ID: 1192388374

View in Genome Browser
Species Human (GRCh38)
Location X:70697327-70697349
Sequence GACATTATTCTGCTTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192388367_1192388374 8 Left 1192388367 X:70697296-70697318 CCAGAGATTAGGGCATGGAAGCC 0: 1
1: 1
2: 1
3: 12
4: 150
Right 1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG 0: 1
1: 0
2: 6
3: 24
4: 243
1192388365_1192388374 10 Left 1192388365 X:70697294-70697316 CCCCAGAGATTAGGGCATGGAAG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG 0: 1
1: 0
2: 6
3: 24
4: 243
1192388366_1192388374 9 Left 1192388366 X:70697295-70697317 CCCAGAGATTAGGGCATGGAAGC 0: 1
1: 0
2: 0
3: 13
4: 127
Right 1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG 0: 1
1: 0
2: 6
3: 24
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192388374 Original CRISPR GACATTATTCTGCTTGTCAC TGG Intronic
900905713 1:5555711-5555733 GGCATTATTCTGCTAACCACAGG + Intergenic
901130208 1:6957813-6957835 GCCATTATTCTGCCTGCCACAGG + Intronic
901752016 1:11416140-11416162 GACATTGTTCTGCCTACCACAGG + Intergenic
901769192 1:11521848-11521870 GATTTTATTCTGATTGTCACTGG + Intronic
902750614 1:18507048-18507070 CCCATTATTCTGCTTACCACAGG + Intergenic
903259491 1:22123731-22123753 GACATTATTCTGCCTCCCAGAGG + Intronic
903655165 1:24944434-24944456 GCCATTATTCTGCCTACCACAGG - Intronic
903683659 1:25114959-25114981 GCCATTATTCTGCTTGCCACAGG + Intergenic
905998407 1:42402181-42402203 GGCATTATTCTGCCTACCACAGG - Intronic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
909521406 1:76572813-76572835 GAAATTTTTCAGCTTGTCAAAGG + Intronic
910802230 1:91158315-91158337 GCCATTATTCTGCCTACCACAGG - Intergenic
911925501 1:103825659-103825681 GAAAATATTCTGCTTGGCAAAGG + Intergenic
912476586 1:109941228-109941250 GAAATTAGTCTGCTGGTCACGGG + Intergenic
912560893 1:110550831-110550853 GGCATTATTCTGCCTCTCACTGG + Intergenic
913153828 1:116074327-116074349 AACATTATTCAGCCTGTCACAGG + Intergenic
913375844 1:118151436-118151458 AAAATTATTCTGCTTCTCAGTGG - Intronic
917444109 1:175092197-175092219 GACATGATCCTGCATGTCATAGG - Intronic
918339359 1:183554775-183554797 TTCCTTATTCTGCTTTTCACAGG + Intronic
919263380 1:195228670-195228692 GACAATTTTCTGCTTCTCAGTGG + Intergenic
1063801750 10:9587810-9587832 TACAATTTTCTGTTTGTCACTGG - Intergenic
1066291760 10:34020856-34020878 GACATTATTCTGGGTGTGTCTGG + Intergenic
1066447510 10:35497439-35497461 TAAAATATTCTGCTTATCACTGG + Intronic
1067980511 10:51079162-51079184 TACAATATTTTGCATGTCACAGG - Intronic
1070436020 10:76394373-76394395 CAAATTCTTCTGCTTTTCACTGG + Intronic
1072546947 10:96447289-96447311 GACTTTATTCTCTTTGTTACAGG + Intronic
1072833671 10:98687620-98687642 TTCATTATTCTGCCTATCACAGG + Intronic
1074106876 10:110395264-110395286 GACATTATTTTGCCTGTCTTGGG - Intergenic
1074470308 10:113721028-113721050 GACATTTTTCTTCTTCTTACTGG - Exonic
1074649333 10:115501361-115501383 GACATTATTTTACTTACCACAGG + Intronic
1075030396 10:119020832-119020854 GTCATTATTCAGCTTACCACGGG - Intergenic
1075576190 10:123579372-123579394 GACATTATTCTGGTGGTCCCAGG - Intergenic
1076203159 10:128573784-128573806 GACATTGTCCCCCTTGTCACAGG - Intergenic
1078391150 11:10936637-10936659 GTCATTATTCTGCCTACCACAGG + Intergenic
1078871372 11:15348298-15348320 GACATTGTTCAGCTTGTTAGAGG - Intergenic
1080131543 11:28801400-28801422 GTCATTATTCAGCCTGTAACAGG + Intergenic
1081094229 11:38912112-38912134 GACATTTTTGTGCTTGTGAAAGG + Intergenic
1081261102 11:40962031-40962053 GCCATTATTCCGCTTCTTACAGG - Intronic
1084316172 11:68347146-68347168 GACCTTGTTCTGCATGGCACTGG + Intronic
1084432183 11:69117190-69117212 GACATTATTCAGCTTTACAGAGG - Intergenic
1086091402 11:83008434-83008456 GTCATTCTTTTGCTTGACACAGG - Intronic
1090134275 11:124180473-124180495 AACATTCTTCTGCACGTCACTGG + Intergenic
1090341974 11:126031887-126031909 GAGTTTATTATGCTTGTCAAAGG - Intronic
1090384734 11:126350882-126350904 GCCTTTACTCTGCTTGTCATTGG - Intergenic
1093386898 12:18568208-18568230 GGTATTATTCTGCCTATCACGGG + Intronic
1093641512 12:21532179-21532201 TACATTATTATGTTTGCCACAGG - Exonic
1093914146 12:24781805-24781827 GCCATTATTCTGCCTACCACAGG + Intergenic
1094321704 12:29190827-29190849 GAAATTCTTCTGATTGTCAGTGG - Intronic
1097436119 12:59553037-59553059 GATATTATTCTCATTATCACGGG + Intergenic
1097920496 12:65067581-65067603 GAAATTATTTTCCTGGTCACAGG - Intronic
1098592682 12:72232216-72232238 GACTTTACTGTGCTTCTCACAGG + Intronic
1100761905 12:97816702-97816724 GACTTGATTCTGTTGGTCACTGG - Intergenic
1101581179 12:106042189-106042211 CAGATTCTTCTGCTGGTCACAGG - Intergenic
1103973172 12:124685134-124685156 AACAATATTCTGGTTTTCACTGG - Intergenic
1107547748 13:41449601-41449623 GACATTACTCCTCATGTCACAGG - Intergenic
1107671682 13:42752807-42752829 GACATTATACAACTTGTCAAAGG + Intergenic
1109636245 13:65121492-65121514 CTCATTATTCTGCTTACCACAGG + Intergenic
1110017886 13:70431907-70431929 TACAGTAGTCTGCTTGTCAGTGG - Intergenic
1111587679 13:90303837-90303859 GATATTATTCTACCTGTCGCAGG - Intergenic
1111741810 13:92214665-92214687 GTCATTATTCTGCCTCTCAGGGG - Intronic
1112143031 13:96667521-96667543 AATAATATTCAGCTTGTCACTGG - Intronic
1112863248 13:103861592-103861614 GACATTCTTCTGCTTCACAAAGG - Intergenic
1114688436 14:24557423-24557445 GACATTATTCTACTTGAAAATGG - Intergenic
1115574005 14:34693508-34693530 CACGTTATTCTGCTGGTCAGTGG - Intergenic
1116515721 14:45802654-45802676 GCCATTATTCTCCCTATCACAGG + Intergenic
1118077923 14:62322427-62322449 AACATTTTTCTGGTTGTCTCTGG + Intergenic
1118711706 14:68524935-68524957 GCCATTACTCTGCCTATCACAGG - Intronic
1118889137 14:69893343-69893365 GCCATTATTTTCCTTGTCTCTGG + Intronic
1125071639 15:35561749-35561771 GACATTATTCAGCTTGTTCCAGG - Intergenic
1128207768 15:65868381-65868403 GGCATTATTCTGCTTGTTATAGG + Intronic
1128232161 15:66042963-66042985 GACATAATTCAGCCTGTAACAGG + Intronic
1131904733 15:97130854-97130876 CACCTGATTCTGCTTTTCACAGG - Intergenic
1133468444 16:6050958-6050980 GACATGACTCTGCTTGTCTTTGG + Intronic
1135838957 16:25856083-25856105 GACCTTCCTCTGCTTTTCACGGG + Intronic
1138407043 16:56804418-56804440 GACATTATGCTGATTGTCTCTGG + Intronic
1138960968 16:62028576-62028598 GACTTTATTGTCTTTGTCACTGG - Intronic
1140348330 16:74236695-74236717 CACATTATTCTGCCTATCCCAGG + Intergenic
1141508366 16:84495917-84495939 CATATTTTTCTGCTTGTCCCCGG - Intronic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1146466261 17:33089085-33089107 GCCATTATTCTGCTTATCACAGG - Intronic
1147333311 17:39711834-39711856 GATATTATTCTTCTTGTGCCTGG + Intronic
1147797010 17:43051274-43051296 GACATTGGACTGCTTGTCCCTGG - Intronic
1148982633 17:51591950-51591972 GACATTATTCTGTCAATCACAGG - Intergenic
1151930021 17:77226399-77226421 GACATTATTCTGGGTGTCTGTGG + Intergenic
1152449415 17:80367552-80367574 GTGATTATGCTGCTTGTCAGGGG - Intronic
1153393396 18:4590125-4590147 GCCTTGATTCTGCTTGTCACTGG + Intergenic
1153586624 18:6627807-6627829 GACATTATGTTTCTTGTTACTGG - Intergenic
1153592394 18:6687228-6687250 GGCATTATTCTGCCTACCACAGG + Intergenic
1153904365 18:9647987-9648009 GACATTCTTCTGCTTCAAACTGG - Intergenic
1156518407 18:37700293-37700315 GATATGATTCTTCATGTCACAGG - Intergenic
1156829743 18:41477532-41477554 GCCATTATTCTGCCTACCACAGG + Intergenic
1157116818 18:44869875-44869897 GACATCATCCTGCCTGTCTCTGG + Intronic
1157439954 18:47703100-47703122 CACATTATTCTGGTTTTTACAGG + Intergenic
1158361559 18:56679399-56679421 CACAATATACTGTTTGTCACTGG - Exonic
1160187885 18:76689333-76689355 GGCATTATTCAGCGTGTCAGTGG - Intergenic
1162156510 19:8681687-8681709 GAAATGAGTCTGCTTGTCATAGG - Intergenic
1164597055 19:29537232-29537254 GAAATTAGCCTGCTTGTCAGTGG + Intronic
1166242439 19:41503540-41503562 GACATTACTCTCCATATCACGGG - Intergenic
1166414026 19:42579180-42579202 GCCATTATTCTGCCTAACACTGG - Intergenic
1168193878 19:54758920-54758942 GACATTCTTCTCATTGTCATTGG + Intronic
1168197824 19:54788511-54788533 GACATTATTCTCATTGTCACTGG + Intronic
1168201710 19:54820026-54820048 GACATTGTTCTCATTGTCACTGG + Intronic
1168204294 19:54837889-54837911 GACATTCTTCTCATTGTCATTGG + Intronic
1168206515 19:54854060-54854082 GACATTCTTCTCATTGTCATTGG + Intronic
925007271 2:453465-453487 GACATTTCACTGCTTGGCACAGG - Intergenic
925372434 2:3356552-3356574 GCCATTATTATGCTGGCCACGGG - Intronic
926067422 2:9854510-9854532 GAGATTATGATGCTTGTCAGAGG + Intronic
926292224 2:11540190-11540212 GCCATTATTCTGCTGAACACAGG - Intronic
927068042 2:19493531-19493553 AAAATTATTGTGCTTGGCACAGG + Intergenic
929827156 2:45317849-45317871 GCCATTATTCTGCCCATCACAGG - Intergenic
930519900 2:52452533-52452555 GACTTTATTCTGTTGGTCCCAGG + Intergenic
930554218 2:52874952-52874974 GACATTACTCTGCCTGTAAATGG - Intergenic
932348971 2:71016613-71016635 GACATTACTCCTCATGTCACAGG - Intergenic
932851056 2:75187304-75187326 GAGATAATTCTGCCTGTGACAGG + Intronic
933313105 2:80684961-80684983 ACCATTATTCTGCCTGCCACAGG + Intergenic
934309124 2:91847833-91847855 GAAATTATACCACTTGTCACTGG + Intergenic
935939103 2:108220138-108220160 GCCATCATTCTGCCTATCACAGG + Intergenic
936506125 2:113108688-113108710 GGCATTATTCTGCTTACCACAGG + Intronic
936726714 2:115327963-115327985 GACATTATTGTCCTTGTCAATGG - Intronic
937783800 2:125871034-125871056 GACATTATTGTGATTTCCACGGG - Intergenic
938948128 2:136232902-136232924 GAAATTGTTCTGCTTGCCAATGG + Intergenic
939069338 2:137520000-137520022 GACATTATTCTCCATGCCTCAGG - Intronic
939322442 2:140641730-140641752 GACTTTTTTCTGTTTGTCAAAGG + Intronic
945029857 2:205653117-205653139 GCCATTATTCGGCCTATCACAGG - Intergenic
945932333 2:215867312-215867334 CTCATTATTCTGCTTGTCACAGG + Intergenic
946918537 2:224552414-224552436 GATATTATTTTTCTTGTCTCTGG - Intronic
947759613 2:232594193-232594215 GGCATTTTGCTGCTTGACACTGG - Intergenic
948373199 2:237503805-237503827 GGGATTATTCTGCTTACCACCGG - Intronic
1169816143 20:9658541-9658563 GAAATTAGTCTGCTTTTCAAAGG + Intronic
1170776690 20:19380856-19380878 CACATTATTCTGGATGTCAAAGG - Intronic
1173626591 20:44477298-44477320 GACTTTAGTCTGGTTGGCACAGG - Intronic
1174245999 20:49180902-49180924 TAATTGATTCTGCTTGTCACTGG - Intronic
1175711898 20:61227989-61228011 GGCATTATTCTGCTGGCCACAGG - Intergenic
1176890354 21:14309739-14309761 GAGCTTATTCATCTTGTCACAGG - Intergenic
1179206967 21:39290570-39290592 GAAATGATTCTTCTTGTAACGGG - Intronic
1179671207 21:42950029-42950051 GATGTTATTCTTATTGTCACAGG + Intergenic
1179671366 21:42951400-42951422 GACATTACTCCTCATGTCACAGG + Intergenic
1179795534 21:43780728-43780750 GCCATTATTCTGGAGGTCACAGG + Intergenic
1180536209 22:16394947-16394969 GAAATTATACTACTTCTCACTGG + Intergenic
1185212588 22:49579300-49579322 GACATAATTCAGCCTGTAACAGG - Intronic
949886555 3:8699602-8699624 GACATTACTCCTCATGTCACAGG - Intronic
951663191 3:25093600-25093622 GCCATTATTCTGGAGGTCACAGG + Intergenic
951806914 3:26655372-26655394 GACATTATGGTGCCTCTCACAGG - Intronic
951832798 3:26949290-26949312 GACATTATTTTGCCTACCACAGG - Intergenic
954814488 3:53270074-53270096 GACATGACCCTGCTTGTCCCTGG + Intergenic
955581977 3:60433234-60433256 AACATTATTCACCTTGTCATAGG - Intronic
955588034 3:60502562-60502584 GACATTATTGTGCTAAGCACTGG - Intronic
956555751 3:70520853-70520875 GACATTATTCATCTTTTCATGGG - Intergenic
957027548 3:75200434-75200456 GACATTATTAGGCTTGTCACAGG - Intergenic
957144298 3:76403145-76403167 GCCATTATTATGCCTATCACAGG + Intronic
958600146 3:96287257-96287279 GTCATTATTCTGGCTATCACAGG - Intergenic
959086911 3:101860696-101860718 AACATTATTTTGCTTGCCGCTGG + Exonic
961271148 3:125689844-125689866 GACATTACTCCTCATGTCACAGG - Intergenic
964889559 3:161519252-161519274 GATATTATTCTCCTTGCCCCTGG + Intergenic
967768721 3:193311139-193311161 GATATTAATCTGCTTGTCTAAGG - Intronic
970039585 4:11780887-11780909 GACACAATTCAGCTTGTCACGGG + Intergenic
970680673 4:18503971-18503993 AACATTATTCTGCCTACCACAGG + Intergenic
971235751 4:24840612-24840634 CACATTTTTGTGCTTTTCACTGG + Intronic
971454901 4:26834990-26835012 GCCATTATTCTGCCTACCACAGG - Intergenic
972299196 4:37769152-37769174 GCCATTATTCAGCCTATCACAGG - Intergenic
972490873 4:39585898-39585920 GACATTATTCTTCATGACAAGGG - Intronic
975448800 4:74500529-74500551 GACATGATTCTCCCTGTCTCAGG - Intergenic
975925574 4:79447404-79447426 GACATTATTCTGCATGTATCTGG + Intergenic
976028963 4:80727803-80727825 GAAAATATTTTGCTTGTCAATGG - Intronic
977750685 4:100606882-100606904 GAGATTATTCTTCCTATCACAGG - Intronic
978427949 4:108601973-108601995 GGCATTATTCTGCCCATCACAGG - Intergenic
978793621 4:112687618-112687640 GACATTGTTTTCTTTGTCACTGG + Intergenic
979265347 4:118695718-118695740 AACATTATTCTGCTTAGCAACGG - Intronic
980847851 4:138345337-138345359 ACCCTTATTCTGCTTATCACAGG - Intergenic
982775795 4:159440021-159440043 AACATTATTCTGCTTAACACAGG + Intergenic
982980101 4:162122258-162122280 GACATCATTCTACTTGTGGCTGG + Intronic
983624089 4:169787086-169787108 GATATTACTCTTCATGTCACAGG - Intergenic
984203320 4:176754755-176754777 GCCATTATTCTGCTTACCACAGG + Intronic
988120084 5:26950216-26950238 AACAATATTCCACTTGTCACAGG - Intronic
988334043 5:29882091-29882113 TTCCTTATTCTGGTTGTCACAGG - Intergenic
989125695 5:38050521-38050543 TACAGTATTCTGTCTGTCACAGG - Intergenic
989279765 5:39627406-39627428 GATACAATTCTGCTTGACACTGG - Intergenic
989384047 5:40837035-40837057 GCCATTATTCTGCCTACCACGGG + Intergenic
991925380 5:71700375-71700397 TACATGATTCTGACTGTCACAGG + Intergenic
992183782 5:74224208-74224230 GTCATTATTCAGCCTGTGACGGG - Intergenic
993844476 5:92923473-92923495 GACATAGTCCTGATTGTCACTGG - Intergenic
994828024 5:104741605-104741627 GTCATTTTTCTTTTTGTCACTGG - Intergenic
996555710 5:124777122-124777144 GACGTTATTCTGCCTACCACAGG + Intergenic
996834056 5:127771661-127771683 GATATTCTTCTGCTTATCAAAGG - Intergenic
997778289 5:136630885-136630907 GACATCTTTCTGCTTATCCCGGG + Intergenic
999210694 5:149886098-149886120 GTCATTATTCTGCCTGCTACAGG + Intronic
999483668 5:151971757-151971779 GATCTTATTTTGGTTGTCACCGG - Intergenic
1001834608 5:174821168-174821190 GGCATTATTCTGCTTATTGCAGG - Intergenic
1002086618 5:176779956-176779978 GGCATTATTCTGCCTGTCACAGG - Intergenic
1002708131 5:181176799-181176821 AACATTATTCTTATTGTCAGAGG - Intergenic
1003424866 6:5992131-5992153 GACGTTTTTCTGCTTACCACAGG + Intergenic
1003536057 6:6976434-6976456 AAAAGTGTTCTGCTTGTCACTGG + Intergenic
1004474540 6:15959160-15959182 GCCATTATTCTGGAGGTCACAGG - Intergenic
1004998323 6:21215775-21215797 GGCATTATTCTGCCTACCACAGG - Intronic
1005257107 6:24014873-24014895 GAAATTATTCTTCCTGACACAGG + Intergenic
1005377607 6:25199920-25199942 ACCATTATTCTGCCTGCCACAGG - Intergenic
1006020256 6:31113594-31113616 GACATCATTCTGCCTGCTACTGG + Intergenic
1008194747 6:48504897-48504919 GAAATAATTCTCCTAGTCACTGG + Intergenic
1008341192 6:50366302-50366324 GACATTATGCTGCTAGTCCAGGG + Intergenic
1008355549 6:50548291-50548313 GACATTAGTCATCTTGTGACAGG - Intergenic
1008491148 6:52088548-52088570 AAAATTTTTCAGCTTGTCACGGG - Intergenic
1009223740 6:61004799-61004821 GATATTATTCTTCATATCACGGG + Intergenic
1009486187 6:64225275-64225297 GCCATTATTCTGCCTACCACAGG - Intronic
1009942713 6:70307279-70307301 GACATTATTCTGGCTGTTATAGG + Intergenic
1011541148 6:88431538-88431560 GACCTTATTCAGTTTTTCACTGG - Intergenic
1012433405 6:99189805-99189827 GCCATTATTCTGCCTACCACAGG + Intergenic
1013548660 6:111185602-111185624 GTCCATGTTCTGCTTGTCACAGG - Intronic
1014447659 6:121547166-121547188 CACATCATTCTGCTGGTCAGTGG + Intergenic
1015207555 6:130656958-130656980 GCTATTATTCTGCCTATCACAGG + Intergenic
1015426523 6:133076053-133076075 CACATTATTCTGCTAGTAAGTGG - Intergenic
1016167131 6:140960163-140960185 GCCATTATTCTACATATCACAGG + Intergenic
1016651612 6:146467993-146468015 AACATTTCTCTTCTTGTCACTGG - Intergenic
1018158986 6:161019037-161019059 GACACTATTCCACATGTCACTGG - Intronic
1019051849 6:169189686-169189708 GACAATATTCTGCTTCTCATGGG + Intergenic
1020674076 7:11158848-11158870 GACATCATTCTGCTTAACAAGGG + Intronic
1022892959 7:34719852-34719874 GACATTAGACTGTCTGTCACTGG - Intronic
1023768869 7:43536653-43536675 GCCATTCTTCTGCTTCTCATGGG - Intronic
1026108804 7:67442216-67442238 GACATAATTTAGCTTATCACAGG - Intergenic
1028341887 7:89732525-89732547 GGCATTATTCTGCCTATCATAGG - Intergenic
1028377720 7:90164121-90164143 GTCTTAATTCTGCTTATCACAGG - Intronic
1030300354 7:107968377-107968399 GCCATTATTCTGCCTCACACAGG - Intronic
1030326697 7:108227238-108227260 TAAATTATTATGCTTGACACTGG - Intronic
1030918038 7:115341398-115341420 GATTTTATTCTGATTGTCACTGG - Intergenic
1031167451 7:118246236-118246258 GCCATTATTCTGCTACCCACAGG + Intergenic
1031167479 7:118246580-118246602 GCCATTATTCTGCTACCCACAGG + Intergenic
1031563782 7:123269374-123269396 GACATTGTTCTGCTGAACACAGG + Intergenic
1035220132 7:157401633-157401655 GACATGGTTCAGCTTGTAACAGG + Intronic
1036750593 8:11441343-11441365 GACACTATTCTGTTAGTCCCTGG - Intronic
1037248081 8:16860158-16860180 GACTTTATTCTCCTAGTCATAGG + Intergenic
1038121454 8:24621152-24621174 GACATTATTCAGCTTATTGCAGG - Intergenic
1038174885 8:25171718-25171740 GTTGTTCTTCTGCTTGTCACTGG - Intergenic
1038966640 8:32580308-32580330 GCCATTATTCTGCCTGCTACAGG + Intronic
1041029459 8:53721707-53721729 TACATTATTCTACCTCTCACTGG + Intronic
1041965894 8:63675998-63676020 GACATAATTCTGCATGTGCCAGG + Intergenic
1042207646 8:66345212-66345234 GAGATTATTCTGCCTACCACAGG - Intergenic
1042366952 8:67948076-67948098 GCCATTATTCTGCCTACCACAGG + Intergenic
1043301578 8:78741164-78741186 GACATCATCATGCTTTTCACAGG - Intronic
1043889057 8:85636128-85636150 GACATGATTCAGCTTGCCTCTGG + Intergenic
1045000643 8:97875181-97875203 GCAATTATTCTGCCTGCCACAGG + Intronic
1045923977 8:107566098-107566120 GACATTATTCCCCATGTCACAGG + Intergenic
1046845187 8:118907500-118907522 AACATTATTCTGCCTGCCACAGG - Intergenic
1047839879 8:128739727-128739749 GAGATTATTTTTCTTCTCACAGG + Intergenic
1048663847 8:136638404-136638426 GGCATTATTCTGCCTACCACAGG - Intergenic
1048900740 8:139035044-139035066 GTCATTATTCTGCCTACCACAGG + Intergenic
1050876031 9:10637781-10637803 GGCATTATTCTGGCTATCACAGG - Intergenic
1051622158 9:19062146-19062168 AACACTATTCTGCTTTTTACTGG - Intronic
1055155256 9:73055049-73055071 GACATTGTCCTGCTTGCCAACGG - Intronic
1055161348 9:73132141-73132163 GACATTCTTCTGCTTGACAGAGG + Intergenic
1055665567 9:78549607-78549629 GGCATTATTCTGCCTACCACAGG - Intergenic
1056440914 9:86620250-86620272 GACATTATGCTACTTGAAACGGG - Intergenic
1058204384 9:102085011-102085033 CCCATTATTCTGCTTACCACAGG + Intergenic
1058671082 9:107360874-107360896 GCCATGATTCTGCCTCTCACAGG + Intergenic
1058798246 9:108519088-108519110 GACATTATTCTGTTAGACAATGG + Intergenic
1059619397 9:115986931-115986953 GGTATTATTCTGCTTAACACAGG - Intergenic
1186321427 X:8430033-8430055 GACATACTTCTGATTTTCACAGG - Intergenic
1186880788 X:13864216-13864238 TACATTATTCTGCATGTCCTTGG - Intronic
1187434572 X:19255474-19255496 GACATTATTCTGTCGATCACAGG + Intergenic
1188266905 X:28088021-28088043 GGCATTATTCTGCCTACCACAGG + Intergenic
1188451481 X:30311537-30311559 GACACTATTCAGCCTATCACAGG + Intergenic
1188567848 X:31546717-31546739 GACATTATGCTTCTTGTCAGAGG + Intronic
1189136712 X:38558115-38558137 TTCATTAATCTACTTGTCACTGG + Intronic
1192388374 X:70697327-70697349 GACATTATTCTGCTTGTCACTGG + Intronic
1194776490 X:97971673-97971695 GATATTATTCTGGTTGGCCCTGG + Intergenic
1197653609 X:129091751-129091773 GCCATTATCCTGTTTTTCACAGG + Intergenic
1198314917 X:135455548-135455570 GACTATGTTCTGCTTGTCTCTGG - Intergenic
1198496632 X:137199847-137199869 GAAATTCTTCTGATTGTCAGTGG + Intergenic
1198711559 X:139509586-139509608 GACATGATTCTGTTCTTCACTGG - Intergenic
1198952487 X:142087366-142087388 GACATTATTCTGAGTACCACAGG + Intergenic
1199010366 X:142751063-142751085 AACATTATTCAGCTTTTCAAAGG - Intergenic
1199763723 X:150925451-150925473 GCCATTATTCAACTTCTCACAGG - Intergenic
1199876508 X:151933364-151933386 GATATTGTTCTGCTTTTCTCTGG + Intergenic
1199905515 X:152225315-152225337 AACATAATTCTGCTGCTCACAGG + Intronic
1201155926 Y:11131394-11131416 GATATTATTCTGAATATCACAGG + Intergenic
1201682500 Y:16663232-16663254 GACATTATCCTGACTATCACAGG + Intergenic