ID: 1192395265

View in Genome Browser
Species Human (GRCh38)
Location X:70774162-70774184
Sequence CCTGGGGCCCAGCAGCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 1, 2: 8, 3: 70, 4: 477}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192395259_1192395265 -2 Left 1192395259 X:70774141-70774163 CCACAACAGACTGCGCACTGTCC 0: 1
1: 3
2: 10
3: 18
4: 101
Right 1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG 0: 1
1: 1
2: 8
3: 70
4: 477
1192395256_1192395265 4 Left 1192395256 X:70774135-70774157 CCCAGCCCACAACAGACTGCGCA 0: 1
1: 1
2: 2
3: 17
4: 144
Right 1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG 0: 1
1: 1
2: 8
3: 70
4: 477
1192395257_1192395265 3 Left 1192395257 X:70774136-70774158 CCAGCCCACAACAGACTGCGCAC 0: 1
1: 1
2: 4
3: 18
4: 119
Right 1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG 0: 1
1: 1
2: 8
3: 70
4: 477
1192395258_1192395265 -1 Left 1192395258 X:70774140-70774162 CCCACAACAGACTGCGCACTGTC 0: 1
1: 0
2: 9
3: 14
4: 62
Right 1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG 0: 1
1: 1
2: 8
3: 70
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192395265 Original CRISPR CCTGGGGCCCAGCAGCACCA GGG Intronic
900181265 1:1312027-1312049 CCAGGAGACCAGCAGCACCTTGG + Exonic
900205578 1:1430783-1430805 CCTGAGGCCCCGCACCGCCAGGG + Intergenic
900338665 1:2177392-2177414 TATGGGGCCCACCAGCACCATGG + Intronic
900408779 1:2503717-2503739 ACTGGGCCCCAGCAGCAGCAGGG + Intronic
900606517 1:3525992-3526014 GCAGGGGCCCAGCAGCTGCAGGG - Intronic
900711364 1:4116632-4116654 CCAGGAGCCAAGGAGCACCAAGG - Intergenic
900918931 1:5658698-5658720 CCAGGGCCCCAGCTGCACCTTGG - Intergenic
901146575 1:7069070-7069092 CCGGGGGCCCAGCAGGGTCAAGG - Intronic
901235267 1:7664269-7664291 CCTGAGTCCCAGCACCACCCTGG + Exonic
901496783 1:9626991-9627013 CCAGGACCCCAGCAGCGCCAGGG + Intergenic
901503912 1:9671999-9672021 CCTGGGAACCCGCAGCACAAGGG - Intronic
901663356 1:10812889-10812911 CCTGGGGCCCAGCAGTTCCTGGG + Intergenic
901849569 1:12006978-12007000 TCTGGGGCCCATCACTACCAGGG - Intronic
901857395 1:12053110-12053132 CCTGGTGCCCAGCAAGACCTGGG - Intergenic
902301474 1:15505618-15505640 CCTGAGTCCCACCAGCAGCAAGG + Intronic
902330120 1:15727200-15727222 AGAGGGGCCGAGCAGCACCACGG + Exonic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
903500075 1:23795855-23795877 GCTTGGCCCCAGCAGCTCCAGGG + Exonic
904598569 1:31661677-31661699 CAGGGGGGCCAGCAGGACCAGGG + Exonic
904858450 1:33517389-33517411 CCTGGAACCCAGCAGAACCCAGG + Intronic
905276044 1:36818944-36818966 GCTGGTGGCCAGCAGGACCAGGG + Intronic
905894035 1:41533773-41533795 GCTGGGGGCCATCAGCACCCAGG - Intronic
906246936 1:44282915-44282937 CCTTTGGGCCAGCAGCACCAAGG + Intronic
906762266 1:48386875-48386897 CCTGGAGCCCAGTGGCAGCAGGG + Intronic
906762337 1:48387391-48387413 CCTGAAGCCCAGCAGCACTGGGG + Intronic
907241844 1:53085266-53085288 CCAAGGCCCCAGCAGCACCCAGG - Exonic
909342260 1:74545314-74545336 CCTGAGAACCAGGAGCACCAAGG - Intergenic
909665915 1:78133335-78133357 CCTGAGGACCAGCATCACCTGGG + Intronic
910394577 1:86779015-86779037 CCTGGGGCCTGGCATCATCAGGG - Intergenic
911171650 1:94776490-94776512 CCTGGGGCTCCACAGCTCCAGGG - Intergenic
915444599 1:155967538-155967560 GCTGGGCCTCAGCAGCTCCAAGG + Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916786468 1:168090597-168090619 CCTGGGGCACAGCAGCAGCACGG - Exonic
918070727 1:181131795-181131817 ACTGGGGCCCTGCAGCTCCCCGG - Intergenic
919351165 1:196455794-196455816 CCTGGGGGCCAGCAGTACACTGG + Intronic
919474417 1:198017026-198017048 CCTGAGGACCAGGAGCACCAAGG + Intergenic
919829654 1:201531575-201531597 CCTGGAGCTGAGCAGCAACAAGG - Intergenic
920366567 1:205451049-205451071 ACTGGGGCCCAGCAGCCCAAGGG + Intronic
920422539 1:205844897-205844919 CCTGGGGTTCAGAAGCACAATGG + Exonic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
922336606 1:224623416-224623438 CCTGGGACCCAGCAGCTCCCGGG - Intronic
922554165 1:226520402-226520424 CCTGGGGCCCAGCCTCAGCGGGG + Intergenic
922776479 1:228216409-228216431 CCTGGCCCCCAGCGGCCCCAGGG + Exonic
924416847 1:243864839-243864861 CCTGGGAACCTGGAGCACCAAGG - Intergenic
924480380 1:244426382-244426404 CCTGGGGCCTAGAAAAACCAAGG - Intronic
1063173447 10:3530360-3530382 CCTGGGGTACAGCAGCATCCCGG - Intergenic
1063512195 10:6656302-6656324 TCTGTGGCTCAGCAGCTCCAGGG - Intergenic
1063602755 10:7497165-7497187 CCTGGGCCCCAGGAGCACTCAGG - Intergenic
1063864402 10:10348221-10348243 CCTGAAGCCCTGCAGCACCCGGG + Intergenic
1065100518 10:22326114-22326136 CCTCCAGCCCAGCAGCCCCAAGG - Intronic
1065725830 10:28667273-28667295 CCTGGGGCCCAGCATTAGCTTGG - Intergenic
1066201131 10:33143577-33143599 CATGGGGCCCGTCAGAACCAGGG + Intergenic
1066984636 10:42454321-42454343 CCTGGGTTGCACCAGCACCAGGG - Intergenic
1067081572 10:43215473-43215495 CCTGAGGCCCACCAGGATCATGG - Intronic
1067427717 10:46222136-46222158 CCAGGGACCCAGCCTCACCATGG - Intergenic
1067478038 10:46579039-46579061 GCTGGGCACCAGCAGCACCACGG + Intronic
1067583134 10:47458025-47458047 CCAGGGACCCAGCCTCACCATGG - Intergenic
1067616702 10:47762748-47762770 GCTGGGCACCAGCAGCACCACGG - Intergenic
1068474307 10:57506592-57506614 CCTGGCTCCCACCAGCTCCATGG - Intergenic
1069826433 10:71257701-71257723 CTTGGGGCCCAGCAGCCCTCTGG + Intronic
1070471413 10:76783883-76783905 CCTGGGGTCCAGTTGCACTAAGG - Intergenic
1070542580 10:77427139-77427161 CCTGGTGCACATCAGCATCATGG + Intronic
1070755874 10:78992941-78992963 CTTGGGCCCCTCCAGCACCAGGG + Intergenic
1071404662 10:85318430-85318452 CCTAGGGCCCAGTGGCACCTGGG + Intergenic
1071666519 10:87564021-87564043 CCTGGGGCTCAGCAGCTCCAGGG + Intergenic
1072437710 10:95428988-95429010 CCTGGGGCCTAGGAGCCCCTGGG - Intronic
1073122824 10:101132598-101132620 CCACTGGCCCCGCAGCACCACGG - Intronic
1073266401 10:102230767-102230789 CCTGGGGCCCTGCAGGGCCTGGG - Exonic
1073517185 10:104086945-104086967 CCTGGGACCCAGCATCACACTGG + Intergenic
1075067627 10:119300172-119300194 CCTGTGGCACAGCGGCACCCAGG - Intronic
1075176236 10:120163810-120163832 CCAGGGGCGCAGAAGCTCCATGG + Intergenic
1075450252 10:122546357-122546379 CCTGGGGGCCAGCAGAGGCATGG + Intergenic
1076001015 10:126913020-126913042 CCTCGAGTCCAGTAGCACCAGGG - Intronic
1076590140 10:131577149-131577171 TCTGGGGCCCAGCCTCTCCAAGG - Intergenic
1076720646 10:132391152-132391174 CCTGTGGACCAGCAGCTCCAGGG + Intergenic
1076871877 10:133198518-133198540 CCCGGGACCCAGCAGCTCCGGGG - Intronic
1076992010 11:280324-280346 CGCCGGGCCCTGCAGCACCACGG - Exonic
1076994072 11:289798-289820 GCTCAGGCCCAGCAGCTCCATGG + Exonic
1078090345 11:8261194-8261216 CCCAGAGCCCAGCAGCTCCATGG + Intronic
1078662248 11:13296958-13296980 CCTGAGGCCAAGCAGCACCCAGG - Intronic
1078830315 11:14971884-14971906 TCTGGAGCCCAGCAGTCCCAGGG - Intronic
1079115907 11:17640596-17640618 CCTGGGGCCCCTCAGCAGCCTGG - Intronic
1080802804 11:35623822-35623844 CATGTGGCCCATCAGCTCCAGGG + Intergenic
1080988977 11:37507173-37507195 TCTGAGCCCCAGCAGCAACAAGG - Intergenic
1081807148 11:45896841-45896863 CCTGGGGCCCCGCAGCCCCCCGG + Intronic
1081823257 11:46021460-46021482 CCTGGGCCCAAGCATCACCAAGG + Intronic
1083721856 11:64607426-64607448 CCGGGAGTCCAGCAGCACCACGG - Exonic
1083765087 11:64837893-64837915 CATGTGGCCCAGCAGGACCTGGG + Intronic
1084377070 11:68784736-68784758 ACTGGGGCCCATCCCCACCAGGG - Intronic
1084536844 11:69762417-69762439 CCAGGTGCCCAGCAGCACACTGG + Intergenic
1084662169 11:70552341-70552363 CCTGGTGCCCAGCAGGGCCCTGG + Intronic
1084666852 11:70580950-70580972 CCTGGAGCCCACCAGGTCCAGGG + Intronic
1084998958 11:73011513-73011535 CCTGGGGTCCAGCATCACTAGGG - Intronic
1085046471 11:73356554-73356576 CCTGTGGCCTGGCAGCACAAGGG + Intronic
1085593660 11:77789399-77789421 CCTGGGGCCCAGTGCCACCAGGG + Intronic
1086184624 11:83998802-83998824 CCTGGAACCCAGCAGTGCCAGGG + Intronic
1086690108 11:89780202-89780224 CCTCGGGCCCCTCAGCAGCAAGG + Intergenic
1086698555 11:89872770-89872792 CCTCGGGCCCCTCAGCAGCAGGG - Intronic
1086707614 11:89971726-89971748 CCTCGGGCCCCTCAGCAGCAAGG + Intronic
1086715746 11:90059755-90059777 CCTCGGGCCCCTCAGCAGCAAGG - Intergenic
1087150448 11:94854969-94854991 CCTGGGGTTCACCTGCACCACGG + Intronic
1088982336 11:114875034-114875056 TCTGGGGCCCAGAGGCTCCATGG - Intergenic
1089064213 11:115650156-115650178 CCTGGTTCCCACCAGCACCTTGG + Intergenic
1090404144 11:126467174-126467196 CCTGGGGCCCCGCAGAGTCACGG - Intronic
1091788656 12:3258370-3258392 TCTGGGGCCCAGAATCACCTTGG + Intronic
1092174125 12:6391172-6391194 CCTGAGGCTGAGCAGCCCCAGGG - Exonic
1092247700 12:6872762-6872784 CTGGGGGCCCAGCGGCGCCACGG - Exonic
1093746003 12:22741802-22741824 CCTGAGGCACAGCAGCTCCAGGG - Intergenic
1094734930 12:33223366-33223388 CCTGGCCCCCAACAGCTCCAGGG - Intergenic
1094840041 12:34339027-34339049 TGTGGGGCCCAGCAGCTCCGGGG - Intergenic
1094841372 12:34343981-34344003 CCAGGGGCCCAGCCGCTCCATGG - Intergenic
1094841540 12:34344511-34344533 CGCGGGGCCCAGCAGCTCCGAGG + Intergenic
1094841957 12:34345953-34345975 CGCGGGGCCCAGCAGCTCCGGGG + Intergenic
1094852664 12:34389222-34389244 CCTGGGGCCCAGGAGACCCTGGG + Intergenic
1094856539 12:34405417-34405439 CCTGGGGCCCAGGGGACCCAGGG + Intergenic
1095973702 12:47924540-47924562 CATGGGGCCCAGCTGGGCCACGG + Intronic
1095983492 12:47985551-47985573 CTTGAGGACCAGCATCACCAGGG + Exonic
1095984297 12:47989227-47989249 CCTTGGCTCCAGGAGCACCAGGG + Exonic
1096973791 12:55686940-55686962 GGTGGGGTCCAGCAGGACCATGG - Intronic
1097181699 12:57175380-57175402 CTTGGGGCCCAGCAGGGCCGTGG + Intronic
1100650798 12:96586253-96586275 CCTGGGCCTCAGCATCACCCAGG - Intronic
1101642839 12:106601100-106601122 CCTGGAACCCAGCAGCCCCTGGG + Intronic
1102479099 12:113208634-113208656 CCTGGGGCCCAGGGTCACCCAGG + Intronic
1102584503 12:113913825-113913847 TCGGGGGACCTGCAGCACCATGG - Intronic
1102951163 12:117032643-117032665 CCTGGGCAACAGCAGCACCAGGG - Intergenic
1102955180 12:117054370-117054392 TCTGTGGACCAGCAGCAGCAGGG - Intronic
1104725233 12:131071624-131071646 TCTGTGGCCCAGCAGCACTGGGG - Intronic
1104751956 12:131245508-131245530 CCTGGGCCCCTGCAGCACCAGGG - Intergenic
1104898811 12:132176848-132176870 CCTGGAGCACAGCAGCCCCGGGG + Intergenic
1105847078 13:24302612-24302634 CCTGTGGCCCCACCGCACCAGGG + Exonic
1105851592 13:24340448-24340470 CCTGGGGTCCCGCAGCGCCTGGG + Intergenic
1106479065 13:30123391-30123413 TCTGGGGCCCAGCAGCCTCCTGG + Intergenic
1107719310 13:43231060-43231082 CCTGGGGCCCATCAGCTCACTGG + Intronic
1111314275 13:86532284-86532306 CCACGGACCCAGCAGCACCAAGG - Intergenic
1112033557 13:95477697-95477719 TCTGTGGACCAGCAGCACCTGGG + Intronic
1112333690 13:98497063-98497085 CTAGGTGCCCAGCAGCCCCAGGG + Intronic
1112466218 13:99647076-99647098 CCTCAGGCCCATGAGCACCATGG - Intronic
1114063107 14:19037946-19037968 ACTGGGGCACAGCAGGACCGGGG - Intergenic
1114099151 14:19362049-19362071 ACTGGGGCACAGCAGGACCGGGG + Intergenic
1114522376 14:23347518-23347540 CCACAGGCCCAGCAGGACCAGGG + Exonic
1114522800 14:23349375-23349397 ACAGGGGCCCACCAGCCCCAAGG + Exonic
1114582533 14:23775562-23775584 CCTGAGGCCCCGCAGTGCCATGG + Intergenic
1114679366 14:24471883-24471905 GCTAGGGCCCAGTAGCACCCTGG + Intergenic
1118674984 14:68174292-68174314 CCTGGAGCCCAGGAGTTCCAGGG + Intronic
1118723081 14:68608121-68608143 GCTGGTGCCCAGCTGCACCTGGG - Intronic
1118821330 14:69348024-69348046 CCAGAGGCCCAGCAGCCCGAGGG + Intronic
1119712354 14:76831333-76831355 CCTGGGCCCCAGGGGTACCAAGG + Exonic
1120521223 14:85530301-85530323 CCTGGTGCCCAGCAGCGGCGAGG + Exonic
1122070306 14:99201644-99201666 CCAGGGGCGGTGCAGCACCAGGG - Intronic
1122115852 14:99526880-99526902 CAGGGGCCCCAGCAGCTCCAGGG + Intronic
1122146430 14:99691626-99691648 CCTGGGGCCCAGGAGCCCTGGGG - Intronic
1122272894 14:100576269-100576291 CCTGAGGGCCAGCAGCACACAGG + Intronic
1122397353 14:101442634-101442656 CCTGTGGCCCAGGCGCACCAAGG + Intergenic
1122780628 14:104142000-104142022 CCTGGGCTCCAACAGCCCCAGGG - Intronic
1122789160 14:104177117-104177139 CCTGGCGCACAGCAGCAGCAAGG + Exonic
1122823040 14:104356598-104356620 GCTGGGGCCCAGCAGCTCCAGGG + Intergenic
1122899695 14:104777274-104777296 CCTGGGGCACAGCCACACCTGGG + Intronic
1122899705 14:104777308-104777330 CCTGGGGCACAGCCACACCTGGG + Intronic
1122899744 14:104777519-104777541 CCTGGGGCACAGCCACACCTGGG + Intronic
1122928776 14:104923791-104923813 CCTGGGGCCCAGCTGCATTCAGG + Intergenic
1122999234 14:105283344-105283366 CCTGGGTACCTGCAGCATCAGGG - Intronic
1123056470 14:105572876-105572898 CCTGGGGCCCAGCAGCCGTGGGG + Intergenic
1123057463 14:105578931-105578953 CCTGGGGCCCAGCAGCCGTGGGG - Intergenic
1123080903 14:105693004-105693026 CCTGGGGCCCAGCAGCCGTGGGG + Intergenic
1123081739 14:105698864-105698886 CCTGGGGCCCAGCAGCCGTGGGG - Intergenic
1202858114 14_GL000225v1_random:63999-64021 CCACGGGCCCAGCCCCACCACGG + Intergenic
1202859421 14_GL000225v1_random:72286-72308 CCCCGGCCCCAGCCGCACCACGG + Intergenic
1123493439 15:20800237-20800259 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1123549948 15:21369339-21369361 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1124319557 15:28702906-28702928 CCAGAGGCCCTGCAGCCCCAGGG - Intronic
1124409262 15:29422395-29422417 CCGGGGGCTCAGCAACACTATGG + Intronic
1124429249 15:29592167-29592189 CCTGGGTGCCAGCAGAACCAGGG - Intergenic
1124698381 15:31887712-31887734 CCTGGAGTCCAGCCGCTCCATGG + Intergenic
1125535481 15:40439578-40439600 CCTGGGGCCCAGCCCCTCCCTGG + Intergenic
1126110501 15:45172187-45172209 CATGGAGCCCAGCAGCCCCCTGG - Exonic
1126934716 15:53694123-53694145 CCTGGAGCCCAGCAGTACCTGGG + Intronic
1127351650 15:58158842-58158864 CCTGGGGCCAGGGACCACCAGGG - Intronic
1127730802 15:61800392-61800414 CCTGGAGCCCAGCAAGTCCAGGG + Intergenic
1127850403 15:62907175-62907197 CTTGGGGTCCAGCAGCACACGGG - Intergenic
1128111195 15:65077268-65077290 CCTGCGGCCCAGCAGCTACGCGG + Exonic
1129524384 15:76204583-76204605 CCTGTGGCCCAGCTTCAGCAGGG + Exonic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1130467620 15:84200306-84200328 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1130496645 15:84473236-84473258 GCTGGGGCACAAGAGCACCAGGG + Intergenic
1130551133 15:84890540-84890562 CCTGGGGCCCAGCACTACCCAGG + Intronic
1130564170 15:84980736-84980758 CCTGGGGCCCATGAGGACCCCGG - Intronic
1130589912 15:85204904-85204926 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1130975202 15:88768573-88768595 CCTCAGGCTCAGCAGCCCCAGGG - Intergenic
1131261307 15:90889455-90889477 CCCTGGGCCCAGCAGGAGCAAGG - Intronic
1131827981 15:96334925-96334947 CCTGGGGCCCAGCAGGCCCGGGG - Intronic
1132070877 15:98775659-98775681 CCAGGGACCCAGCACCAGCAGGG - Intronic
1132085005 15:98901265-98901287 ACTGGGGAGCAGCAGCAGCAGGG - Intronic
1132242167 15:100266345-100266367 CCAGGCGCCCAGCAGCACTCTGG - Intronic
1202958277 15_KI270727v1_random:96557-96579 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1132575115 16:660574-660596 GCTGGGCCCCAGCAGCATCCGGG + Intronic
1132668039 16:1090807-1090829 GCTGGGGCCCCACAGCAACAGGG + Intronic
1132673712 16:1113117-1113139 CCCGGCCACCAGCAGCACCATGG - Intergenic
1132678940 16:1131819-1131841 CGTGGGCCCCAGCAGGGCCAAGG - Intergenic
1132749757 16:1452099-1452121 CCTGGGCTCCAGCAGCACAGGGG + Intronic
1132973639 16:2701017-2701039 CCAGGGCCCCAGCCCCACCAAGG - Intronic
1133039034 16:3050151-3050173 CCTGGGGCCCACCCGCACCCTGG + Intronic
1133239779 16:4407613-4407635 CTCGGGGCCCAGCACCACCCCGG + Exonic
1133762007 16:8806610-8806632 GCTGTGAACCAGCAGCACCAGGG - Intronic
1133783620 16:8958338-8958360 GCTGGGAACCGGCAGCACCAAGG + Intronic
1134551770 16:15141961-15141983 CCTGAGGCGCAGCAGCCCTAAGG + Intergenic
1134635730 16:15790442-15790464 AGTGGAGCCCAGCAGCAACATGG - Intronic
1135128027 16:19827777-19827799 CCTGCGAGCCAGGAGCACCAAGG - Intronic
1136315944 16:29454860-29454882 CGTCGGGTCCAGCAGCACAATGG + Exonic
1136430521 16:30194202-30194224 CGTCGGGTCCAGCAGCACAATGG + Exonic
1136451997 16:30358771-30358793 CGTGTGGCGCAGCAGGACCAGGG + Exonic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1137676859 16:50308168-50308190 ACTGTGGCCCAGCTGCCCCATGG - Intronic
1137731680 16:50694440-50694462 CAGGGGCCCCAGCAGCCCCATGG - Intronic
1137872020 16:51959383-51959405 CCAGGTGCCCAGCAAAACCAAGG - Intergenic
1138191936 16:55020786-55020808 CCTGGGACCCAGCTGCAGCATGG - Intergenic
1138395076 16:56697791-56697813 CCAGTGGCCCAGCAGCTCCCTGG - Intronic
1139586390 16:67906792-67906814 CCAGGGCCCCACCAGCCCCAGGG + Intronic
1139613504 16:68075283-68075305 CCTGGGGTCCTGCAGTACCCTGG + Intronic
1139916221 16:70430088-70430110 CCGAGGGCCCAGGAGCATCAGGG - Intronic
1139949482 16:70662216-70662238 CCTGGGGGTCAGGAGCACCTTGG - Exonic
1141505027 16:84471349-84471371 CCTGGGGCTCAGCAGCACCAGGG + Intergenic
1141959203 16:87392862-87392884 TCTGGGGCCCAACAGCCCCCGGG + Intronic
1142086115 16:88183439-88183461 CCTACAGCTCAGCAGCACCAAGG + Intergenic
1142267737 16:89072261-89072283 CCAAGGGCCCAGCAGGACCTGGG + Intergenic
1142292158 16:89198165-89198187 CATGGTGCCCAGCAGCAGCACGG + Exonic
1142373945 16:89697317-89697339 CCTGGGGCCCAGCTGGCCTAGGG + Exonic
1142880367 17:2878770-2878792 CCTGCTGCCCAGGAGCCCCACGG + Intronic
1143644833 17:8223467-8223489 TCTGGGGCCCAGAAGACCCACGG + Intergenic
1144632483 17:16881292-16881314 GCTGAGGCCCAGCAGCACAAGGG - Intergenic
1144761427 17:17709660-17709682 CCCGAGGCCCAGCAGCTCCTTGG - Intronic
1144948591 17:18982252-18982274 CCTGGGGCTCAGCAGCAGGTGGG + Intronic
1145010464 17:19364941-19364963 CCAGCTGCCCGGCAGCACCATGG - Intronic
1145279261 17:21456107-21456129 ACTGAGGCCCAGCAGGACCTGGG + Intergenic
1145281642 17:21472269-21472291 CTTGGGGTCCAGAAGCAGCAAGG - Intergenic
1145395794 17:22493354-22493376 CTTGGGGTCCAGAAGCAGCAAGG + Intergenic
1145398595 17:22514338-22514360 ACTGTGGCCCAGCAGGACCTGGG - Intergenic
1146398750 17:32487602-32487624 CCCGGCGCGCAGCAGCACCATGG + Exonic
1146521567 17:33529351-33529373 CCTGGGGCTGAGAACCACCAAGG + Intronic
1146619515 17:34386597-34386619 CCTGGAGCCCAGCAGTGCTAGGG - Intergenic
1146721806 17:35129303-35129325 CCTGGGCCCCAGCAGGAGCAGGG + Intronic
1146805154 17:35858944-35858966 CCTGAGGCCTTGCAGCAACATGG - Exonic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147375974 17:40022716-40022738 GATGTGGCCCAGCAGGACCAGGG + Exonic
1147420121 17:40318362-40318384 CCTGATGCCGAGCAGCACCAGGG + Intronic
1147425700 17:40345027-40345049 CCTAGGGCCCTGCAGAACCCAGG - Intronic
1147944999 17:44075871-44075893 CAGGGGGCCCAGCAGCCCCATGG - Exonic
1148105822 17:45118301-45118323 CGGGGGGCCCAGCAGCACCGAGG - Exonic
1148436225 17:47687986-47688008 CCTGTGGCCAAGGAGCACCTGGG - Intergenic
1148794806 17:50191823-50191845 CTCGGGGACCAGCAGGACCAGGG + Exonic
1148885037 17:50766239-50766261 GCTGGGGCCCAGCTGCTACAGGG - Intergenic
1149607624 17:57936053-57936075 CCTGGAGCCAAGCAGCATCAGGG + Intronic
1149863946 17:60139967-60139989 CGTGGGGCACTTCAGCACCACGG - Intergenic
1150952670 17:69821196-69821218 CCTGGGGCCCAGAAGCAGGCAGG + Intergenic
1151028945 17:70712786-70712808 CATCGGGCCCAGTAGCAACATGG + Intergenic
1151344625 17:73494082-73494104 CCAGGGGCCCAGCCTGACCAGGG + Intronic
1151365166 17:73612265-73612287 CCTGTGACCCAGCTGCACCTGGG + Intronic
1151365204 17:73612392-73612414 CCTGTGGCCCAGCTGCACCTAGG + Intronic
1151444443 17:74153962-74153984 GCTGAGGCCCAGCATCACCCGGG + Intergenic
1152106118 17:78330008-78330030 CCTGGGGCCCAGCCGCTTCCAGG + Intergenic
1152194554 17:78909564-78909586 CTGGGGGTCCAGCTGCACCATGG - Intronic
1152240265 17:79157253-79157275 CCTGGCGTCCATCAGCACCCAGG + Intronic
1152466737 17:80470911-80470933 CCTGGCCACCTGCAGCACCAAGG - Exonic
1152800670 17:82329347-82329369 CCTGAGCCTCAGCAGCACCTCGG - Intronic
1152820157 17:82433740-82433762 CATGGCGCCCACCAGCGCCAGGG - Exonic
1152868296 17:82736995-82737017 CCTGGGGCTTAGCAGCCCCAAGG + Intronic
1152880763 17:82813478-82813500 TCAGAGGCCCAGCACCACCACGG - Intronic
1154305955 18:13231073-13231095 CCTGCAGCCCCGCAGCACCCTGG - Intronic
1155751793 18:29433275-29433297 CCTGGGGAGCAGCAAAACCAAGG + Intergenic
1157290296 18:46405311-46405333 CCTGGCTCCCAGCAGCAGCAGGG - Intronic
1160012321 18:75115552-75115574 GCTGGGTCCCAGCAGCAACAGGG - Intergenic
1160394378 18:78561074-78561096 CCTGACACCCAGCAGGACCATGG + Intergenic
1160584344 18:79904275-79904297 CCTGGGGCTCAGGGGCACCCAGG + Intronic
1160671605 19:367281-367303 CCTGGGGTCCTTCAGCTCCAGGG - Intronic
1160740507 19:683349-683371 CCTGGGGCCCTGCCTCACCAAGG + Exonic
1160856436 19:1220046-1220068 CCTGTGGTCCTGCAGCAGCAAGG - Intronic
1160871892 19:1281521-1281543 CCTGGGGCACCCCGGCACCAGGG - Intergenic
1160963930 19:1737351-1737373 CCTGGGGCACAGCAGGTGCATGG - Intergenic
1161288567 19:3480739-3480761 CCTGGGGACCATCAGCCTCAGGG + Intergenic
1161394283 19:4037175-4037197 CCTGGGGCTCAGCACCTGCAGGG + Intronic
1161453738 19:4360246-4360268 CCTTGGGCTCAGGAGCACCTGGG + Intergenic
1161590494 19:5127163-5127185 CCTGGGCCCCATCTGTACCATGG + Intronic
1161592466 19:5135043-5135065 CCAGGGGCCACCCAGCACCAGGG + Intronic
1162150721 19:8643646-8643668 CCTGAGAGCCAGGAGCACCAGGG - Intergenic
1162523465 19:11194866-11194888 CTTGGGGCCCCCCAGCCCCAGGG - Intronic
1162867757 19:13561746-13561768 CCTGAGAACCAGGAGCACCAAGG - Intronic
1163433996 19:17284245-17284267 CCTGGGGTCCAGCAGCAGATAGG - Exonic
1163468517 19:17483677-17483699 CCTGGGGCCCATGAGCCTCATGG + Intronic
1163520356 19:17788137-17788159 CCTGGGGCCCAGTGGCAACAGGG + Intronic
1163648186 19:18502124-18502146 CCTGGTGCCCCACAGCTCCACGG + Intronic
1163708500 19:18831862-18831884 CCTGGTGCCCAGCAGGAAGACGG - Intergenic
1163755392 19:19103662-19103684 CCTAGGGCCCAGAAGCAAGATGG + Intronic
1164151602 19:22557990-22558012 TCAGGGGCACAGCAGCACCCAGG - Intergenic
1164388311 19:27795119-27795141 GCTAAGGCCCAGCAGCACGAAGG - Intergenic
1164829386 19:31309022-31309044 CCTGGGGGCCAACAGCACGGTGG - Intronic
1164840689 19:31390183-31390205 CCTGAGGCCCAGCAGGGCCTGGG + Intergenic
1165072851 19:33265512-33265534 CCTGGAGGCCAGCAGCACAGAGG + Intergenic
1165388274 19:35524433-35524455 CCTGGCTCCCAGGGGCACCAGGG + Intronic
1167658228 19:50780269-50780291 GCTGGGGCACAGCAGCTCCTGGG + Intergenic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
1168146497 19:54422313-54422335 GCTGCGGCCCAGCAGCTGCAGGG + Exonic
1168707913 19:58480205-58480227 CCAGAGGCCCAGCCGCCCCAGGG + Exonic
925003189 2:422511-422533 CCTGGGCTCCAGTAGCTCCATGG + Intergenic
925262620 2:2541672-2541694 ACTGTGGCCCAGCAGCACAGCGG - Intergenic
925388396 2:3479289-3479311 CCTGGGGTCCTGCTGGACCATGG - Exonic
925587154 2:5475425-5475447 TATGGGACACAGCAGCACCAGGG + Intergenic
925731782 2:6924291-6924313 CCTCGGGCCCCCCAGCAACACGG - Intronic
925901586 2:8512992-8513014 TCAGGGGCACAGCAGCAGCAGGG - Intergenic
926105215 2:10145668-10145690 CCTGGGGCCCAGGACCACTGAGG - Intronic
926157455 2:10464877-10464899 CCTGGGTCCCAGCGGCATCCTGG + Intergenic
926782282 2:16484419-16484441 CATGGAGGCCAGCAGCACCCAGG + Intergenic
928432797 2:31234485-31234507 CGCGGGGCTCAGCCGCACCATGG - Exonic
929501137 2:42492929-42492951 GCTGGCGCACAGCACCACCATGG + Exonic
930326214 2:49922174-49922196 CCGGGAGTCCAGCAGCACCACGG - Exonic
930651787 2:53970934-53970956 CGTGGGGCCCAGCAGCACGCCGG - Intronic
932596250 2:73095457-73095479 CCTCTGGGCCAGCAGCAGCATGG - Intronic
933836675 2:86251464-86251486 CATGTGGCCCAGCAGATCCAGGG - Intronic
934882813 2:97998013-97998035 CCTGAGGCTCAGCAGCTCCATGG + Intergenic
934979231 2:98826539-98826561 GCTGGGACACAGCAGCACCAAGG + Intronic
935545141 2:104393224-104393246 CCTGGAGCCCAGCAGATCCCTGG + Intergenic
938293414 2:130162243-130162265 CCTGCTGCCCTGCAGCACCACGG + Intronic
938307183 2:130264217-130264239 CCTGGTGCTCAGCAGCCCCCGGG + Intergenic
938463140 2:131510718-131510740 GCTGCTGCCCTGCAGCACCACGG - Intergenic
938838361 2:135131654-135131676 CCTGGGGGCCATCCACACCATGG + Intronic
941328177 2:164143536-164143558 CCTGGGGATGAGAAGCACCACGG + Intergenic
941923446 2:170873677-170873699 CCAGGGTTCCAGCAACACCAAGG + Intergenic
944667400 2:201968994-201969016 CCTGGGATCCAACAGCAACATGG + Intergenic
945766882 2:213991558-213991580 GCGGGGGTCCAGGAGCACCAGGG - Intronic
948454444 2:238098268-238098290 CGTGGGCCGCAGCACCACCAGGG + Exonic
948676623 2:239600791-239600813 CCTGGGGCCCAGCTGCACTCAGG + Intergenic
948861726 2:240755830-240755852 CCTGGGGCCCAGGAGGTGCAGGG + Intronic
948918706 2:241051603-241051625 CCTGGGGCCTGGCTGCAGCAGGG - Intronic
949032490 2:241803667-241803689 CCGGCGCCGCAGCAGCACCAGGG - Exonic
1168940780 20:1709352-1709374 GCTGGGTCCCAGGAGGACCAGGG - Intergenic
1168991376 20:2098727-2098749 CCTGTGGCCCAGCAATTCCATGG - Intergenic
1169025957 20:2371782-2371804 TCTGGAACCCAGCAGGACCAGGG - Intergenic
1169221657 20:3826647-3826669 ACTGGAGCTCAGCAGCCCCACGG - Exonic
1170823486 20:19773666-19773688 CCTGGCACTCAGCAGTACCATGG - Intergenic
1171395283 20:24829183-24829205 TCTGGGGCCCTGCATCACCTGGG - Intergenic
1172290097 20:33769939-33769961 CCTGGGATCCAGTAGCAGCAGGG + Intronic
1172780014 20:37431025-37431047 CCTTGGGGCCGTCAGCACCAAGG - Intergenic
1172836979 20:37879295-37879317 CCTGGGGCCCAGGAGAGCCTGGG + Intergenic
1173782932 20:45771613-45771635 CCTTGGCCCCAGCAATACCATGG - Intronic
1174168748 20:48603518-48603540 CCTGGGGCCCAACAGCTGCTGGG + Intergenic
1174282168 20:49447199-49447221 CCTGGGGCCCAGGGACACAAAGG + Intronic
1174796545 20:53527344-53527366 CCTGGCTTCCTGCAGCACCAAGG + Intergenic
1175206387 20:57314987-57315009 CCTGAAGCCTAGCAGCACCTTGG + Intergenic
1175265660 20:57701985-57702007 TTTGGGGCCCAGGAGCACCCTGG - Intronic
1175271848 20:57739597-57739619 CCCGTGGACCAGCAGCACCAGGG - Intergenic
1175913593 20:62415736-62415758 GCTGGGCCCCCGCAGGACCAGGG - Intronic
1175950011 20:62578392-62578414 TCTGGTGCCCATTAGCACCAAGG + Intergenic
1176148199 20:63574633-63574655 TTGGGGTCCCAGCAGCACCAGGG - Intergenic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1177187990 21:17819190-17819212 CCTGGCGCGCAGCAGCGCGAGGG + Intronic
1178095675 21:29212500-29212522 TCTGGGCCCCAGCAACAGCACGG - Intronic
1179175746 21:39006725-39006747 CCTGGGGGCCAGCAGGACAGAGG - Intergenic
1179716423 21:43291050-43291072 CCGTGGCCCCAGCAGCACCTTGG - Intergenic
1180007138 21:45028022-45028044 CCTGGGCCCCAGAAGCCCCTGGG + Intergenic
1180147373 21:45928909-45928931 CCTGGGGCTCAGGAGGACCCTGG - Intronic
1180481600 22:15760575-15760597 ACTGGGGCACAGCAGGACCGGGG - Intergenic
1180699356 22:17773323-17773345 CCTGGGGCCCTGCAGTCCCCTGG - Intronic
1180957051 22:19745872-19745894 CCTGGGGCTCAGCATCCCCTCGG - Intergenic
1181433633 22:22897639-22897661 CCTTGTGCCCAGCAGGACTATGG - Intergenic
1181608743 22:23998772-23998794 CCTGGGGACCAGCCCCACCTGGG + Intergenic
1181862422 22:25829174-25829196 CCCGCAGCCCAGAAGCACCAAGG + Intronic
1182353774 22:29713073-29713095 CCTGGGGGCCACCAGTGCCAGGG + Intergenic
1182427513 22:30282780-30282802 CCTGGTGCCCAGCATCTGCAGGG - Intergenic
1182481210 22:30609977-30609999 GCTGGAGCCCAGCAGCAACTGGG + Intronic
1182843904 22:33415138-33415160 CCTGCAGCCCAGCTGCACAAAGG + Intronic
1183276427 22:36900952-36900974 TCTGGGGGTCAGGAGCACCAGGG - Intergenic
1183402012 22:37610054-37610076 CCTGGGTCTCAGCAGCAACTGGG + Intronic
1183530584 22:38351318-38351340 CCTGGGGCCCAGCCTCAGGAAGG - Intronic
1183667777 22:39255185-39255207 CATGGGGCCCAGCAGCCCGGGGG - Intergenic
1183829767 22:40411557-40411579 TCCTGAGCCCAGCAGCACCATGG - Exonic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1184047713 22:41981865-41981887 CCTGGTGGCGGGCAGCACCAAGG + Intronic
1184138886 22:42566129-42566151 CCTGGGGTCCAGCTGGAGCAGGG - Intronic
1184259889 22:43308711-43308733 CCTGGAGCCCAGCTGCACCCTGG - Intronic
1184466496 22:44671485-44671507 TCTGGGTAGCAGCAGCACCAGGG - Intronic
1184595700 22:45512662-45512684 CCTGGGGTCCAGCCCCACCCTGG - Intronic
1185179667 22:49351924-49351946 TCTGGGGCCCAGCGGCAACCTGG - Intergenic
1185345383 22:50308386-50308408 CCTGGCCTCCAGCAGCACCTTGG + Intergenic
949890842 3:8732906-8732928 CCTGGGCTCCAGCAGCATGAAGG - Intronic
950004237 3:9681300-9681322 CCTGAGGGACAGCAGCCCCAGGG - Intronic
950432549 3:12959222-12959244 CCAGGGGCCCAGCAAGACGAGGG + Intronic
950585175 3:13887150-13887172 CCTGGGGGCCAACAGCTCCAAGG - Intergenic
951868426 3:27333593-27333615 CCTGCAACCCAGTAGCACCAGGG + Intronic
952449286 3:33416063-33416085 CTGAGGGCCCAGCAGCACCTGGG + Intronic
953508210 3:43507481-43507503 TCCAGGGACCAGCAGCACCAGGG - Intronic
953660423 3:44887716-44887738 CCTCGGGTCGAGCACCACCAGGG - Exonic
953927427 3:46989550-46989572 CCTGGGGCAAAGCAGCAGGAGGG - Exonic
954030873 3:47819033-47819055 CCTGGGACGCAGCAGCAGCATGG - Intronic
955479459 3:59374700-59374722 TCTGTTGCCCAGCATCACCAAGG + Intergenic
958678314 3:97293977-97293999 GCTGGGGCACAACAGCACCCAGG + Intronic
959603924 3:108222031-108222053 ACTGGTTCCCAGCAGGACCAAGG + Intronic
961398572 3:126616585-126616607 TCTGGGGCCCAGCAGCACAGTGG - Intronic
961650365 3:128413971-128413993 CCTTGGGCCCAGCGGCCCCTCGG - Intergenic
961746424 3:129066274-129066296 GCTGGGACTCAGCAGCACCTGGG + Intergenic
962335523 3:134527142-134527164 CCTGGCACCCACCAGCACCCTGG - Intronic
962385766 3:134930955-134930977 CCTGGTGCCCAGCACCAGCCTGG + Intronic
963112845 3:141701079-141701101 TCTGGGGCCCTGCAGGCCCATGG - Intergenic
963351140 3:144152509-144152531 CCTGTGGCTCAGCAGCATCAGGG - Intergenic
963761572 3:149290961-149290983 CCTGGTGACCAGCATCCCCAGGG - Intergenic
965793255 3:172411580-172411602 CCTGGCTCCCACCAGCTCCATGG + Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
967105476 3:186251846-186251868 CCAGCGGTCCAGCATCACCAAGG + Exonic
968005830 3:195242167-195242189 CCCGTGGCCCCGCAGCACCTGGG + Intronic
968515324 4:1013222-1013244 CCTGGGACCCAGCCCCAGCAAGG + Intronic
968613181 4:1566280-1566302 CACGGTGCCCAGGAGCACCAGGG + Intergenic
969194044 4:5546852-5546874 CCTGGCTCCCACCAGCTCCATGG - Intronic
969431939 4:7160500-7160522 CCTGAGACGCAGCAGCCCCAAGG - Intergenic
970446409 4:16126528-16126550 CCTGGGTCCCGGCATCCCCAGGG + Intergenic
971083541 4:23243913-23243935 TCTGGGGCCAAGAAGCCCCAAGG + Intergenic
971834710 4:31748347-31748369 CCTGGGTTGCAACAGCACCAGGG + Intergenic
972722233 4:41711570-41711592 GCTGAGGCCCACCAGCCCCATGG - Intergenic
973757255 4:54087562-54087584 CCTGGGACACAGGAGCATCAGGG - Intronic
973768479 4:54185631-54185653 CCTTGAGCCCAGCAGCATAAGGG + Intronic
974227036 4:59060169-59060191 CCTGGGGCCAAGCAAGACCCCGG - Intergenic
974697875 4:65398238-65398260 CCTGGGTCACAACAGCACCCAGG - Intronic
975254448 4:72216715-72216737 CCTGGCTCCCACCAGCTCCATGG + Intergenic
976700814 4:87966783-87966805 CCCTGGGCTCAGCAACACCAGGG + Intergenic
980027077 4:127780726-127780748 ACAGGCGCCCAGCAGGACCAGGG + Intergenic
985209483 4:187576975-187576997 CCTGGGGCCCAGTGGAAACAGGG - Intergenic
985564628 5:609093-609115 GCTGGGCCCCATCAGCCCCATGG - Intergenic
985608129 5:870043-870065 CCTGGGGCCCATCCGTACCCTGG - Intronic
985727161 5:1522559-1522581 CCTGAGGACCAGCCGCATCAAGG + Intronic
985774066 5:1831596-1831618 CCCCTGCCCCAGCAGCACCAGGG - Intergenic
985778999 5:1860083-1860105 CCTGGGGCACCGCAGCAAAATGG - Intergenic
985966229 5:3340604-3340626 GCTGGGGCCCAGCACCTCCGAGG - Intergenic
986357289 5:6941219-6941241 CCTGGGATCCAGCAGATCCAGGG - Intergenic
986466923 5:8034994-8035016 CCTGAGCAGCAGCAGCACCAGGG + Intergenic
986715395 5:10520097-10520119 CCTCCTGCCCAGCAGCCCCATGG + Intronic
987667735 5:20966412-20966434 ACAGGTGCCCAGCTGCACCATGG + Intergenic
989610076 5:43282406-43282428 ACTGGGGCCCAGTAGCACATCGG + Intergenic
991247461 5:64523172-64523194 CCTGGGGCCCTGCTGGACCTGGG - Intronic
991437370 5:66610510-66610532 CCTGGCCCCGAGCATCACCAGGG + Intronic
991659409 5:68935062-68935084 CCTGGGTCCCGGCAGCACTGAGG + Intergenic
992092205 5:73327165-73327187 CCTGGTGCCCAGCACATCCAAGG + Intergenic
992213284 5:74501981-74502003 CCTGGGGCCCATCCTGACCAAGG + Intergenic
992748784 5:79843230-79843252 CTGGGGACCCAGCAGCAGCAAGG + Intergenic
992763288 5:79970803-79970825 CCTAGGTGCCAGCAGCACGATGG - Intergenic
993898868 5:93571086-93571108 CCTGGGGCCCTGCAGCACCGAGG + Intergenic
994851085 5:105056715-105056737 CCTGGCTCCCATCAGCTCCATGG - Intergenic
995242941 5:109905414-109905436 GCAGTGGCACAGCAGCACCAGGG + Intergenic
995830889 5:116354415-116354437 CCTGAGAACCAGGAGCACCAAGG - Intronic
997654967 5:135547801-135547823 CCTGACGCCCACCAGCAGCAGGG - Intergenic
997781841 5:136667315-136667337 CCTGGGGCCCAGTGGCATCGGGG + Intergenic
997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG + Intergenic
998381585 5:141729759-141729781 CCTGGGGCCCAGCAGCCTGGAGG + Intergenic
1001286510 5:170427664-170427686 CCTGGGGCCCAGCAGCAGGCCGG - Intronic
1002046157 5:176542946-176542968 CCTGGGTCCCAGCCGCAGCTGGG + Intronic
1002174544 5:177394094-177394116 GCAGGTGCACAGCAGCACCAGGG - Exonic
1002292402 5:178208983-178209005 CCTCTAGCCCAGCAGGACCAAGG + Intronic
1003130986 6:3395023-3395045 CCTGGAGCCCAGCCCCACCTTGG - Intronic
1003187079 6:3841288-3841310 CCAGGGACCCACCAGCCCCAGGG - Intergenic
1004027949 6:11837210-11837232 CCTGGGTGCCTGCACCACCAGGG + Intergenic
1004186447 6:13425445-13425467 CCTGGGGAACATCAGCCCCAGGG - Intronic
1004493473 6:16140699-16140721 CCTGGGGCATAGCAGCTGCAGGG + Intronic
1004721608 6:18272606-18272628 CCTGAGAACCAGGAGCACCAAGG - Intergenic
1004806027 6:19204954-19204976 CCAGTGGCCCAGAAGCACCTTGG - Intergenic
1005136059 6:22570463-22570485 CCTGGGGCCCGGCAGGGCAAAGG - Exonic
1006296746 6:33173217-33173239 CCTGGGTCTGAGCAGCACCAGGG + Intronic
1006993296 6:38234345-38234367 CCTGGGCCCAAGCAGCTGCAGGG - Intronic
1007054271 6:38866593-38866615 CCTGGCGCCCAGCATATCCAGGG - Exonic
1007341674 6:41194591-41194613 CCAGGGACCCAGGAGGACCATGG - Exonic
1007370950 6:41426917-41426939 TCTGGGGGCCAGCAGCCCCTTGG + Intergenic
1007752880 6:44080924-44080946 CCTGGGGTTCAGCAACCCCAGGG - Intergenic
1011160393 6:84382972-84382994 CCTGGAGTCCAGCAGCACAAAGG - Intergenic
1013345310 6:109254385-109254407 CTTGGGGCCCAGCAGAGCGACGG - Intergenic
1013374747 6:109503738-109503760 CCAGGTGCCCAGCAGCTGCAGGG - Intronic
1013479502 6:110541862-110541884 CCTGGGGCCTGGCAGTGCCAGGG + Intergenic
1016024445 6:139271908-139271930 CCTGAGGTCCAGAAGAACCAGGG - Intronic
1016199832 6:141394396-141394418 CCTGGGGCTCAGAGGCACCCCGG - Intergenic
1017787473 6:157768374-157768396 CCTGGGGCTCAGCAGCACCCTGG + Intronic
1019139819 6:169936173-169936195 CCTTGGCCTCAGCAGCACCCTGG - Intergenic
1019190751 6:170249322-170249344 CCTGGCCACCAGCAGCCCCAAGG + Intergenic
1019409658 7:900943-900965 CCCAGGCCCCAGCAGCACCAGGG - Intronic
1019411162 7:907373-907395 CCCAGAGCCCAGGAGCACCAGGG + Intronic
1019628673 7:2034979-2035001 CCTGAGGCCCAGCAGCACAGGGG + Intronic
1020013904 7:4820304-4820326 CCGGGAGCCCAGGAGCCCCAGGG + Intronic
1020096095 7:5370495-5370517 CCTGGGCTCCAGCAGCACCCGGG + Exonic
1022495451 7:30850301-30850323 CCTGCAGCCCAGGAGCCCCAAGG - Intronic
1022944493 7:35268452-35268474 CCTGAATCCCATCAGCACCAAGG - Intergenic
1023223257 7:37943063-37943085 GCTGAGGCTCAGCAGCAGCAGGG + Intronic
1023831491 7:44041035-44041057 CCTGGGCCCCATCATCAACAAGG - Intergenic
1024083087 7:45872445-45872467 CAAGGGGACCAGCAGCCCCAGGG - Intergenic
1025026768 7:55522709-55522731 CCTGGGGCCTGGCTGCTCCAGGG + Intronic
1025144632 7:56493080-56493102 CCTGGGGCCCAGCCGTACAAAGG - Intergenic
1029363457 7:100102663-100102685 CCTGTGTCTCAGCATCACCATGG + Exonic
1029487948 7:100854541-100854563 CCTGGAGCTCTGCAGAACCAGGG + Intronic
1029741813 7:102495339-102495361 CCTGGGCCCCATCATCAACAAGG - Exonic
1029759804 7:102594508-102594530 CCTGGGCCCCATCATCAACAAGG - Exonic
1029777166 7:102690418-102690440 CCTGGGCCCCATCATCAACAAGG - Intergenic
1030087965 7:105833173-105833195 CCTGGGGACCAGCAGATCCAAGG - Intronic
1032000062 7:128259484-128259506 CCTGAGGCCCAGCAGGACTGGGG - Intergenic
1033149280 7:138899261-138899283 TCAGGGGCCCAGAATCACCATGG + Intronic
1033305697 7:140223821-140223843 CCTGGAGCCTGGCAGCCCCATGG - Intergenic
1034154783 7:148947847-148947869 CCTTGGGCATAGCAGCAGCAGGG - Intergenic
1035029813 7:155849778-155849800 CCTGGGGCCAAGCTGCCACAGGG - Intergenic
1035171109 7:157017976-157017998 CCGGGGGCCCAGATGCACCCAGG - Intergenic
1036691873 8:10949354-10949376 TCTGGGGTGCAGCAGCACCGTGG + Intronic
1037373694 8:18206208-18206230 CCTGTGCCCCAGCAGCTCCAGGG - Intronic
1037645545 8:20789630-20789652 CCGGGTGGCCAGCTGCACCAGGG + Intergenic
1037748835 8:21666937-21666959 ACTGGGGCCCAGAGGCTCCAGGG - Intergenic
1037947794 8:22999960-22999982 GCTGGAGCCCAGCAGCAGCGCGG + Intronic
1039672012 8:39612350-39612372 CCTGGCTCCCAGCAGCTCCTAGG + Intronic
1040781647 8:51116627-51116649 CCTGGTTCCCAGCTGCAACATGG - Intergenic
1044630961 8:94278318-94278340 CCTGTGACCCTGAAGCACCAGGG + Intergenic
1046918295 8:119700308-119700330 CCTGGGTCCCAGGAACTCCAAGG + Intergenic
1047428448 8:124767845-124767867 CCTGGGGGCTAGCAACAGCAGGG + Intergenic
1049291678 8:141806619-141806641 CCTGGGGCCACGCAACCCCATGG + Intergenic
1049441383 8:142611388-142611410 CTAGTGGCCCACCAGCACCAGGG + Exonic
1049516488 8:143060679-143060701 CCTGGGGACCACTACCACCAAGG - Intergenic
1051108118 9:13603833-13603855 TCTTAGGCCCCGCAGCACCAAGG - Intergenic
1051440283 9:17075711-17075733 CCTGAGAGCCAGGAGCACCAAGG + Intergenic
1053055246 9:34989938-34989960 CCCGGGGCCCCGCATCCCCAAGG - Intronic
1056103755 9:83326560-83326582 CCTGAGGCCCAGACTCACCAAGG + Intronic
1057179825 9:93023666-93023688 CCTGGGGCCTAGCAGGGCAAGGG - Intronic
1057196135 9:93116385-93116407 CCTGGGTCTCAGCAGCCACAGGG + Intergenic
1057198453 9:93127851-93127873 CCTGTGGCCCTGCGGCACCCCGG - Intronic
1057533401 9:95875320-95875342 CCTGGGGTGCTGCACCACCACGG + Intergenic
1057539654 9:95954819-95954841 CCTGTGACACAGCACCACCAGGG - Intronic
1058572255 9:106359135-106359157 CCTGGCCCTCAGCAGCACCTGGG - Intergenic
1060224620 9:121783370-121783392 CCTGGGGCCCAGCACACCCAGGG + Intronic
1060547034 9:124467911-124467933 CCTTGGTCCCAGCAGAACCTTGG + Intronic
1060839740 9:126784062-126784084 CCTGGCTCCCAGTAGCAACATGG + Intergenic
1060952286 9:127612087-127612109 CCTGGCGCCCAGCCGCATCTCGG + Intergenic
1061092361 9:128433849-128433871 CCTGGGGCACAGTAGCACTCAGG + Intronic
1061397815 9:130353054-130353076 CCTGCTCCCCACCAGCACCAAGG + Intronic
1061725951 9:132582183-132582205 CCGGGGGCCCGTCAGCACCGTGG - Exonic
1061899183 9:133664305-133664327 CCTGGGAAACAGCAGCAACACGG + Intronic
1061916895 9:133760066-133760088 CCAGGGGGCCAGGAGCAGCAGGG + Intergenic
1061997352 9:134193301-134193323 CTTGGGGGCCATCAGCACAAAGG + Intergenic
1062013561 9:134280121-134280143 CTTGGGCCCCAGCAGCCCCCGGG + Intergenic
1062251135 9:135594711-135594733 CATGGTGGCCAGCAACACCACGG - Intergenic
1062289135 9:135786756-135786778 CCTGTGGCCTCCCAGCACCAGGG - Intronic
1062358790 9:136177792-136177814 CCTGGGCCCCAGCACCTCCTTGG - Intergenic
1062413906 9:136438621-136438643 CCTGGCGCCCATCCGCAGCAAGG - Exonic
1062464015 9:136673335-136673357 CCTGGAGCCCAGCTGCACCCTGG + Exonic
1187166492 X:16809189-16809211 ACTGGGAACCAGCAGCACAAGGG - Intronic
1189555612 X:42142226-42142248 CTTGAGGACCAGCAGCTCCATGG - Intergenic
1189858979 X:45252727-45252749 CCTGGGGCCCAGCAGCACTGAGG - Intergenic
1189946013 X:46179900-46179922 CCTGGAGCCCAGTAGTGCCACGG - Intergenic
1192266852 X:69544421-69544443 CCTGGGTCCCTGCAGTGCCAGGG - Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1193512954 X:82428755-82428777 CTTGGAGACCATCAGCACCATGG - Intergenic
1194434166 X:93849307-93849329 CCTGGGGCCCAGCAGTGATAGGG - Intergenic
1194553526 X:95330542-95330564 CCTTAGGTCCAACAGCACCAGGG - Intergenic
1196140169 X:112252855-112252877 CCTGGGATCCAGGATCACCAAGG - Intergenic
1196389969 X:115196558-115196580 CCAGGGGCACATGAGCACCAAGG + Intronic
1197501273 X:127244595-127244617 CCTGGCTCCCAGCAGCTCCATGG + Intergenic
1197678664 X:129358714-129358736 CCTGAGAACCAGGAGCACCAAGG + Intergenic
1198189362 X:134287556-134287578 CCTGGCTGCCAGCAGCTCCATGG - Intergenic
1198223576 X:134625186-134625208 CCTGGAGCCCAGCTGCAACCTGG - Intronic
1198583658 X:138095983-138096005 CCTGGAGCTCAGCAGCACTAGGG + Intergenic
1199847332 X:151700801-151700823 ACTGGGCCCCAGCACCACCTGGG - Exonic
1200057914 X:153471040-153471062 CCTGGTTCCCAGGAGGACCAAGG + Intronic
1200162898 X:154018450-154018472 CCCGAGGCCCAGAACCACCAAGG + Intronic