTCTAGG - Intronic
1149748955 17:59127047-59127069 TCTATCAATTTGACTACTCTAGG - Intronic
1149786077 17:59436201-59436223 TCTATGAACTTGACTACTCTAGG + Intergenic
1149849889 17:60028030-60028052 TCCATGGATGTGACTGTTCTAGG + Intergenic
1149860279 17:60118494-60118516 TCCATGGATGTGACTGTTCTAGG - Intergenic
1150110296 17:62493175-62493197 TCTGTGAATTTGACTACTCTAGG + Intronic
1150447230 17:65236003-65236025 TCTGTGAATTTGACTACTCTAGG - Intergenic
1150474226 17:65462153-65462175 TCTATGAATTTGGCTACTCTGGG + Intergenic
1150617216 17:66781635-66781657 TGCTATGATTTGACTACTCTAGG - Intronic
1150694561 17:67393373-67393395 TCTGTGAATTTGACTACTCTAGG + Intronic
1150706105 17:67488791-67488813 TCCCTGAGTTTGACTACTCTAGG + Intronic
1151080782 17:71325976-71325998 TCTATGAATTTGACTACTCTAGG + Intergenic
1151217289 17:72585949-72585971 TCTATGAATTTGGCTACTCTGGG - Intergenic
1151775744 17:76200504-76200526 TCTATGAGTTTGACTACTCTAGG - Intronic
1151863666 17:76785256-76785278 TCCATGAATTTGTCTACTCTAGG - Intergenic
1151949799 17:77345104-77345126 TCTCTGAATTTGACTACTCTAGG - Intronic
1152147770 17:78579366-78579388 TTAATGAATTTGACTACTCTAGG - Intergenic
1152154612 17:78624708-78624730 TCTACAGATTTGCCTATTCTGGG - Intergenic
1152156358 17:78636042-78636064 TCTACGAATTTGACTCCTCTAGG - Intergenic
1152187912 17:78869943-78869965 TCTGTGGATTTGACTACTCCAGG - Intronic
1152364302 17:79846161-79846183 TCTATGAATTTGACTACTCTGGG + Intergenic
1152863028 17:82706734-82706756 TCTACAGATTTGACAACTCTAGG + Intergenic
1153012500 18:551804-551826 TCTATGAAGTTGACTACTCTAGG - Intergenic
1153023205 18:650569-650591 TCTATGAATTTGACTACTCTAGG + Intronic
1153169741 18:2302309-2302331 TCTATGCATTTGACTATTCTGGG - Intergenic
1153283216 18:3433543-3433565 TCCATGAATTTGACTATTCTAGG - Intronic
1153546369 18:6209927-6209949 TCTATGGATTTGTCTAGTCTGGG - Intronic
1153616491 18:6939764-6939786 TCTACACATTTGACCACTCTGGG - Intergenic
1153630392 18:7063796-7063818 TCTATGAATTTGATTACTCTGGG - Intronic
1153734013 18:8045605-8045627 TCTACAGATTTTCCTACTCTGGG - Intronic
1153744594 18:8164636-8164658 TCTATGAATTTGACTACTCTAGG - Intronic
1153883461 18:9440683-9440705 TCTACAAATTTGACTACTGTAGG - Intergenic
1153885963 18:9466657-9466679 TCTATGAATTTGACTTCTCTAGG + Intergenic
1153903076 18:9636325-9636347 TCCATCAATTTGACTACTATAGG - Intergenic
1154000866 18:10481475-10481497 TCTGTGGATTTGACTATTCTAGG - Intronic
1154032495 18:10765975-10765997 TCCTCTGATTTGACTTCTCTAGG - Intronic
1154102773 18:11491272-11491294 TCCTGGGATTTTACTACTCTGGG - Intergenic
1154192228 18:12239799-12239821 TCTATGAATTTGACTACTCTAGG + Intergenic
1154319909 18:13339987-13340009 TCTATGAATTTGATTACTCTAGG + Intronic
1155067660 18:22281725-22281747 TCTATGAATTTGACTTCTCTAGG - Intergenic
1155314335 18:24556676-24556698 TCTATGAATTTGATTACTCTAGG - Intergenic
1155383915 18:25256198-25256220 TCTATGAATTTGACTACTCTAGG - Intronic
1155443129 18:25882958-25882980 TCCATGGATTTGAGTATTCATGG + Intergenic
1155557701 18:27039443-27039465 TCAATAAATTTGACTACTCTGGG - Intronic
1155579834 18:27290965-27290987 TCTATGAATTTGACTATTCTAGG - Intergenic
1155836181 18:30587650-30587672 TCTATGAATTTGACTATTCTAGG + Intergenic
1156256821 18:35406269-35406291 TCTATGAATTTGACTACTCTAGG - Intergenic
1156506887 18:37601912-37601934 TCTATATATTTGACTACTCTAGG + Intergenic
1157162583 18:45327584-45327606 TCTATGAATTTGACTACTCTAGG + Intronic
1157500537 18:48187495-48187517 TTTATGGATTTGACTTCTCTAGG - Intronic
1157593499 18:48850066-48850088 TGTATGAATTTGACTACTCTAGG + Intronic
1157658210 18:49414106-49414128 TCTATGAATTTGACTACTCTGGG - Intronic
1157704861 18:49797167-49797189 TCTATGAATTTGACTACGCTAGG + Intronic
1157822832 18:50786357-50786379 TTTATGAATTTGACTACTCTAGG + Intergenic
1157886076 18:51368014-51368036 TCTATGAATTTGACTATTCTAGG + Intergenic
1157995426 18:52548929-52548951 TTCACAGATTTGACTATACTTGG + Intronic
1158280941 18:55825532-55825554 TCTATGAATTTGACTACCCTAGG + Intergenic
1158391790 18:57050640-57050662 TGCAGGGATTTGACTGCTGTGGG - Intergenic
1158430662 18:57383489-57383511 TCCATTAATTTGACTGCTCTAGG + Intergenic
1158577310 18:58649554-58649576 TCTATAAATTTGACTACTCTAGG - Intergenic
1158651177 18:59287674-59287696 TCTATGAATTTGATTACTCTAGG - Intronic
1158764200 18:60428884-60428906 TCTATAAATTTGACTACTCTAGG - Intergenic
1158826821 18:61230560-61230582 TCTATAAATTTGACTACTCTGGG - Intergenic
1158895223 18:61906333-61906355 TCTATGAATTTGACTTCTCTGGG + Intergenic
1158917529 18:62150614-62150636 TCTATGCATTTGACTACTCTAGG - Intronic
1159036328 18:63281111-63281133 TCTATGAACTTGACTACTCTAGG - Intronic
1159611732 18:70533132-70533154 TCCTTGAATTTCACTACTCTAGG - Intergenic
1160497668 18:79384627-79384649 TCCATGGATCTGACAACTCCGGG - Intergenic
1161641899 19:5429191-5429213 TCCAGGAATTTGCCTCCTCTAGG - Intergenic
1162610344 19:11745101-11745123 TCCATGAATTTGACTATTCTAGG - Intergenic
1162773036 19:12961463-12961485 TCTATGAATTTGACTACTCTAGG + Intergenic
1162866642 19:13552925-13552947 TCTATGAATTTGACTACTCTAGG + Intronic
1163044020 19:14625873-14625895 TATATGGATTTGACTACTTTAGG - Intronic
1163370518 19:16898651-16898673 TCTACGGATTTGCCTGTTCTGGG + Intronic
1163620019 19:18353691-18353713 TCTATGGATTTGCCTGCTCTGGG + Intronic
1163887250 19:19977300-19977322 TCCAAGGATTTGCCTATTTTGGG + Intergenic
1164701799 19:30290076-30290098 TCTGTGAATTTGACTACTCTAGG + Intronic
1165213405 19:34253063-34253085 TCTATGTTTTTGACTACTCTAGG + Intergenic
1165220523 19:34312495-34312517 TCTATAAATTTGACTACTCTAGG + Intronic
1165864584 19:38928848-38928870 TCTATGAATTTGATTACTCTAGG + Intronic
1166270949 19:41713625-41713647 TCCACAAGTGTGACTACTCTAGG + Intronic
1166276876 19:41760212-41760234 TCCATGAGTGTGACTACTCTAGG + Intronic
1166282708 19:41805607-41805629 TCCATGAGTTTGACTACTCTAGG + Intronic
1166419809 19:42627682-42627704 TCCATGAGTTTGACTACCCTAGG + Intronic
1166424069 19:42660668-42660690 TTCATGAGTTTGACTACTCTAGG - Intronic
1166431425 19:42731018-42731040 TCCATGGGTTCGACTACTCTAGG + Intronic
1166434544 19:42756225-42756247 TCCCTGGATTCGACTACTCTAGG + Intronic
1166444423 19:42846253-42846275 TCCATGGGTTCGACTACTCTAGG + Intronic
1166447400 19:42869996-42870018 TCCATGGGTTCAACTACTCTAGG + Intronic
1166454313 19:42927678-42927700 TCCTTGGGGTTGACTACTCTAGG + Intronic
1166470260 19:43073590-43073612 TCCCTGGGTTCGACTACTCTAGG + Intronic
1166481391 19:43177110-43177132 TCCATGGATTCGACTACTCTAGG + Intronic
1166483862 19:43196234-43196256 TCCCTGGGTTCGACTACTCTAGG + Intronic
1166610405 19:44188354-44188376 TCCACAGATTCAACTAATCTTGG + Intergenic
1167228755 19:48268173-48268195 TCCAGGAATTTGACTGTTCTAGG - Intronic
1167539935 19:50079325-50079347 CCTATGAATTTGACTACTCTAGG + Intergenic
1167588370 19:50388109-50388131 TCCATGGATCTGCCTATTCTGGG - Intronic
1167629767 19:50618443-50618465 CCTATGAATTTGACTACTCTAGG - Intergenic
1167707223 19:51088551-51088573 TCTATGAATTTGACTACTCTAGG + Intergenic
1168234994 19:55057176-55057198 TCTATGGATTTGCCTATTCTGGG - Intronic
1168408675 19:56124689-56124711 TCTATGAATTTGACTTCTCTAGG - Intergenic
1168505412 19:56929851-56929873 TTTATGAATTTGACTACTCTAGG - Intergenic
1168505968 19:56935355-56935377 TCTATGAATTTGACTACTTTTGG + Intergenic
925332423 2:3069115-3069137 TCTATGGATCTGACTACTCTAGG - Intergenic
925925261 2:8665580-8665602 TCCACGAACGTGACTACTCTAGG - Intergenic
926015200 2:9445205-9445227 TCTATGAATTTGACTATTCTAGG + Intronic
926033778 2:9617413-9617435 TCTATGAATTTGACTACTCTAGG - Intronic
926633723 2:15159560-15159582 TCTATGAATTGGACTACTCTAGG - Intergenic
926713437 2:15902838-15902860 TCTATGAATTTGACTATTCTAGG - Intergenic
927116387 2:19906756-19906778 TCTATGAATTTGACTACTCTGGG - Intergenic
927144340 2:20151879-20151901 TCTACGAATTTGACTATTCCAGG + Intergenic
927687376 2:25180809-25180831 TCTATGGATTTGCCTATTCTGGG - Intergenic
927750826 2:25669061-25669083 TCTATGAATTCGACTACTCTAGG - Intronic
927767489 2:25825490-25825512 TCTATGAATCTGACTACTCTAGG + Intronic
928017861 2:27675288-27675310 TCTATGAATTTGACTACTTTAGG + Intronic
928232108 2:29507313-29507335 TATATGAATTTGACTACTCTAGG - Intronic
928248025 2:29648556-29648578 TCTGTGAATTTGACTACTCTAGG + Intronic
929196987 2:39195014-39195036 TCCATGAATTTGACTATTCTAGG + Intronic
929658738 2:43760839-43760861 TCTATGCATTTGACTACTTTAGG + Intronic
930138800 2:47930875-47930897 TCTAAGAATTTGACTGCTCTAGG - Intergenic
930435926 2:51342017-51342039 TCCAGGGTCTTGAATACTCTAGG + Intergenic
930996037 2:57719666-57719688 TCTATGAATTTGACTACTTTAGG - Intergenic
932164119 2:69490599-69490621 TCTATGAATTTTACTACTCTAGG - Intronic
932226908 2:70048578-70048600 TCAAAGTATTTGACTTCTCTGGG + Intergenic
932346083 2:70996040-70996062 CCCATGATTTTGACTACTCTGGG - Intergenic
932643462 2:73476097-73476119 TCTATGAATTTGGCTACTCTAGG + Intronic
933046707 2:77547093-77547115 TCTACGAATTTGACTATTCTAGG - Intronic
933676818 2:85064524-85064546 TCCATGGATTTGCCTGTTCTGGG - Intergenic
933737839 2:85509594-85509616 TCTATGAATTTGACTACACTAGG - Intergenic
933809517 2:86024298-86024320 TCTACGAATTTGACTTCTCTAGG - Exonic
934049628 2:88199471-88199493 TCTATGAATTTGACTACTCTAGG - Intergenic
934515586 2:94984480-94984502 TCTATGGATTTGCCCACTCTAGG - Intergenic
934777039 2:96946045-96946067 TCTATGAATTTGACTACCCTGGG + Intronic
935104684 2:100029600-100029622 TCAATGAATTTGACTACCCTAGG - Intronic
935121708 2:100188708-100188730 TCTATGGATTTGACTATTCCAGG + Intergenic
935277677 2:101489551-101489573 TCTATGAATTTGACTACTCTAGG + Intergenic
935557242 2:104523360-104523382 TCCATGAATTTGGCTATTCTAGG - Intergenic
935570142 2:104651186-104651208 TCTACGAATCTGACTACTCTAGG - Intergenic
935574319 2:104693090-104693112 TGTATGTATTTGACTACTCTAGG + Intergenic
935595631 2:104875042-104875064 TCTAGGAATCTGACTACTCTAGG + Intergenic
935641162 2:105291709-105291731 TCTATGAATTTGACTACTCTAGG - Intronic
935683466 2:105659926-105659948 TCTGTGAATTTGACTACTCTGGG - Intergenic
935711950 2:105907012-105907034 TCTACGAATTTGACTATTCTAGG + Intergenic
935823814 2:106921329-106921351 TCCATGGATTTGGTTACTTTAGG + Intergenic
935901307 2:107796645-107796667 TCTATGAATCTGACTACTCTAGG + Intergenic
935973651 2:108556147-108556169 TCTATGAATTTGCCTACTCTAGG + Intronic
936107938 2:109641531-109641553 TCTATGAATTTGACTACTGTAGG - Intergenic
936264281 2:110989554-110989576 TCTACGAATTTGACTACTCTAGG - Intronic
936415345 2:112303590-112303612 TCTATGGATTTGCCTATTCTAGG + Intronic
936467407 2:112765381-112765403 TCTATGGATTTGACAACTGTAGG + Intergenic
936558575 2:113517024-113517046 TCCATGATTTTGACTACTCTAGG + Intergenic
936897040 2:117439421-117439443 TCTATGAATTTGACTATTCTAGG - Intergenic
937142735 2:119616002-119616024 TCTACGGATTTGCCTTTTCTGGG + Intronic
937184588 2:120028323-120028345 TCCAGGAGTTTGACTAGTCTGGG + Intronic
937376935 2:121343604-121343626 TCCATGAATTTGACTACCCCAGG - Intronic
937396156 2:121536726-121536748 TCAGTGAATTTGACTACTCTAGG - Intronic
937413809 2:121698611-121698633 ACTACAAATTTGACTACTCTAGG - Intergenic
937424137 2:121783866-121783888 ACTACAAATTTGACTACTCTAGG - Intergenic
937669049 2:124519122-124519144 TCTATGGATTTGCCTATTCTGGG - Intronic
937824439 2:126351542-126351564 TCTATGAATTTGAGTACTCTAGG - Intergenic
937882817 2:126881308-126881330 TCCATGGATTTGACTATTCTAGG - Intergenic
938545382 2:132324700-132324722 TCTATGCATTTGACTTCTCTGGG + Intergenic
938898340 2:135775573-135775595 TCTACGGATTTGTCTATTTTGGG - Intronic
938925744 2:136040322-136040344 TCTATAGATTTGCCTACTCTAGG - Intergenic
939990052 2:148869339-148869361 CCCAGGAACTTGACTACTCTAGG + Intergenic
939998612 2:148944353-148944375 TCTATGAATTTGACTGCTCTAGG + Intronic
940177139 2:150890866-150890888 TGCATAAATTTGACTACTCTAGG - Intergenic
940224385 2:151386444-151386466 TCCACACATTTGAATATTCTCGG - Intergenic
940287334 2:152045461-152045483 TCCATAAATTTGACTACTGTAGG - Intronic
940523277 2:154779375-154779397 TCCAAGGATTTGAGTCCTTTAGG - Intronic
940645653 2:156390135-156390157 TCTATGCATTTGATTACTCTAGG - Intergenic
940839469 2:158562429-158562451 TCTATGAATTCGACTACTCTAGG - Intronic
940854778 2:158721576-158721598 TCTATGGATTTGACTCCTCTAGG - Intergenic
940920618 2:159302178-159302200 TCTATGAATTTGACTACTCTAGG - Intergenic
940941219 2:159563610-159563632 TCTATGAATTTGACTATTCTGGG - Intronic
940963570 2:159812895-159812917 TCTATGAATTTGACAACTCTGGG + Intronic
941097396 2:161254628-161254650 TCTATGAATCTGACTACTCTAGG - Intergenic
941359006 2:164529197-164529219 TCTATGAATTTGACTATTCTAGG - Intronic
941687849 2:168465671-168465693 TCTATGAATCTGACTACTCTAGG - Intronic
941728911 2:168894011-168894033 TCTATGAATCTGACTACTCTAGG + Intronic
941799958 2:169648243-169648265 TCAATGGATTTGATTATTCTAGG - Intronic
941915121 2:170807106-170807128 TTGATGAATTTGACTACTCTAGG + Intergenic
941955830 2:171203395-171203417 TGTATGAATTTGACTACTCTAGG + Intronic
941975345 2:171398444-171398466 TCTATCGGTTTGACTACTCTAGG - Intronic
943021230 2:182576267-182576289 TCTATGAATTTGACTACTGTAGG + Intergenic
943276862 2:185878247-185878269 TCCTTGGAATTTACTACTCTGGG - Intergenic
943642857 2:190378273-190378295 TCTATGAATTTGACTATTCTAGG + Intergenic
943715466 2:191147447-191147469 TCTGTGAATTTGACTACTCTAGG - Intronic
943787346 2:191892638-191892660 TCTATGAATTTGACTACTCTAGG + Intergenic
943789639 2:191917827-191917849 TTAAGGGATTTTACTACTCTTGG + Intergenic
944103073 2:196050281-196050303 TCTATGTATTTGACTACTCTAGG - Intronic
944135594 2:196396156-196396178 TCTATGAATTTGATTACTCTAGG - Intronic
944185269 2:196941057-196941079 TCTATGAATATGACTACTCTAGG - Intergenic
944216140 2:197257938-197257960 TCTCTGAATTTGACTACTCTAGG + Intronic
944462101 2:199960482-199960504 TCCACAGATTTAACCAATCTAGG + Intronic
944839690 2:203613118-203613140 TCTAAGAATTTGACTATTCTAGG - Intergenic
945157496 2:206855068-206855090 TCTATGAATTTGACTACTCTGGG - Intergenic
945255913 2:207802944-207802966 TCTGTGAATTTGACTACTCTAGG + Intergenic
945459916 2:210093999-210094021 TATATGAATTTGACTACTCTAGG - Intronic
946459061 2:219852820-219852842 TCCATGAGTTTGACCACTCTAGG + Intergenic
946471058 2:219961397-219961419 TTTATGAATTTGACTACTCTAGG + Intergenic
946713638 2:222531461-222531483 TCTATGAATTTGATTACTCTAGG - Intronic
947161156 2:227216016-227216038 TCTATGAATTTGACTACTGTAGG - Intronic
947497908 2:230652030-230652052 TCTATGACTTTGACTACTCTAGG + Intergenic
947539457 2:230965044-230965066 TCTGTGAATTTGACTACTCTAGG - Intergenic
947540371 2:230973300-230973322 TCTATGCATTTGACTACCCTAGG - Intergenic
947726333 2:232403097-232403119 TCTATGAATTTGACTCCTCTAGG + Intergenic
947769181 2:232657268-232657290 TCGATGATTTTGACTACTCTAGG + Intronic
947850915 2:233287200-233287222 TCCACTGATTTGAACACCCTGGG - Intronic
948306219 2:236948828-236948850 TCTATGAATTTGACTACTCTAGG - Intergenic
948493301 2:238327787-238327809 TCTATGAATCTGACTACTCTAGG + Intronic
948649429 2:239431099-239431121 TCTATGCATTTGACTACGCTAGG - Intergenic
948687603 2:239678860-239678882 TCCTCGCATGTGGCTACTCTAGG + Intergenic
948927713 2:241110241-241110263 TCTATGAATCTGACTACTCTAGG - Intronic
1168871193 20:1130108-1130130 TCTACAAATTTGACTAATCTAGG - Intronic
1169387220 20:5160758-5160780 TCTACGAATTTGACTACTCTAGG + Intronic
1169536621 20:6550703-6550725 TCTATGGATTTGCCTATTCTCGG - Intergenic
1169604257 20:7297964-7297986 TTTACGAATTTAACTACTCTAGG + Intergenic
1169675502 20:8148858-8148880 TCCATGAATTTGACTACTCCAGG - Intronic
1169801065 20:9512373-9512395 TCAACCCATTTGAGTACTCTAGG + Intergenic
1169915684 20:10680885-10680907 TCTATGAATTTGACTACCCTAGG + Intergenic
1169939073 20:10917568-10917590 TCCATGAGTTTGACTACTATAGG - Intergenic
1170216476 20:13897018-13897040 TACACGATTTTGACTACTGTAGG - Intronic
1170221880 20:13950110-13950132 TCCCTGAATTTGACTACTTTAGG - Intronic
1170474612 20:16702366-16702388 TCTATGAATTTGACTACTCTAGG + Intergenic
1170504175 20:17007581-17007603 TCTATGAATTTGACTACACTAGG + Intergenic
1170712070 20:18800369-18800391 TCTATGAATTTGACTACTCCAGG + Intergenic
1170784823 20:19458579-19458601 TGTATGAATTTGACTACTCTAGG + Intronic
1170966847 20:21081371-21081393 TCTATGAATTTGACTACTGTGGG - Intergenic
1170986095 20:21260309-21260331 TCTATGAATTTGCCTACTCTAGG + Intergenic
1171131341 20:22656366-22656388 TCTATGAATTTGACTACTCTAGG + Intergenic
1172265989 20:33614609-33614631 CCTATGGATTTAACTACTCTAGG + Intronic
1172321259 20:33996828-33996850 TCTGTGAATTTGACTACTCTAGG + Intronic
1172336572 20:34121573-34121595 TCTATGAATTTGACTATTCTAGG - Intergenic
1172485483 20:35295375-35295397 TCTATGAATTTGACTCCTCTAGG + Intergenic
1172611254 20:36254382-36254404 TCTATGAATCTGACTACTCTAGG - Intronic
1172724962 20:37032357-37032379 TCTGTGAATTTGACTACTCTAGG - Intronic
1173145096 20:40517891-40517913 TCTATGAACTTGACTACTCTAGG - Intergenic
1173216460 20:41089367-41089389 TCTATGAATTTGACTACTTTAGG + Intronic
1173312769 20:41915302-41915324 TCTATGGATTAGACTACTCTGGG + Intergenic
1174208744 20:48860314-48860336 TCTATGATTTTGACTACTCTAGG - Intergenic
1174500900 20:50983430-50983452 TCTGTGAATTTGACTACTCTAGG - Intergenic
1174936293 20:54873877-54873899 TCTATGGATTTGCCTATTCTAGG - Intergenic
1176655696 21:9587490-9587512 TCTATGGATTTGACTACTCTAGG + Intergenic
1177002438 21:15631023-15631045 TCTATGAATTTGACTACTCTAGG - Intergenic
1177520667 21:22218739-22218761 TCTACGAATTTGACTACTCTAGG + Intergenic
1178370080 21:32020287-32020309 TCTGTGAATTTGACTACTCTAGG + Intronic
1178415746 21:32403744-32403766 TTTATGGATTTGACTTCTCTGGG - Intergenic
1178427431 21:32490277-32490299 TCTGTGGATTTCACTACTCTAGG + Intronic
1178440862 21:32597170-32597192 TCTCTGGATCTGACTACTCTAGG + Intronic
1178468109 21:32867197-32867219 TCTACGAACTTGATTACTCTAGG + Intergenic
1178563996 21:33666256-33666278 TCCACAGATTTGCCTATTCTGGG - Intronic
1178621724 21:34183086-34183108 TCCACGGGTTTAACAAGTCTTGG - Intergenic
1178670669 21:34588949-34588971 TCTATGAATTTGACTACTTTAGG - Intronic
1178677077 21:34640107-34640129 TCTATGAATTTGACTATTCTAGG + Intergenic
1179076306 21:38125072-38125094 TCTAGGAATTTGACTACTCTAGG + Intronic
1179217845 21:39382461-39382483 TCTGTGAATTTGACTACTCTTGG + Intronic
1179245101 21:39626130-39626152 TCTATGGATTTTGCTACTCTAGG + Intronic
1179268994 21:39834009-39834031 TCTATGAATTTGACCACTCTAGG + Intergenic
1179302243 21:40123084-40123106 TCTCTGGATTTGACTCCTCTAGG - Intronic
1179311563 21:40200352-40200374 TCTATGAATTTGACTTCTCTGGG + Intronic
1179484826 21:41703584-41703606 TCTATGGATTTGACTACTCCGGG - Intergenic
1179900201 21:44388344-44388366 TCCATGAATTTGACTACTCCAGG - Intronic
1179920704 21:44505617-44505639 TCTATGAATTTGACCACTCTAGG + Intronic
1180114093 21:45685182-45685204 TCTCTGAATTTGACTACTCTTGG - Intronic
1180822725 22:18842495-18842517 TCTACGGATTTGCCTAGTCTAGG - Intergenic
1180914653 22:19477476-19477498 TCCATGAATTTGCCTACTCTAGG - Intronic
1180924155 22:19541810-19541832 TCCATGAATTTGACTACTCCAGG - Intergenic
1180924968 22:19547353-19547375 TCTATGAATTTGACTACTCTAGG + Intergenic
1180938302 22:19640338-19640360 TCCGTGGATTTGACTCCTCTAGG + Intergenic
1181190238 22:21133531-21133553 TCTATGGATTTGCCTAGTCTAGG + Intergenic
1181208964 22:21276993-21277015 TCTATGGATTTGCCTAGTCTAGG - Intergenic
1181347663 22:22231840-22231862 TGTAGGAATTTGACTACTCTAGG - Intergenic
1181364591 22:22365841-22365863 TCTATGGATTTCACTACTCTAGG - Intergenic
1181487491 22:23240882-23240904 TCTATGAATTTGACTACTCTAGG + Intronic
1181502937 22:23329205-23329227 TCTATGGATTTGCCTAGTCTAGG + Intergenic
1181579331 22:23818695-23818717 TCTATGAATTTGACTACTCGAGG + Intronic
1181611631 22:24017530-24017552 TCTATGAATTTGACTACTGTAGG + Intronic
1181653741 22:24277580-24277602 TCTATGGATTTGCCTAGTCTAGG + Intronic
1181749616 22:24979834-24979856 TCTATGAATTTGACTACTTTAGG + Intronic
1181784465 22:25216829-25216851 TCCATGAATTTGCCTACCCTAGG + Intergenic
1182275602 22:29186621-29186643 TCTATGATTTTGACTACTCTAGG - Intergenic
1182636261 22:31729695-31729717 TCTATGAATTTGACTACTCTAGG - Intronic
1182791457 22:32956484-32956506 TCAATAGATTTGACTACTCTAGG + Intronic
1182900740 22:33896137-33896159 TCTACAAATTTGACTACTGTAGG + Intronic
1183473730 22:38024149-38024171 TCTATGATTTTGACTACTCTGGG + Intronic
1183863602 22:40686609-40686631 TCTCTGGATTTGACTGCTCTAGG + Intergenic
1184016483 22:41789684-41789706 TCTATGAATTTGACTACTGTAGG + Intronic
1184346862 22:43918895-43918917 TCTATGAATCTGACTACTCTAGG - Intergenic
1184382834 22:44156812-44156834 TCTATGAATTTGACTCCTCTGGG - Intronic
1184537616 22:45098201-45098223 TCTATGAATTTGACTATTCTAGG - Intergenic
1184674557 22:46033928-46033950 TCTATGAATTTGACTATTCTCGG + Intergenic
1184756822 22:46520931-46520953 TCTATGAATTTGACTCCTCTAGG + Intronic
1184911395 22:47536954-47536976 TCCATGAATTTGACTTCTGTAGG + Intergenic
1184933491 22:47699397-47699419 TCTATGAATTTGACTATTCTAGG + Intergenic
1185407579 22:50663199-50663221 TCCATGTATTTGACTATTCTAGG - Intergenic
1203217975 22_KI270731v1_random:18455-18477 TCTACGGATTTGCCTAGTCTAGG + Intergenic
1203272862 22_KI270734v1_random:68402-68424 TCTATGGATTTGCCTAGTCTAGG - Intergenic
949276037 3:2282934-2282956 TCTATGGATTTGCCTATTCTGGG - Intronic
949407979 3:3734634-3734656 TCTATGAATTTGACTACTCTAGG - Intronic
949519418 3:4836196-4836218 TCCATGAATTTGACTGCTCCAGG - Intronic
949956411 3:9272452-9272474 TCCATGAATTTGACTACTCTAGG + Intronic
950278720 3:11686449-11686471 TCTAGGAATTTGACTATTCTGGG - Intronic
950286044 3:11745616-11745638 TCTATGAATTTGACTACTCTAGG - Intergenic
950409860 3:12828772-12828794 TCTATGAATTTGACTACTCTAGG + Intronic
950445881 3:13037802-13037824 TCCATGAATTTCACTGCTCTGGG - Intronic
950473675 3:13202569-13202591 TCCATGAGTTTGACTACTCCAGG - Intergenic
950527140 3:13531060-13531082 TCCATGAATTTGACTCCTCTAGG - Intergenic
950726079 3:14917876-14917898 TCCATGAATTTGACTACTATGGG + Intronic
950736687 3:15014696-15014718 TCCATGAATTTGACTACTCTAGG + Intronic
950769323 3:15298740-15298762 TCTATGAATTTGACTACCCTAGG - Intronic
950842476 3:15980605-15980627 TCTATGAATTTGACTCCTCTAGG - Intergenic
951354094 3:21642881-21642903 TCAATGAATTTGACTACTGTAGG - Intronic
951488319 3:23239482-23239504 TCTATGGATTTGTCTATTCTGGG + Intronic
951537674 3:23754437-23754459 TCTATGAATTTGACTATTCTAGG + Intergenic
951678562 3:25270417-25270439 TCTATGAATTTGACTACTTTAGG - Intronic
951905385 3:27701510-27701532 TCCACTTTTTTGACTATTCTAGG + Intergenic
952205586 3:31178853-31178875 TCTATGAATTTGACTACTCTGGG + Intergenic
952486835 3:33820608-33820630 TCTATGAATTTGATTACTCTAGG + Intronic
952770823 3:36998616-36998638 TCTATGAATGTGACTACTCTAGG - Intronic
952796827 3:37246554-37246576 TCTAAGAATTTGACTACTCTAGG - Intronic
952804799 3:37338790-37338812 TCTATGGATTTGCCTATTCTGGG + Intronic
952812952 3:37421608-37421630 TTCAAGGCTTTGACTATTCTTGG + Intronic
952916137 3:38244477-38244499 TCTATGAATTTGCCTACTCTAGG + Intronic
952927415 3:38330819-38330841 TCTATGGATTTGCCTATTCTGGG - Intergenic
952938302 3:38419093-38419115 TCTATGGATTTGCCTATTCTAGG + Intronic
953207011 3:40840072-40840094 TCTATGAATTTGACTACTCCAGG - Intergenic
953266610 3:41395562-41395584 TCTATGAATTTGACTACTCTAGG - Intronic
953532458 3:43750797-43750819 TCTATGAATTTGACTATTCTAGG + Intergenic
953571305 3:44073813-44073835 CCTCTGGATTTGACTACTCTAGG - Intergenic
953615259 3:44484384-44484406 AACACTGAGTTGACTACTCTGGG + Intergenic
953833041 3:46318489-46318511 GCTATGAATTTGACTACTCTAGG + Intergenic
953903288 3:46855207-46855229 TGTATGAATTTGACTACTCTAGG + Intergenic
953924301 3:46974132-46974154 TCTCTGAATTTGACTACTCTAGG - Intronic
953964512 3:47293069-47293091 TTCATGAATTTGACTATTCTAGG - Intronic
954088522 3:48266278-48266300 TTCCAGGCTTTGACTACTCTAGG + Intronic
954339805 3:49944197-49944219 TCTATGAATTTGACTACTCTAGG + Intronic
954471341 3:50698224-50698246 TCTAAGGATTTGCCTATTCTAGG + Intronic
954522122 3:51237944-51237966 TCTATGAATTTGACTACTTTAGG + Intronic
954657029 3:52200372-52200394 TCTATGAATTTGACTATTCTAGG + Intronic
954730480 3:52657086-52657108 TCTATGAATTTGACTATTCTAGG - Intronic
954770258 3:52961225-52961247 TCTATGAATTTGACTACTGTAGG - Intronic
954829434 3:53407034-53407056 TCTATGAATTTGACTACTTTAGG - Intergenic
954887541 3:53889318-53889340 CCGACAAATTTGACTACTCTAGG + Intronic
955152703 3:56383902-56383924 TCTATGAATTTGACTACTCTAGG + Intronic
955159933 3:56454991-56455013 TCTATGAATTTGACTATTCTAGG - Intronic
955603089 3:60669069-60669091 TCCACGGATTTGAAACATCTTGG + Intronic
955765321 3:62338447-62338469 TCTATGAATTTGATTACTCTAGG - Intergenic
956011428 3:64835576-64835598 TCTACGGATTTGCCTATTCTAGG + Intergenic
956082195 3:65569220-65569242 TCCATGAATTTGACTATTCTAGG - Intronic
956234628 3:67054949-67054971 TCTACTGATTTGTCTATTCTGGG + Intergenic
956393305 3:68797732-68797754 TTTATGAATTTGACTACTCTAGG - Intronic
956426004 3:69135920-69135942 TCTATGAATTTCACTACTCTGGG - Intergenic
957192147 3:77022996-77023018 TCTATAAATTTGACTACTCTAGG + Intronic
958851364 3:99329825-99329847 TCTATGAATTTGAATACTCTGGG - Intergenic
958880279 3:99661902-99661924 TCCATAAATTTGACTACTCTAGG - Intronic
958893706 3:99807501-99807523 TCTATGAATTTGACTACTCTAGG - Intergenic
959511938 3:107223557-107223579 TCTATGAATTTGACTATTCTAGG - Intergenic
959608177 3:108264704-108264726 TCTGTGAATTTGACTACTCTAGG - Intergenic
960109574 3:113832643-113832665 TCTATGAATTTGACTACTCTAGG + Intronic
960529326 3:118745498-118745520 TCTATGATTTTGACTACTCTAGG - Intergenic
960945068 3:122960761-122960783 TCCATGGATTTGACTACTCTAGG - Intronic
961053292 3:123765856-123765878 TCTATGAATTTTACTACTCTAGG - Intronic
961118121 3:124349259-124349281 TCCATGAATTTCACTACTCTAGG - Intronic
961258380 3:125578314-125578336 TCCATGGATTTGTCTATTCTGGG - Intronic
961361248 3:126369061-126369083 TCTATGAATTTGACTGCTCTAGG + Intergenic
961380789 3:126495351-126495373 TCTATGAATTTGACTGCTCTAGG + Intronic
961416340 3:126760543-126760565 TCTATGAATTTCACTACTCTAGG + Intronic
961560338 3:127724263-127724285 TCTATAAATTTGACTACTCTAGG + Intronic
961584808 3:127913581-127913603 TCTACGAATTTGCCTATTCTAGG - Intergenic
961765500 3:129207275-129207297 TTTATGAATTTGACTACTCTAGG + Intergenic
962582505 3:136810923-136810945 TGTATGAATTTGACTACTCTAGG + Intergenic
962759925 3:138501492-138501514 TCTATGGATTTGCCTATTCTAGG + Intronic
963024952 3:140910549-140910571 TCCGTGGATTTGACTACTCTAGG - Intergenic
963121394 3:141779733-141779755 TCTAGGGATTTGCCTATTCTGGG + Intronic
963124910 3:141806676-141806698 TCTATGAATTTGACTGCTCTAGG - Intronic
963125046 3:141808396-141808418 TCTATGAATTCGACTACTCTAGG - Intronic
963747301 3:149137758-149137780 TCTATGAATTTGACTACTCTAGG - Intronic
963804380 3:149708523-149708545 TCTATGAATTTGACCACTCTAGG + Intronic
963846759 3:150166943-150166965 TCCATAGATTTGCCTATTCTGGG + Intergenic
964018780 3:151981355-151981377 TCTATGAATTTGACTACTCTAGG + Intergenic
964498520 3:157322161-157322183 TTTATGAATTTGACTACTCTAGG + Intronic
964785676 3:160393460-160393482 TCTATGAATTTGACTACTCTAGG - Intronic
964854252 3:161129086-161129108 TCCATGCATTTGAGTATTCTAGG - Intronic
965171250 3:165266894-165266916 TCCATAGATTTGCCTATTCTGGG + Intergenic
965616218 3:170595341-170595363 TCTATGAATTTGACTACTTTAGG + Intronic
965749890 3:171965166-171965188 TCCACGGATTTTCCTATGCTGGG - Intergenic
966096979 3:176215324-176215346 TCTATGTATTTGAATACTCTAGG - Intergenic
966502955 3:180666170-180666192 TCTATGAATTTGACTACTCTAGG + Intronic
966717198 3:183025086-183025108 TCTATGAATTTGACTACTCTAGG - Intronic
966903613 3:184505934-184505956 TCTATGAATTTGACTACTCTGGG - Intronic
966923809 3:184631518-184631540 TCCCCGGATTTGCCCAATCTGGG - Intronic
967323360 3:188215480-188215502 TCTATGAATGTGACTACTCTAGG + Intronic
967756217 3:193172572-193172594 TCTATGGATTTGCCTATTCTGGG - Intergenic
968475658 4:805891-805913 TCAATGAATTTGGCTACTCTAGG - Intronic
968536594 4:1134572-1134594 TCTATGGATTTGACTCCTCTAGG + Intergenic
968840682 4:3003121-3003143 TCTATGAATTTGACTACTCTAGG + Intronic
968875439 4:3264694-3264716 TCTGTGCATTTGACTACTCTAGG + Intronic
968961880 4:3749705-3749727 TCTATGAATTTGACTGCTCTAGG + Intergenic
969088508 4:4674558-4674580 TCTATGATTTTGACTACTCTAGG + Intergenic
969108288 4:4824792-4824814 TCTATGAATTTGAGTACTCTAGG - Intergenic
969241779 4:5903580-5903602 TCTATGAATTTGACCACTCTAGG - Intronic
969287760 4:6216180-6216202 TCTATGAATTTGACTACTCTAGG - Intergenic
969369508 4:6722852-6722874 TCTATGAATTTGACGACTCTAGG + Intergenic
969531071 4:7730675-7730697 TCCATGGATTTGCCTGTTCTGGG - Intronic
969744126 4:9056330-9056352 TCTACAGATTTGCCTATTCTGGG - Intergenic
970176407 4:13344011-13344033 TCTATGAATTTGACTACTCTAGG - Intergenic
971409747 4:26357773-26357795 TCTATGAATTTGACTACTCTAGG + Intronic
971411397 4:26376330-26376352 TCCATGAATTTGACTACTCTAGG + Intronic
972586586 4:40443100-40443122 TCTATGAATTTGACTACTCTAGG - Intronic
972731590 4:41800329-41800351 TCTATGGTTTTGACTACTCTAGG - Intergenic
972772373 4:42209455-42209477 TCTATGAATTTGAATACTCTAGG + Intergenic
972812412 4:42604957-42604979 TCCATGGATTTGTCTGTTCTTGG - Intronic
973279852 4:48347815-48347837 TCTATGAATTTGACCACTCTAGG + Intronic
973298904 4:48558375-48558397 TCTATGGATTTGACTACTTTAGG - Intronic
973621517 4:52731126-52731148 TCTATGAATTTGACTATTCTAGG + Intronic
973760674 4:54112367-54112389 TCTATGAATTTGAGTACTCTAGG + Intronic
973919166 4:55667179-55667201 TCTATGAATTTGACTATTCTGGG + Intergenic
974026183 4:56735380-56735402 TCTATGAATTTGACTACTCTAGG - Intergenic
974124396 4:57677653-57677675 TCTATAAATTTGACTACTCTAGG + Intergenic
974552359 4:63395158-63395180 TCTATGAATCTGACTACTCTAGG - Intergenic
974773304 4:66444775-66444797 TCTATGAGTTTGACTACTCTAGG - Intergenic
975055084 4:69920060-69920082 TCCATGCATTTGACTACTCCAGG + Intergenic
975123114 4:70750793-70750815 TCCATAGATTTGCCTATTCTGGG + Intronic
975208775 4:71674976-71674998 TTTATGAATTTGACTACTCTAGG - Intergenic
975463671 4:74685165-74685187 TCTATAAATTTGACTACTCTGGG - Intergenic
975488520 4:74962699-74962721 TCTATGAATTTGACTACTTTAGG - Intronic
975653372 4:76616616-76616638 TCAATGAGTTTGACTACTCTAGG - Intronic
975658679 4:76667013-76667035 TCTATGAATTTGACTATTCTAGG - Intronic
975872147 4:78791653-78791675 TCTATGAATTTGACTATTCTAGG + Intronic
975873147 4:78804169-78804191 TCTATGGATTTGTCTATTCTGGG + Intronic
976021904 4:80639585-80639607 TCCATGAATTTAACTACTCTAGG - Intronic
976230404 4:82836653-82836675 TCTATGTATTTGACTATTCTAGG - Intronic
976400847 4:84605355-84605377 TCAATGGATTTTACTACCCTTGG + Intronic
976456109 4:85248374-85248396 TCTATGAATTTCACTACTCTAGG - Intergenic
976516947 4:85979533-85979555 TCTATGAATTTGTCTACTCTAGG + Intronic
976639627 4:87324340-87324362 TCTGTGTATTTGACTACTCTAGG - Intergenic
977358029 4:95970909-95970931 TCTATGAATGTGACTACTCTAGG + Intergenic
977506958 4:97914865-97914887 TCTATGAATTTCACTACTCTAGG + Intronic
978883447 4:113737427-113737449 TCTGTGAATTTGACTACTCTGGG - Intronic
979623666 4:122823727-122823749 TCTATGGATTTGCCTACCCTAGG + Intergenic
979679263 4:123441811-123441833 TCTAACAATTTGACTACTCTAGG + Intergenic
980044795 4:127975353-127975375 TCTATGAATCTGACTACTCTAGG + Intronic
980193849 4:129561931-129561953 TCTATGAATCTGACTACTCTAGG + Intergenic
981060649 4:140421004-140421026 TCTATGATTTTGACTACTCTAGG + Intronic
981072693 4:140560929-140560951 TCTATGAATTTGACTACTCTAGG + Intronic
981139326 4:141250284-141250306 TCCACGTATTTGTATACTTTTGG + Intergenic
981661208 4:147168864-147168886 TCTACGGATTTGACTACTTCAGG - Intergenic
981727564 4:147863298-147863320 TCTATGAATTTAACTACTCTAGG + Intronic
981751315 4:148094985-148095007 TCTATGAATTTGGCTACTCTAGG - Intronic
982045103 4:151437061-151437083 TCCACGGATTCAACTAATCAAGG - Intronic
982046195 4:151448511-151448533 TCCATGAATTAGACTACTCTAGG + Intronic
982131472 4:152232825-152232847 TCAATGAATTTGACTACTCTAGG - Intergenic
982141931 4:152331505-152331527 TCTATGAGTTTGACTACTCTAGG - Intronic
982188434 4:152826960-152826982 GCTATGAATTTGACTACTCTAGG - Intronic
984729952 4:183058784-183058806 TCTATGGATTTGACAATTCTAGG + Intergenic
984936752 4:184896842-184896864 TCTTTGAATTTGACTACTCTAGG - Intergenic
984955189 4:185037905-185037927 TCCATGGATGAAACTACTCTAGG + Intergenic
984965129 4:185133307-185133329 TCCATGAATTTGACTTCTCTAGG - Intergenic
985094215 4:186396731-186396753 TCTATGTATTTGACTACTCTAGG + Intergenic
986312798 5:6567153-6567175 TCCATGAATTTGCCTATTCTAGG - Intergenic
986619505 5:9657684-9657706 TCTAAGAATTTAACTACTCTAGG - Intronic
986658727 5:10040317-10040339 TCTATGAATTTGACGACTCTAGG + Intergenic
986826359 5:11527023-11527045 TCTATGAATTTGCCTACTCTAGG - Intronic
987517289 5:18928162-18928184 TCTATAGATTTGACTATTCTGGG + Intergenic
987656644 5:20815623-20815645 TTCATGGATTTGTCTACTTTTGG - Intergenic
988506984 5:31832206-31832228 TCTATGAATTTGACTATTCTAGG - Intronic
988545352 5:32151907-32151929 TCTATGAATTTGACTATTCTAGG - Intronic
988582148 5:32477714-32477736 TCTATGACTTTGACTACTCTAGG - Intergenic
988582797 5:32482843-32482865 TCCATGAATTTGACTATCCTAGG + Intergenic
989091826 5:37741811-37741833 TCTATGGATTTGACTACTGTAGG + Intronic
989242247 5:39214967-39214989 TTTATGAATTTGACTACTCTAGG - Intronic
989416324 5:41181501-41181523 TACAAGGATTTAACTTCTCTTGG - Exonic
989678624 5:44003955-44003977 TTCACGGATATGACTTCTGTGGG + Intergenic
990024377 5:51167488-51167510 CTCAAGAATTTGACTACTCTAGG + Intergenic
990293310 5:54377132-54377154 TCTATGAATTTGACTATTCTAGG - Intergenic
990312993 5:54557560-54557582 TCTATGAATTTGACTACTGTAGG - Intergenic
990365372 5:55065197-55065219 TCCATGGATTTGCCTATTCTAGG + Intergenic
990365849 5:55069605-55069627 GCCAGGAATTTGACTGCTCTTGG + Intergenic
990465063 5:56064003-56064025 TCTGTGAATTTGACTACTCTAGG - Intergenic
991476342 5:67024106-67024128 TCTATGAATTTGACTACTCTAGG + Intronic
991602728 5:68369711-68369733 TCTACGAATTGGACTATTCTAGG + Intergenic
991689939 5:69216193-69216215 TCTATGAATTTGACTACTGTGGG - Intergenic
992205352 5:74425522-74425544 TCTAAGGATTTGACTCTTCTGGG + Intergenic
992239963 5:74757881-74757903 TTCATGACTTTGACTACTCTAGG - Intronic
992247995 5:74847336-74847358 TCTACGAATTGGACTATTCTAGG + Intronic
992402621 5:76425704-76425726 TGCTCGGATTTGACTAGTGTGGG + Intronic
992404692 5:76445891-76445913 TCTATGAATTTGACTACTCTTGG + Intronic
992428331 5:76682004-76682026 TGTATGTATTTGACTACTCTAGG - Intronic
992734187 5:79702539-79702561 TCTACAGATTTGCCTATTCTGGG - Intronic
992861366 5:80913889-80913911 TCTATGAATTTGACTACTGTAGG - Intergenic
992938829 5:81741269-81741291 TCCAAGAATTTGACTATTCGAGG - Intronic
993404060 5:87488823-87488845 TTCATGGATTTGACTACCTTTGG - Intergenic
993631326 5:90289253-90289275 TCTATGGATTTGACTATTCTAGG + Intergenic
993708991 5:91204343-91204365 TCCATGAATTTCACTATTCTAGG - Intergenic
993945075 5:94109218-94109240 TCTATGAATTTGACTACTCTAGG - Intronic
995002343 5:107149341-107149363 TCCATGAATTTGACTACTATAGG - Intergenic
995194316 5:109346694-109346716 TCAATGAATTTGACTACTTTAGG - Intronic
995495823 5:112741825-112741847 TCAAAGAATTTGACTATTCTGGG + Intronic
996562452 5:124845471-124845493 TCTATGAATTTGACCACTCTAGG - Intergenic
996846631 5:127906226-127906248 TCCATGAATTTCACTATTCTAGG + Intergenic
996899393 5:128526671-128526693 TCTATGAATTTGACTACTTTAGG - Intronic
997116676 5:131132827-131132849 TCTATGAATTTGACTACTCTAGG - Intergenic
997183189 5:131854276-131854298 TCTATAAATTTGACTACTCTAGG - Intronic
997289288 5:132714217-132714239 TCTATGAATTTGACTGCTCTGGG - Intronic
997289313 5:132714560-132714582 TCTATGAATTTGACTATTCTAGG - Intronic
997978792 5:138456174-138456196 TCTATGGATTTCACTATTCTAGG - Intergenic
998153927 5:139773536-139773558 TCTATGAATTTGACTACCCTAGG + Intergenic
998181424 5:139948118-139948140 TCTATGAATCTGACTACTCTAGG + Intronic
998268480 5:140685227-140685249 TCTATGGATTTGACTATTCTAGG - Intronic
998271896 5:140714011-140714033 TCTATAAATTTGACTACTCTAGG + Intergenic
998272731 5:140721566-140721588 TCTATAAATTTGACTACTCTAGG + Intergenic
998273482 5:140728640-140728662 TCTATAAATTTGACTACTCTAGG + Intergenic
998332031 5:141337561-141337583 TCTATGAATTTGACTAATCTAGG - Intronic
998427071 5:142037924-142037946 TCTATGAATTTGACTACTCCAGG - Intergenic
998594995 5:143519979-143520001 TCTATAAATTTGACTACTCTAGG + Intergenic
1000022924 5:157334210-157334232 TCCATGAATTTGCCTACTGTAGG - Intronic
1000029777 5:157391489-157391511 TCTATGCATTTGACTACTCTAGG + Intronic
1000068207 5:157715052-157715074 TCTATGAATTTGACTACTGTAGG + Intergenic
1000578398 5:163005479-163005501 GCTATGAATTTGACTACTCTAGG + Intergenic
1000713684 5:164612808-164612830 TCTATGAATTTGACTACTCTAGG + Intergenic
1000873209 5:166603057-166603079 TCTATGAATGTGACTACTCTAGG + Intergenic
1001128611 5:169044523-169044545 TCTATGGATTTGCCTATTCTGGG - Intronic
1001308278 5:170591652-170591674 TCTACAAATTTGACTACTCTAGG + Intronic
1001472450 5:172024156-172024178 TCTATGAATTTGACTAGTCTAGG + Intergenic
1001477712 5:172062686-172062708 CCTATGAATTTGACTACTCTAGG - Intronic
1001697433 5:173682215-173682237 TCCTTGAATTTGACTGCTCTAGG - Intergenic
1001714176 5:173801544-173801566 TCTGTGAATTTGACTACTCTGGG - Intergenic
1001800609 5:174540817-174540839 TCCCTGAATTTGACTACTCCAGG - Intergenic
1001883700 5:175269417-175269439 TCTACGATTTTGACAACTCTAGG - Intergenic
1001908632 5:175495241-175495263 TCTCTGAATTTGACTACTCTAGG - Intronic
1002332285 5:178452186-178452208 TCCACAGTTTTGTCTACTTTTGG - Intronic
1002333807 5:178464257-178464279 TCTATGAATTTCACTACTCTAGG + Intronic
1002431056 5:179204132-179204154 TCTGAGAATTTGACTACTCTGGG - Intronic
1002883719 6:1275271-1275293 TCTATGCATTTAACTACTCTAGG - Intergenic
1002910565 6:1488130-1488152 TCTACGACTTTGACTACTTTAGG - Intergenic
1002933813 6:1654550-1654572 TTTATGAATTTGACTACTCTAGG - Intronic
1003271191 6:4609380-4609402 TCTACGAGTTTGACTAATCTAGG - Intergenic
1003539511 6:7005996-7006018 TCCATGAGTTTGACCACTCTAGG - Intergenic
1003656986 6:8021188-8021210 TCTATGAATTTGACTGCTCTAGG - Intronic
1003934270 6:10959340-10959362 TCTATGAATTTGACTATTCTAGG - Intronic
1004090013 6:12491403-12491425 TCCATTGTTTTGTCTACTCTTGG - Intergenic
1004285821 6:14319625-14319647 TCTATGAATTTGACTATTCTAGG - Intergenic
1004536577 6:16509045-16509067 TCTATGAATTTGACTGCTCTAGG - Intronic
1004684259 6:17927446-17927468 TCTATGAATTTAACTACTCTGGG - Intronic
1004813459 6:19286554-19286576 TCTATGAATTTGACTACTCTAGG - Intergenic
1004883343 6:20029836-20029858 TCTGTGGATTTGGCTACTCTAGG + Intergenic
1005062545 6:21790432-21790454 TCTATGAATTTGACTGCTCTAGG + Intergenic
1005089226 6:22038802-22038824 TCTATGAATTTGACTACTTTTGG + Intergenic
1005380363 6:25227929-25227951 TCTATGAATTTGACTACTTTAGG - Intergenic
1005630323 6:27701164-27701186 TCTATGAATTTGACTATTCTAGG + Intergenic
1006059326 6:31408623-31408645 TCTATGAATTTGACCACTCTAGG + Intronic
1006071808 6:31503504-31503526 TCTATGAATTTGACCACTCTAGG + Intronic
1006371568 6:33647563-33647585 TCTATGAATTTGATTACTCTTGG + Intronic
1006508445 6:34506789-34506811 TCCACTGACCTGATTACTCTTGG + Intronic
1006587454 6:35125943-35125965 TCTATGAATTTGACTACTCTAGG - Intronic
1006874994 6:37287579-37287601 TCTAAGAATTTGACTACTCCAGG + Intronic
1007238461 6:40408012-40408034 TCTATGAATTTGACTACTCCAGG - Intronic
1007544487 6:42682198-42682220 TCTATAAATTTGACTACTCTAGG - Intronic
1008550294 6:52622881-52622903 TCTATGGATTTGACAACTCCAGG - Intergenic
1010240344 6:73609814-73609836 TCTATGGATTTGACTACTATAGG - Intronic
1011148840 6:84246119-84246141 TCTATAAATTTGACTACTCTTGG - Intergenic
1011268182 6:85548034-85548056 TCCATGAATTTGACTACTCTGGG - Intronic
1011643574 6:89436605-89436627 TCCATGTGTATGACTACTCTAGG - Intronic
1011735494 6:90306309-90306331 TCTATGAATTTGACTACTCTAGG + Intergenic
1011816954 6:91203129-91203151 TCTACGAATGTGACCACTCTAGG + Intergenic
1012222369 6:96664439-96664461 TCCATGAATTTGACTACTTTAGG + Intergenic
1012946849 6:105475319-105475341 TCTATGAATTTAACTACTCTAGG + Intergenic
1013028867 6:106310750-106310772 TCTATGAATTTGACTACTCTAGG + Intronic
1013343104 6:109234734-109234756 TCTATGAATTTGACTACTCTAGG - Intergenic
1013591774 6:111624849-111624871 TCTATGAGTTTGACTACTCTAGG - Intergenic
1013626881 6:111947220-111947242 TCTAGGAATTTGACTATTCTAGG - Intergenic
1014224617 6:118833721-118833743 TCTATGGATTTGACTACTCTAGG - Intronic
1014782663 6:125582705-125582727 TCTGCGAATTTGACCACTCTAGG + Intergenic
1014965463 6:127742708-127742730 TCTATGAATTTGACTACTCTAGG - Intronic
1015168674 6:130227173-130227195 TCCATGAATTTGACTATTTTAGG + Intronic
1015215052 6:130740506-130740528 TTCATGAATTTGACTACTCTAGG + Intergenic
1015599580 6:134899453-134899475 TCTCTGAATTTGACTACTCTGGG + Intergenic
1015762503 6:136680110-136680132 TCTCTGAATTTGACTACTCTAGG - Intronic
1016872333 6:148830745-148830767 TCTATGAATTTGACTACTCTAGG - Intronic
1016904940 6:149138833-149138855 TCCATGAATTTGCCTATTCTAGG + Intergenic
1017520875 6:155201015-155201037 TCTATGGATTTGCCTATTCTGGG + Intronic
1017604439 6:156118839-156118861 TTTATGAATTTGACTACTCTAGG - Intergenic
1017646534 6:156544319-156544341 TCTATGAATTTGACTACTCTAGG + Intergenic
1017661771 6:156681846-156681868 TCTATTAATTTGACTACTCTGGG - Intergenic
1017695240 6:157008362-157008384 TCTCTGAATTTGACTACTCTAGG + Intronic
1017842826 6:158235372-158235394 TCTATGAATTTGACTACTCTAGG + Intronic
1017897748 6:158695727-158695749 TTTATGAATTTGACTACTCTAGG + Intronic
1018072793 6:160180541-160180563 TCTATGAATTTGACTACTCTGGG - Intronic
1018293095 6:162313316-162313338 TCTATGAATTTGGCTACTCTAGG + Intronic
1019391697 7:791191-791213 TCCATGGAATTTACTCCTCTCGG + Intergenic
1019495132 7:1334547-1334569 TCTACGGATTTGCCTGTTCTAGG + Intergenic
1019551572 7:1605687-1605709 TCCATGGAATTGCCTATTCTGGG - Intergenic
1019785857 7:2977064-2977086 TCTATGGATTTGCCTATTCTGGG - Intronic
1019868436 7:3735369-3735391 TCTATGAGTTTGACTACTCTAGG + Intronic
1019923332 7:4176688-4176710 TCGACGGATTTGACGACTCTGGG + Intronic
1020229728 7:6308782-6308804 TCTATGAATTTGACTACTCTAGG - Intergenic
1020574981 7:9914495-9914517 TCTATGAATTTGACTATTCTAGG + Intergenic
1020961652 7:14811993-14812015 TCTGCGAATTTGACGACTCTAGG + Intronic
1021330422 7:19331615-19331637 TCTATGAATTTCACTACTCTAGG + Intergenic
1021436132 7:20618248-20618270 TCTATGGATTTGCCTGCTCTAGG + Intronic
1021536590 7:21712084-21712106 TCTATGAATTAGACTACTCTAGG + Intronic
1021747025 7:23751910-23751932 CCTACAGATTTGACTGCTCTAGG - Intronic
1021825932 7:24551331-24551353 TCCATGAATTTGACTGCTCAAGG - Intergenic
1022080006 7:27010724-27010746 ACTATGAATTTGACTACTCTAGG + Intergenic
1022440954 7:30432825-30432847 TCTATGGATTTGCCTACTCTGGG - Intronic
1022658047 7:32339294-32339316 TCTATGAATTTGACTACTCTAGG - Intergenic
1022759564 7:33333036-33333058 TCTACAAATCTGACTACTCTAGG + Intronic
1022797137 7:33741106-33741128 TCCATTACTTTGACTACTCTAGG + Intergenic
1022860472 7:34361863-34361885 TCAACGGATTCCACTGCTCTTGG - Intergenic
1023152140 7:37212167-37212189 TCTATGAATTTGACTACTCCAGG - Intronic
1023235621 7:38082841-38082863 TCTATGTATTTGACTACTCTAGG - Intergenic
1023240651 7:38143215-38143237 TCTGTGAATTTGACTACTCTAGG - Intergenic
1023341259 7:39222610-39222632 TCTATGAATTTGACCACTCTGGG + Intronic
1023347212 7:39283474-39283496 TCTATGAATTTGATTACTCTAGG + Intronic
1024306833 7:47936371-47936393 TCTATGAATGTGACTACTCTAGG + Intronic
1024566218 7:50683251-50683273 TCTAGGAATTTGACTACTCCAGG - Intronic
1024979830 7:55147831-55147853 TCTATGAATTTGACTGCTCTGGG + Intronic
1025067180 7:55867330-55867352 TCTATGAATTTGACTACTTTAGG + Intergenic
1025282385 7:57637675-57637697 TCTATGGATTTGACTACTCTAGG + Intergenic
1025302345 7:57827844-57827866 TCTATGGATTTGACTACTCTAGG - Intergenic
1026066216 7:67075663-67075685 TCTACAGATTTGTCTATTCTAGG - Intronic
1026433991 7:70377680-70377702 TCTATGAATTTGACTACTCTAGG + Intronic
1026710711 7:72736675-72736697 TCTACAGATTTGTCTATTCTAGG + Intronic
1027191533 7:75999296-75999318 TCTGTGAATTTGACTACTCTAGG - Intronic
1027505152 7:79007602-79007624 TCTATAAATTTGACTACTCTAGG + Intronic
1028510936 7:91625495-91625517 TCTATAAATTTGACTACTCTAGG - Intergenic
1029104307 7:98163067-98163089 TCTAGGAATCTGACTACTCTAGG - Intronic
1029242907 7:99177161-99177183 TCTATGAATTTGACTATTCTAGG - Intronic
1029844511 7:103398956-103398978 TCTGTGGATTTGAATACTCTAGG - Intronic
1029962140 7:104699482-104699504 TCTATGAATTTGACTACTCATGG - Intronic
1030043742 7:105475893-105475915 TCTATGGCTTTGACTACTCTAGG + Intronic
1030044355 7:105481682-105481704 TCCATGGATTTGCCTATTCTAGG + Intronic
1030063974 7:105645033-105645055 TCTATGAATTTGACTACTCCAGG - Intronic
1030378017 7:108776140-108776162 TCTATGAATTTGACTGCTCTAGG + Intergenic
1030622380 7:111804374-111804396 TCTATGAATTTAACTACTCTAGG - Intronic
1031056103 7:116994208-116994230 TCTATGAATTTGACTACACTAGG + Intronic
1031651406 7:124295084-124295106 TCTATGAATTTGATTACTCTAGG - Intergenic
1031945363 7:127833902-127833924 TCTAAGAATTTGACTACTCTAGG + Intronic
1032039316 7:128545490-128545512 TCTGTGAATTTGACTACTCTAGG + Intergenic
1032169967 7:129576545-129576567 TCCATGAATTTGACTGCTCTAGG - Intergenic
1032178433 7:129653124-129653146 TCTATGAATTTGACTACTCTAGG + Intronic
1032658002 7:133952695-133952717 TCTATGAATTTGACTACTCTAGG + Intronic
1032805179 7:135347096-135347118 TCTAGGAGTTTGACTACTCTAGG + Intergenic
1033065509 7:138150069-138150091 TCTACGAATTTGACTGCCCTAGG - Intergenic
1033157477 7:138969333-138969355 TCCATGGCTTTGACTACTCTAGG + Intronic
1033218457 7:139511473-139511495 TGTATGAATTTGACTACTCTAGG - Intergenic
1033313766 7:140281365-140281387 TCCATGAATGTGACAACTCTAGG - Intergenic
1033383370 7:140846453-140846475 TCTATGAATTGGACTACTCTAGG - Intronic
1034261172 7:149756821-149756843 TCTATGAATCTGACTACTCTAGG - Intergenic
1035047335 7:155976841-155976863 TCTATGAATTTGACTATTCTAGG + Intergenic
1035057800 7:156047898-156047920 TCTCTGCATTTGACTACTCTAGG - Intergenic
1036153851 8:6323909-6323931 TCTATGAATTTGACTACTCTAGG + Intergenic
1036192579 8:6684214-6684236 TCTATGAATTTGACTACTCTAGG - Intergenic
1036395152 8:8363506-8363528 TCTCTGAATTTGACTACTCTAGG - Intronic
1036399684 8:8396709-8396731 TCCATACATTTGTCTACTCTAGG - Intergenic
1036550653 8:9812636-9812658 TCCAGGAATTTGACTTCTCTTGG + Intergenic
1036589240 8:10152945-10152967 TCTATGAATTTCACTACTCTAGG - Intronic
1036617713 8:10401844-10401866 TCTATGAATTTGACTACTCTAGG - Intronic
1036666404 8:10745564-10745586 TCTATGAATTTGACCACTCTAGG + Intronic
1036699787 8:11004976-11004998 CCTATGAATTTGACTACTCTTGG - Intronic
1036771587 8:11582175-11582197 TCTTTGGATTTGACTCCTCTAGG - Intergenic
1036775715 8:11611797-11611819 TCTATGTATTTGACTCCTCTGGG - Intergenic
1036781733 8:11652390-11652412 TCTATGAATTTGACTACTCCAGG + Intergenic
1036784081 8:11674048-11674070 TCCATGAATGTGACTCCTCTAGG - Intergenic
1037383025 8:18308654-18308676 TCTATGGATTTGACTACTGTAGG - Intergenic
1037928071 8:22860431-22860453 TCTATGAATTTGACTCCTCTAGG + Intronic
1038022151 8:23559700-23559722 TCTACAAATTTGACTACTCTAGG + Intronic
1038189116 8:25302852-25302874 TCTGAGAATTTGACTACTCTAGG - Intronic
1038313466 8:26463529-26463551 TCTATGAATTTGACTTCTCTAGG + Intronic
1038330393 8:26603715-26603737 TCTATGGATTTGACTGTTCTAGG + Intronic
1038427748 8:27475486-27475508 TCTATGAATTTGACTATTCTAGG - Intronic
1038487575 8:27947922-27947944 TCTATGGATTTGTCTTCTCTTGG - Intronic
1038506956 8:28092798-28092820 TCCCCGGATGTGACGACCCTGGG + Intronic
1038602578 8:28961408-28961430 TCTGTGAATTTGACTACTCTAGG + Intronic
1038631724 8:29251551-29251573 TCTATGAATTTGACTACCCTAGG - Intronic
1039038611 8:33385563-33385585 GCCAGTGATTTGACTATTCTTGG - Intronic
1039054074 8:33520835-33520857 TCTACAGATTTGCCTATTCTGGG - Intergenic
1039294546 8:36135698-36135720 TCTACAAATTTGACTACTCTAGG - Intergenic
1039349648 8:36748518-36748540 TCTAAGAATTCGACTACTCTAGG + Intergenic
1039506137 8:38053839-38053861 TCTCTGAATTTGACTACTCTAGG - Intronic
1039592597 8:38762326-38762348 TCTACACATTTGACTACTGTAGG + Intronic
1039721213 8:40166592-40166614 TCTATGAATTTGGCTACTCTAGG - Intergenic
1039833169 8:41233830-41233852 TCCATGGATTTGGGTAATCTTGG - Intergenic
1039901639 8:41756976-41756998 TCTACGAATTTTACTACTATAGG - Intronic
1040022070 8:42749801-42749823 TCTATGAATTTGACCACTCTGGG - Intergenic
1040655970 8:49508084-49508106 TCCATAAATTTGACTTCTCTAGG + Intergenic
1040856170 8:51950358-51950380 TCTATGAATTTGACTACTCTGGG - Intergenic
1041079723 8:54204640-54204662 TCTATGAATTTGACTACTCCAGG + Intergenic
1041089273 8:54287147-54287169 TCCATGGATGTGACCTCTCTAGG + Intergenic
1041100557 8:54392493-54392515 TCTACGGATTCGACTACTCTGGG + Intergenic
1041103763 8:54421579-54421601 TTCACAGATTTGCTTACTCTGGG + Intergenic
1041206308 8:55501505-55501527 TCTATGAATATGACTACTCTAGG + Intronic
1041220068 8:55641780-55641802 TCTATGAATTTGACTAGTCTAGG + Intergenic
1041557820 8:59177922-59177944 TCTATGAATTTGACTACTTTGGG + Intergenic
1041847697 8:62350406-62350428 TCTACCAATTTGATTACTCTAGG - Intronic
1042137217 8:65644152-65644174 TCTAAAGATTTGAATACTCTAGG - Intergenic
1042223457 8:66496005-66496027 TCTATGAATTTGACTACTCTAGG + Intronic
1042266899 8:66917612-66917634 TCTATGAATTTGACTATTCTAGG + Intronic
1042292311 8:67181875-67181897 TCCATAAATTTGACTACTCTAGG + Intronic
1042339270 8:67661812-67661834 TCTATGAACTTGACTACTCTGGG + Intronic
1042358013 8:67850634-67850656 TCTACGAATTTGGCTATTCTAGG + Intergenic
1042506640 8:69567537-69567559 TCTGTGGATTTGACTACTCTAGG + Intronic
1042547202 8:69961356-69961378 TCCATGAATTTAACTATTCTAGG + Intergenic
1042585690 8:70335645-70335667 TCTATGAATTTGACTACTCTAGG + Intronic
1042811030 8:72825097-72825119 TCTATGAATTTGACTACTCTAGG + Intronic
1042815161 8:72870130-72870152 TCTATGAATGTGACTACTCTAGG - Intronic
1042957410 8:74266481-74266503 TCTCTGAATTTGACTACTCTAGG - Intronic
1043141492 8:76595343-76595365 TCTATGAATTTGACTACTCTAGG - Intergenic
1043668488 8:82849125-82849147 TTCATGAATTTGACTACTCTAGG - Intergenic
1043916806 8:85932352-85932374 TCTATGAATTTGACTACTTTAGG - Intergenic
1043941143 8:86197294-86197316 TCTATGAATTTGACTACTCCAGG - Intergenic
1044138647 8:88619999-88620021 TCCATAAATTTGACTACTCTAGG - Intergenic
1044348637 8:91136755-91136777 TCTCTGAATTTGACTACTCTAGG + Intronic
1044709631 8:95044164-95044186 TTCATGGATTTGTCTATTCTGGG - Intronic
1044863008 8:96541634-96541656 TCTATGAATTTGACTACTCTAGG - Intronic
1045015606 8:97999045-97999067 TCTATGAATTTGACTATTCTAGG + Intronic
1045180175 8:99772407-99772429 TTTATGAATTTGACTACTCTTGG - Intronic
1045429551 8:102100841-102100863 TCTATGAATTTGACTACTCTAGG - Intronic
1046540479 8:115574469-115574491 TCCAAGCATTAGACTTCTCTAGG - Intronic
1047433864 8:124817950-124817972 GCTATGAATTTGACTACTCTAGG + Intergenic
1047474745 8:125215798-125215820 TCTATGTATTTGACTATTCTGGG + Intronic
1047648786 8:126897731-126897753 TCCATGAATTTGATTACTCTAGG + Intergenic
1047719056 8:127621727-127621749 TCTACGAATTTGACTAGTCTAGG - Intergenic
1047794758 8:128243112-128243134 TCTATGAATTTGACTACTCTAGG + Intergenic
1048002547 8:130391216-130391238 TGTATGAATTTGACTACTCTAGG - Intronic
1048021069 8:130539613-130539635 TCTATGAACTTGACTACTCTAGG - Intergenic
1048050721 8:130813435-130813457 TCTATGAATTTGACCACTCTAGG + Intronic
1048330636 8:133468406-133468428 TCTATGAATTTGACTACTCTAGG - Intronic
1048980319 8:139699992-139700014 TCCAAGGATTTGTCTCCTATTGG - Intronic
1049170167 8:141155065-141155087 TCCATGAATTTGACTCCTCTAGG - Intronic
1049894270 9:99131-99153 TCCACGATTTTGACTACTCTAGG - Intergenic
1049916598 9:323712-323734 TCTATGAATTTTACTACTCTAGG + Intronic
1050002597 9:1094192-1094214 TCTACGGATTTGACTGCTCTAGG + Intergenic
1050412011 9:5376129-5376151 TCTATTAATTTGACTACTCTAGG - Intronic
1050530441 9:6583803-6583825 TCCATGAATTTGACTACTTTAGG - Intronic
1050679423 9:8092863-8092885 TCCAAGGATATGAATATTCTTGG - Intergenic
1050837682 9:10104105-10104127 TCTATGACTTTGACTACTCTGGG - Intronic
1051435939 9:17031827-17031849 TCTATGAATTTGACTACTGTAGG + Intergenic
1051464143 9:17357058-17357080 TCTATGGATTTGCCTATTCTAGG + Intronic
1051485427 9:17603423-17603445 TCTATGAATTTGACTACTCTAGG - Intronic
1051812967 9:21071393-21071415 TCTATGAATTTGACTACTCTTGG - Intergenic
1052483392 9:29062624-29062646 TTTATGGATTTGACTACTCTAGG - Intergenic
1052723676 9:32203316-32203338 TCCTGGGAATTGACTCCTCTTGG + Intergenic
1053254193 9:36601772-36601794 TCTATGAATTTGACTAATCTAGG + Intronic
1053548172 9:39045633-39045655 TCTATGAATTTGATTACTCTGGG + Intergenic
1053566260 9:39255800-39255822 TCTATGAATTTGACTACTCTAGG + Intronic
1053735498 9:41099236-41099258 TCCATGATTTTGACTACTCTAGG - Intergenic
1053832037 9:42093661-42093683 TCTATGAATTTCACTACTCTAGG + Intronic
1054130889 9:61363213-61363235 TCTATGAATTTGACTACTCTAGG - Intergenic
1054598509 9:67093764-67093786 TCTATGAATTTCACTACTCTAGG - Intergenic
1054692879 9:68332165-68332187 TCCATGATTTTGACTACTCTAGG + Intronic
1054796837 9:69310143-69310165 TCTATGAATTTGACTACTCTAGG + Intergenic
1055182701 9:73407758-73407780 TCTATGAATATGACTACTCTAGG - Intergenic
1055456572 9:76477833-76477855 TCTGCGCATTTGACTACTCTAGG + Intronic
1055636636 9:78285445-78285467 TCTATGAATTTGACTACTCCAGG - Intergenic
1055639330 9:78307244-78307266 TCTGTGAATTTGACTACTCTAGG + Intronic
1056142725 9:83699039-83699061 TCTCTGAATTTGACTACTCTAGG - Intronic
1056164857 9:83931124-83931146 TCTATGGATTTGACTATTCTAGG + Intergenic
1056736799 9:89216645-89216667 TCTGTGAATTTGACTACTCTTGG - Intergenic
1057051380 9:91926779-91926801 TCTATGTATTTGACTACGCTGGG - Intronic
1057102965 9:92381178-92381200 TCTATGAATTTGACTATTCTAGG + Intronic
1057365105 9:94412773-94412795 TCTATGGATTTGCCTATTCTGGG - Intronic
1057538714 9:95944312-95944334 TCTATGGATTTGACTATTCCAGG - Intronic
1057658219 9:96975317-96975339 TCTATGGATTTGCCTATTCTGGG + Intronic
1057825149 9:98367414-98367436 TCTATGAATTTGACTCCTCTAGG - Intronic
1058382979 9:104398861-104398883 TCCATGAATTTGACTATTGTAGG + Intergenic
1059163340 9:112055944-112055966 TTTATGAATTTGACTACTCTAGG - Intronic
1059226414 9:112677102-112677124 TCTATGAATTTGACTACTCTAGG + Intergenic
1059302357 9:113324256-113324278 TCTATGGACTTGACTATTCTAGG + Intronic
1060095130 9:120782151-120782173 TCTATGAATTTGACTACTCTAGG - Intronic
1060100458 9:120836053-120836075 TCTCTAGATTTGACTACTCTAGG + Intronic
1060239344 9:121889575-121889597 TCTATGAATTTGACTACTCTAGG + Intronic
1060251867 9:121993068-121993090 TCTATGAATTTGACTGCTCTAGG - Intronic
1060257530 9:122045834-122045856 TCTATGAATTTGACTACTCTAGG - Intronic
1060360082 9:122947279-122947301 TCTAAGAAATTGACTACTCTAGG - Intronic
1060473546 9:123968559-123968581 TCTATGGATTTGACTACTCCAGG + Intergenic
1060495530 9:124115728-124115750 TCCATGGATTTGACTGTTCTAGG - Intergenic
1060577864 9:124714179-124714201 TCTATGAATTTGTCTACTCTAGG - Intronic
1060802758 9:126554950-126554972 TCTATGGATTTGACTGATCTTGG - Intergenic
1061223477 9:129266387-129266409 TCTATGAATTTGACTGCTCTAGG + Intergenic
1061294580 9:129670039-129670061 TCTGTGGATTTGACTACCCTAGG + Intronic
1061515692 9:131088779-131088801 TCTATGAATTTGACTACTCTGGG + Intronic
1061526588 9:131169945-131169967 TCTATAGTTTTGACTACTCTAGG - Intronic
1061622665 9:131821855-131821877 TCTATGGATTTGACAACTCTAGG - Intergenic
1061656122 9:132091608-132091630 TCTATGAATTTGACTACTCCAGG - Intergenic
1061660832 9:132129202-132129224 TCTATGAATTTGACTATTCTAGG + Intergenic
1061674011 9:132205397-132205419 TCTATGAATTTGACGACTCTGGG - Intronic
1061683083 9:132253382-132253404 CCCATGGATTTGCCTATTCTGGG - Intergenic
1061782853 9:133006002-133006024 TCGATGAATTTGACTACTCTAGG - Intergenic
1062066367 9:134528767-134528789 TCCATGGATTTGCCAATTCTGGG + Intergenic
1062293763 9:135812449-135812471 TCCATGGATTTGCCTGTTCTGGG - Intronic
1062728510 9:138094209-138094231 TCGATGAATTTGACTACTATAGG - Intronic
1203633411 Un_KI270750v1:90951-90973 TCTATGGATTTGACTACTCTAGG + Intergenic
1185564107 X:1083014-1083036 TCTACAAATTTGACGACTCTAGG - Intergenic
1185844955 X:3429023-3429045 TCCAGGAATGTGTCTACTCTTGG + Intergenic
1186193911 X:7093206-7093228 TCTATGGATTTGACAACTCTAGG + Intronic
1186261485 X:7784716-7784738 TCTATGGATTTGACTACTCTAGG - Intergenic
1186413742 X:9365432-9365454 TCTACGGATTTGACTTCTCTGGG + Intergenic
1186519262 X:10191239-10191261 TCTATGGATTTGCCTATTCTGGG + Intronic
1186859428 X:13656888-13656910 TCTATGGATGAGACTACTCTAGG - Intronic
1187026514 X:15440926-15440948 TCTACAGATATGACTGCTCTAGG + Intronic
1187178824 X:16923011-16923033 TCTATGAATTTGACTACTCTAGG + Intergenic
1187379143 X:18784602-18784624 TCTACGAATTTCACCACTCTAGG + Intronic
1187381951 X:18810579-18810601 TCTATGGATTTGCCTATTCTCGG + Intronic
1187473171 X:19587276-19587298 TCTATGGATTTGACTACTCCAGG - Intronic
1187488517 X:19727365-19727387 TCTATACATTTGACTACTCTAGG + Intronic
1187600410 X:20823432-20823454 TCTATGATTTTGACTACTCTGGG - Intergenic
1187758451 X:22552235-22552257 TCCATGAATTTGACCACTCGAGG - Intergenic
1187777418 X:22777701-22777723 TTTATGAATTTGACTACTCTAGG + Intergenic
1187947548 X:24441171-24441193 TCTATGAATTTGACTACTCTAGG + Intergenic
1187957523 X:24534449-24534471 TCTCTGCATTTGACTACTCTAGG - Intronic
1188011537 X:25061361-25061383 TCTATGGATTTGACTACTCTAGG + Intergenic
1188435829 X:30157513-30157535 TCTATGAATTTGACTACTCTAGG - Intergenic
1188552095 X:31375649-31375671 TCTATGCATTTGACTATTCTAGG - Intronic
1188623454 X:32255043-32255065 TCTAAGAATTTAACTACTCTAGG + Intronic
1188712913 X:33424071-33424093 TCTATGATTTTGACTACTCTGGG - Intergenic
1188867954 X:35337914-35337936 TCTGTGAATTTGACTACTCTAGG + Intergenic
1188912752 X:35869971-35869993 TTTATGAATTTGACTACTCTAGG + Intergenic
1189425150 X:40893270-40893292 TCTATGAATTTGACTACTCTAGG + Intergenic
1189504747 X:41601039-41601061 CCTATGAATTTGACTACTCTAGG - Intronic
1189591436 X:42516620-42516642 TCCACTGATTTGGCTGCTATTGG + Intergenic
1189791502 X:44609672-44609694 TTTATGAATTTGACTACTCTTGG - Intergenic
1190012250 X:46795474-46795496 TCTATGAATTTGACTACTCTAGG + Intergenic
1190099141 X:47507697-47507719 TCCATAAATTTGACTACTTTAGG + Intergenic
1190211815 X:48454962-48454984 CCTACGGATTTGCCTATTCTTGG - Intergenic
1190510989 X:51174308-51174330 TCCAGTGAATTGATTACTCTAGG - Intergenic
1190796729 X:53752267-53752289 TCTATGAATTTGACTAATCTAGG + Intergenic
1190843078 X:54164460-54164482 TCTATGAATTTGACTACTTTAGG + Intronic
1191999600 X:67134717-67134739 TCTATGAATTTGACTACTCTAGG + Intergenic
1192268059 X:69553943-69553965 TCTGTGAATTTGACTACTCTAGG - Intergenic
1192374020 X:70540810-70540832 TCTATGAATTTGACCACTCTGGG + Intronic
1192386401 X:70675946-70675968 TCCACGGATTTGACTACTCTAGG + Intronic
1193098118 X:77576820-77576842 TCTACAAATTTCACTACTCTAGG + Intronic
1193104561 X:77655075-77655097 TCTATGAATTTTACTACTCTAGG - Intronic
1193108865 X:77707152-77707174 CCTAGGAATTTGACTACTCTAGG - Intronic
1193120794 X:77821015-77821037 CCTATGAATTTGACTACTCTAGG + Intergenic
1193125029 X:77861840-77861862 TCTATGAATTTGACTACTCTAGG - Intronic
1193517537 X:82487434-82487456 TCCATAAATTTGACTATTCTAGG - Intergenic
1193913609 X:87337795-87337817 TCTAAGAATTTGATTACTCTAGG - Intergenic
1194702412 X:97130544-97130566 TCTACAAATTTGACTATTCTAGG - Intronic
1194910498 X:99637034-99637056 TCTATGAATTTGACTACTTTGGG - Intergenic
1194948631 X:100098159-100098181 TTTATGAATTTGACTACTCTAGG - Intergenic
1195019780 X:100815487-100815509 TCTATGAATTTGACTACTCTAGG - Intergenic
1195280225 X:103326102-103326124 TCTATGAATTTGACTACTCTAGG + Intergenic
1195304680 X:103569296-103569318 TCTATGAATTTGACTACTCTAGG - Intergenic
1195805962 X:108765631-108765653 TCCATGTATTTGACCACTATAGG + Intergenic
1195921077 X:109984421-109984443 TCTATGCATTTGACTACTCTAGG - Intergenic
1195950056 X:110260978-110261000 GCTATGAATTTGACTACTCTAGG - Intronic
1196036781 X:111154081-111154103 TCTATGAATTTGACTCCTCTAGG - Intronic
1196871150 X:120115005-120115027 TCTATGATTTTGACTACTCTAGG - Intronic
1197220104 X:123904047-123904069 TCTATAAATTTGACTACTCTAGG + Intronic
1197700928 X:129599077-129599099 TCTATGGATTTGACTATTCTAGG - Intergenic
1197948578 X:131869356-131869378 TTCATGAATTTGAATACTCTGGG - Intergenic
1198037069 X:132811519-132811541 TCTATGAATATGACTACTCTAGG + Intronic
1198231069 X:134690066-134690088 TCTATAAATTTGACTACTCTAGG + Intronic
1198309456 X:135416007-135416029 TCAATGAATTTGACTACTCTAGG - Intergenic
1198558021 X:137816671-137816693 TCTATGAATTGGACTACTCTTGG + Intergenic
1198690714 X:139281490-139281512 TCTATGAATTTGACTACACTAGG + Intergenic
1199548983 X:149037730-149037752 TCTATGACTTTGACTACTCTAGG - Intergenic
1199712742 X:150482299-150482321 TCCATGAATTGGACTACTCTAGG - Intronic
1199723404 X:150559407-150559429 TCTATGAATTTGACTACTCTAGG + Intergenic
1199754083 X:150848331-150848353 TCTGTGAATTTGACTACTCTAGG - Intronic
1200006093 X:153085322-153085344 TCTATGGATTTGACCACTCTAGG + Intergenic
1200082252 X:153583503-153583525 TCTATGGATTTGACCACTCTAGG + Intergenic
1200179538 X:154141814-154141836 TCTATGGATTTGACCACTCTAGG + Intergenic
1200782044 Y:7225640-7225662 TCCAAGTATTTGACTCCTCAAGG - Intergenic
1201508256 Y:14728694-14728716 TCTATGAATTTGACAACTCTAGG - Intronic
1201565870 Y:15364885-15364907 TCTATGGATTTGACAACTCTAGG + Intergenic
1201682058 Y:16657208-16657230 TCTATGAATTTTACTACTCTGGG - Intergenic