ID: 1192398538

View in Genome Browser
Species Human (GRCh38)
Location X:70810519-70810541
Sequence CATTCTCAGCAACCTGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9535
Summary {0: 1, 1: 82, 2: 3193, 3: 3265, 4: 2994}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192398538 Original CRISPR CATTCTCAGCAACCTGACAC AGG Intronic
Too many off-targets to display for this crispr