ID: 1192399629

View in Genome Browser
Species Human (GRCh38)
Location X:70821840-70821862
Sequence CATTATGCAAAATAGTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1158
Summary {0: 1, 1: 0, 2: 17, 3: 168, 4: 972}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192399626_1192399629 13 Left 1192399626 X:70821804-70821826 CCCTTGTACACTGTTGGCAATGT 0: 1
1: 3
2: 21
3: 47
4: 238
Right 1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG 0: 1
1: 0
2: 17
3: 168
4: 972
1192399627_1192399629 12 Left 1192399627 X:70821805-70821827 CCTTGTACACTGTTGGCAATGTA 0: 1
1: 5
2: 24
3: 41
4: 172
Right 1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG 0: 1
1: 0
2: 17
3: 168
4: 972

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192399629 Original CRISPR CATTATGCAAAATAGTAGGA AGG Intronic
900904383 1:5542378-5542400 CATTATGGAAAACAGTATGGAGG + Intergenic
901312692 1:8281790-8281812 CATTATGGAAAATAGTGTGGAGG - Intergenic
904224343 1:29002757-29002779 CATTCTACAAAATAGAATGAGGG + Intronic
904989159 1:34577605-34577627 CATTATGGAAAACAGTATGGAGG - Intergenic
905333882 1:37230116-37230138 CATTATGGAAAACAGTATGGAGG - Intergenic
906053501 1:42894842-42894864 CACTATGGAAAACAGTACGAAGG - Intergenic
906956584 1:50380607-50380629 CATTATGGAAAATAGTATGGAGG - Intergenic
907000092 1:50843949-50843971 CATTATGGAAAACAGTATGGAGG - Intronic
907338942 1:53719769-53719791 CATTATGGAAAACAGTATAAAGG + Intronic
907421578 1:54351274-54351296 CATTTTGAAAAGTAGGAGGAAGG - Intronic
907452467 1:54554847-54554869 CATTATGGAAAACAGTATGGAGG - Intronic
907763380 1:57384329-57384351 CACTATGGAAAACAGTATGACGG + Intronic
907775876 1:57514255-57514277 CATTATGGAAAAAAGTATGAAGG - Intronic
907795977 1:57717490-57717512 CATTATGGAAAATAGTATAGAGG + Intronic
908457392 1:64317371-64317393 CATTATGGAAAACAGTAGAGAGG - Intergenic
908505907 1:64799823-64799845 CATTATGGAAAACAGTACGATGG - Intronic
908579135 1:65495470-65495492 CATTATAGAAAACAGTAGGGAGG + Intronic
908593700 1:65661391-65661413 CATTATGGAAAGTAGTAGGGAGG - Intergenic
908699617 1:66884387-66884409 CATTATGGAAAACTGTAGGTAGG - Intronic
908838888 1:68258102-68258124 CATTATGGAAAATGGTATGAAGG - Intergenic
909716186 1:78709915-78709937 CATTACAGAAAATAGTATGAAGG + Intergenic
909761936 1:79299858-79299880 CATTATGAAAAATAGTATGGAGG - Intergenic
909860779 1:80602644-80602666 CATTATGGAAAACAGTATGGAGG + Intergenic
910151597 1:84153939-84153961 CATTATGGAAAATGATATGAAGG - Intronic
910373833 1:86548018-86548040 CATTATGGAAAACAGTATGGAGG - Intronic
910475780 1:87605044-87605066 CATTATGAAAAACAGTATGGAGG - Intergenic
910573530 1:88733262-88733284 CATTATGGAAAACAGCATGAAGG - Intronic
910778468 1:90900158-90900180 TATTATACGAAATATTAGGAGGG + Intergenic
910896840 1:92078751-92078773 CATTATGGAAAACAGTATGGAGG - Intergenic
911137503 1:94456817-94456839 CATTATGGAAAACAGTATGGAGG - Intronic
911771651 1:101750743-101750765 CATTATGGAAAACAGTATGGAGG - Intergenic
911993060 1:104726815-104726837 CATTATGGAAAATAGTATGGAGG + Intergenic
912060159 1:105658511-105658533 CATTATGGTACAAAGTAGGATGG - Intergenic
912072341 1:105827034-105827056 CATTATGGAAAACAGTATGGAGG + Intergenic
912577704 1:110689365-110689387 CATTATGCTAAATATTTGGTAGG - Intergenic
913459734 1:119071263-119071285 CATTATGGAAAACAGTATGGTGG + Intronic
914930827 1:151931425-151931447 AGTTATGCCAAATAGTAGAATGG - Intergenic
915640644 1:157222076-157222098 CATTATGGAAAACAGTATGGAGG - Intergenic
915818669 1:158997382-158997404 CATTATGGGAAATAGTATGGAGG - Intergenic
915833030 1:159148589-159148611 CGTTATGGAAAACAGTATGAAGG + Intergenic
915845867 1:159264355-159264377 CATTATGCAAAAAAGTATGGCGG - Intergenic
915856163 1:159388585-159388607 CATTAGGGAAAATAGTTGAAAGG + Intergenic
915884318 1:159706267-159706289 AATGATGCAAAATATTGGGAGGG + Intergenic
916060248 1:161093360-161093382 CACTATGCTCAATATTAGGATGG + Intergenic
916188727 1:162158560-162158582 CATTATGGAAAACAGTATGGAGG - Intronic
916228160 1:162510877-162510899 CATTATGGAAAGTAGTATGGAGG - Intronic
916323138 1:163528169-163528191 CATTATGGAAAACAGTATGGAGG + Intergenic
916468734 1:165100388-165100410 CATTATGAACAATAGTATGAAGG + Intergenic
916770994 1:167907984-167908006 CATTATGGAAAATAATATGCAGG + Intronic
916805756 1:168259669-168259691 CATTATGGAAAACAGTATGGAGG - Intergenic
916990931 1:170244063-170244085 CATTATGGAAAACAGTATGGCGG - Intergenic
917008669 1:170445898-170445920 CATTATCAAGAATAATAGGAAGG - Intergenic
917069360 1:171133094-171133116 CATTATGGGAAACAGTATGAAGG + Intergenic
917253164 1:173084628-173084650 CATTATGGAAAACAGTAAGGAGG + Intergenic
917558088 1:176113120-176113142 CATTATGAAAAAGAGTATGGAGG - Intronic
917698242 1:177551934-177551956 CATTATGAAAAACAGTATGGAGG - Intergenic
917728754 1:177853544-177853566 CTTTAAGCGGAATAGTAGGAAGG - Intergenic
918108679 1:181436285-181436307 CATTATGGAAAATAGTATGGCGG + Intronic
918228347 1:182508098-182508120 CAGTATGAAAAATAGTATGGAGG - Intronic
918503310 1:185223119-185223141 CATTATGTAAAATAGTACAGAGG - Intronic
918667876 1:187174596-187174618 CATTATGAAAAACAGTATAAAGG + Intergenic
918813073 1:189146148-189146170 CATTATGGAAAATAATATGGAGG + Intergenic
918932162 1:190868417-190868439 CACAATGCAAAATTGAAGGAAGG - Intergenic
919026799 1:192182260-192182282 CATTATAGAAAATAGTATAAGGG - Intronic
919146143 1:193637905-193637927 CATCATGGAAAATAGTATGGAGG - Intergenic
919210992 1:194485983-194486005 CATTATGAAAAATAGTATGAAGG - Intergenic
919320884 1:196036427-196036449 CATTATGGAAAACAGTATGTAGG - Intergenic
919507060 1:198412424-198412446 CATTATGAAAAATAGTATGGAGG - Intergenic
919541658 1:198854072-198854094 CATTTTGGAAAATAGTAGAGAGG + Intergenic
919585249 1:199430446-199430468 CAATATGTAAAACAGTATGAAGG + Intergenic
919598853 1:199598568-199598590 CATTATGGAAAACAGTATGGAGG + Intergenic
919963776 1:202500043-202500065 CATTATGGAAAACAGTATGGAGG + Intronic
920282783 1:204856950-204856972 CACTATGCATAATAGCAGAAAGG - Intronic
920632676 1:207668089-207668111 CATTATGGGAAATAGTATGGAGG + Intronic
921127815 1:212193651-212193673 CATTATGGAAAACAGTACGGAGG - Intergenic
921174034 1:212577996-212578018 CATTATGAAAAACAGTATGGAGG - Intronic
921461778 1:215435842-215435864 CATTATGGAAAATAGTATGGAGG - Intergenic
921529640 1:216265416-216265438 CATTATGGAAAAAAGTATGAAGG + Intronic
921733971 1:218605852-218605874 CATTATGGAAAACAGTATGGAGG + Intergenic
921956361 1:220987893-220987915 CATTATAGAAAACAGTAGGGAGG - Intergenic
922403916 1:225291645-225291667 CATTATGGCAAATAGTATGGAGG - Intronic
922523724 1:226280855-226280877 CATTATGGAAATTAGTATGGAGG + Intronic
923058277 1:230446153-230446175 CATTATGGAAAAGAGTATGGAGG + Intergenic
923230452 1:231981712-231981734 CCCTATCCAGAATAGTAGGAGGG + Intronic
923834976 1:237601010-237601032 CATTATGAAAAACAGTATGGAGG + Intronic
923915498 1:238499213-238499235 CATTATGGAAAGCAGTATGACGG + Intergenic
923952542 1:238974967-238974989 CATTATGCATAATAGCAAAAAGG - Intergenic
924196364 1:241611624-241611646 AATAATTCAAAATGGTAGGACGG + Intronic
924393471 1:243589604-243589626 CATTATGGAAAACAGTATGGAGG + Intronic
924649677 1:245914192-245914214 CATTATGGAAAACAGCATGAGGG + Intronic
1063024530 10:2164777-2164799 CATTATGGAAAACAGTAAGGAGG + Intergenic
1063286947 10:4699483-4699505 CATTATGGAAAACAGTATGGAGG + Intergenic
1063359050 10:5433866-5433888 CATTAGGGAAAAAAGGAGGATGG - Intronic
1063396185 10:5690328-5690350 CTTTATACAAAATATTAGCAAGG - Intronic
1063757541 10:9031616-9031638 CATTATGGAAAACAGTATGGTGG + Intergenic
1063871288 10:10420328-10420350 CATTATGGAAAACAGTATGGGGG - Intergenic
1063901756 10:10740478-10740500 CATTATGGAAAATGGTATGGAGG + Intergenic
1064757547 10:18585238-18585260 CATTATGTAAAATGGTATGGAGG + Intronic
1064816002 10:19263212-19263234 CATTATGAAAAACAGTATGGAGG - Intronic
1065200254 10:23305748-23305770 CATTATGGAAAATAGTATGGAGG + Intronic
1065407460 10:25385535-25385557 CACTATGGAAAACAGTATGAAGG - Intronic
1065548029 10:26842001-26842023 CATGATGGAAAATAGTATGGAGG - Intronic
1065632660 10:27696630-27696652 TAATATGCAAAACATTAGGATGG + Intronic
1065764820 10:29018599-29018621 CATTATGGAAAACAGTATGGAGG + Intergenic
1066142474 10:32520287-32520309 CACTATGGAAAATAGTTTGAGGG - Intronic
1066608989 10:37215382-37215404 TATTTTGCTAAATAGTAGGAGGG + Intronic
1067168811 10:43887420-43887442 CATTATGGAAAACAGTATGGAGG + Intergenic
1067271742 10:44797471-44797493 CATTCACCAAAATAGTATGATGG + Intergenic
1067959471 10:50831985-50832007 CATTATGGAAAACAGTATGCAGG + Intronic
1068205465 10:53845297-53845319 CATTATGGAAAACAGTATGGAGG + Intronic
1068325873 10:55485566-55485588 CATTATGGAAAACAGTATGGAGG + Intronic
1068334279 10:55611574-55611596 CATTATGGAAAACAGAAGGGAGG + Intronic
1068381461 10:56259191-56259213 CACTATGCAAAAAAGTAAGGAGG - Intergenic
1068422290 10:56809929-56809951 CATTATGGAGAATAGTATGGAGG - Intergenic
1068436494 10:56998733-56998755 CATTATAAAAAACAGTATGAAGG + Intergenic
1068479051 10:57565528-57565550 CATTATGGAGAATAGTATGGAGG - Intergenic
1068629589 10:59285515-59285537 CACTATGCAAAACAGAATGATGG + Intronic
1069126120 10:64636585-64636607 CATTGTGGAAAATAGTTGGGCGG - Intergenic
1069220919 10:65882231-65882253 CATTATGAAAAATGGTATGGAGG - Intergenic
1069509135 10:69028098-69028120 GATTGTGCAAAACTGTAGGATGG + Intergenic
1069680343 10:70280295-70280317 CATTATGGAGAATAGTATGGAGG - Intronic
1070491975 10:76985799-76985821 CATTATGCAACAGAGAAGGTTGG + Intronic
1070556928 10:77535465-77535487 CACTATGGAAAACAGTATGAAGG + Intronic
1070566738 10:77609015-77609037 CATTATGGAAAACAGTATGGAGG + Intronic
1071002786 10:80849726-80849748 CATTATGAAAAACAGTAGGGAGG + Intergenic
1072301099 10:94063180-94063202 CATAAAGGAAAAGAGTAGGAGGG - Intronic
1072379526 10:94853275-94853297 CATTATGCACAAAGGAAGGAAGG - Intergenic
1072391237 10:94989406-94989428 CATTATGCATAAAAGAAGGAAGG - Intergenic
1073198331 10:101713769-101713791 CATTATGGAAAACAGTATGGAGG - Intergenic
1073437029 10:103524011-103524033 CATTATGGAAAACAGTATCAAGG - Intronic
1073654756 10:105401735-105401757 CATTATGGAAAATAGTATGGAGG + Intergenic
1073719612 10:106152232-106152254 CATTATGGAAAATAGTATAGAGG + Intergenic
1073807613 10:107116184-107116206 CATTATGTAAGACAGTAGGAAGG + Intronic
1073851520 10:107624526-107624548 CATTATGGAAAATAGTATGGAGG - Intergenic
1073866511 10:107810634-107810656 CATTATGCAAAATAGCCAAAAGG - Intergenic
1074173488 10:110970603-110970625 CACTATGGAAAACAGTATGAAGG - Intronic
1074213249 10:111357961-111357983 GATTACAGAAAATAGTAGGAGGG + Intergenic
1074486403 10:113887275-113887297 CATTTTGGAAAATAGTATGGAGG + Intronic
1074812365 10:117118470-117118492 CACTATGAAAAATAGTATGGAGG + Intronic
1076050640 10:127330504-127330526 CACTATGGAAAATAGTAGGATGG + Intronic
1077725173 11:4667135-4667157 CATTATGGAAAATAATACGGAGG + Intergenic
1077936241 11:6789823-6789845 CATTATGGAAAACAGTATGGAGG + Intergenic
1078123941 11:8539980-8540002 CATTATGGAAAACAGTATGGAGG + Intronic
1078328545 11:10400137-10400159 CATTATGGAAAACAGTATGGGGG - Intronic
1078388618 11:10915339-10915361 CAGTAGGCTAAATAGTAGAAAGG - Intergenic
1078939060 11:15980211-15980233 CAATCTGCAAAGTAGGAGGAAGG + Intronic
1079357452 11:19741923-19741945 CATTATGAAAAATAGCATGGAGG - Intronic
1079553131 11:21726185-21726207 CATTATGGAAAATAGTATGGAGG - Intergenic
1079573366 11:21972433-21972455 CATTATAGAAAATAGTATGTAGG - Intergenic
1079822891 11:25153375-25153397 CATTATGAAAAATAGTATGAAGG - Intergenic
1080163381 11:29206712-29206734 CATTATGGAAAACAGTATGGAGG + Intergenic
1080293648 11:30700358-30700380 CATTATGGAAAACAGTAGGGAGG - Intergenic
1080713749 11:34776800-34776822 CATTATGGAAAACAGTATGGAGG - Intergenic
1080728157 11:34917485-34917507 CAGTATGCAAAATGGCAGGCCGG + Intronic
1080986932 11:37479756-37479778 AATTATGGAAAATATCAGGAAGG - Intergenic
1081134736 11:39426237-39426259 CATGATGAAAAATGGTATGAAGG + Intergenic
1081145313 11:39556255-39556277 CACTATGGAAAACAGTACGAAGG + Intergenic
1081210789 11:40331200-40331222 CATTATGGAAAACAGTATGGAGG + Intronic
1082104776 11:48209841-48209863 CATTATGCAAAATACATGGCTGG + Intergenic
1082211198 11:49504222-49504244 CATTATGAAAAATAGTATGGAGG + Intergenic
1082864969 11:57890646-57890668 CATTATGGAAAACAGTATGGAGG - Intergenic
1082914681 11:58419622-58419644 CATTATGGAAAACAGTATGGAGG + Intergenic
1083520514 11:63306689-63306711 CATTATGGAAAACAGTATGAAGG - Intronic
1084790211 11:71470512-71470534 TATTATGCAAAAGAGTACCAAGG - Intronic
1085817321 11:79753162-79753184 CATTATGGAAAAGAGTATGGAGG + Intergenic
1085842843 11:80032851-80032873 CATTATGGAAAATAGAATGGAGG + Intergenic
1086053633 11:82622600-82622622 TATTATTCAAAATAGAAGCATGG + Intergenic
1086182276 11:83967304-83967326 CATTATGGAAAACAGTATGCAGG - Intronic
1086276850 11:85140230-85140252 CATTATGGAAAACAGTATGGAGG - Intronic
1086320311 11:85639646-85639668 CATTATGGAAAACAGTATGGTGG + Intergenic
1086461527 11:87010518-87010540 CATTATGGAAAACAGTATGGAGG + Intergenic
1086638445 11:89120832-89120854 CATTATGAAAAATAGTATGGAGG - Intergenic
1086903517 11:92393762-92393784 CATTAAGCAGAATAGCATGAAGG + Intronic
1086936760 11:92753635-92753657 CATAATGGAAAATAGTATGGAGG + Intronic
1087209364 11:95430973-95430995 CATAATGCAAAACAGTCGAAAGG + Intergenic
1087434859 11:98101910-98101932 CATTATGGAAAATAGTATGGAGG + Intergenic
1087675808 11:101159701-101159723 CATTATGGAGAACAGTATGAAGG - Intergenic
1087867722 11:103252424-103252446 CATTATGAAAAATGGTAGGAAGG - Intronic
1088087724 11:106001623-106001645 GATTTTGCAAATGAGTAGGATGG - Intronic
1088185414 11:107162061-107162083 CATTATGGAAAATGGCATGAAGG + Intergenic
1088374272 11:109123090-109123112 CACTATGAAAAATAGTATGGAGG - Intergenic
1088386079 11:109258032-109258054 CATTATGGAAAACAGTATGGAGG - Intergenic
1088618741 11:111660605-111660627 CATTATGGAAAATCTGAGGAAGG - Intronic
1089819876 11:121215120-121215142 CATTATGAAAAACAGTGGGGAGG + Intergenic
1090112122 11:123924083-123924105 CATTATGGAAAACAGTATGGAGG - Intergenic
1090145982 11:124323123-124323145 CATTCTGTAAAATAGAAGTAGGG - Intergenic
1090746800 11:129712154-129712176 TATTATGCAAAACAGTGTGAAGG + Intergenic
1090789989 11:130083896-130083918 CACTATAGAAAATAGTATGAAGG - Intronic
1090885761 11:130874936-130874958 CACTATGGAAAACAGTATGAAGG + Intergenic
1091344031 11:134840671-134840693 CATTATGGAAAATAGTACAAAGG + Intergenic
1091519848 12:1227199-1227221 CATTATGGAAAACGGTAAGAAGG - Intronic
1091547472 12:1511568-1511590 CATTCTGGAAAACAGTATGAAGG - Intergenic
1092724538 12:11472416-11472438 CATTATGGAAAATGGTATGGAGG - Intronic
1093061125 12:14606242-14606264 CATTATGAAAAACAGTATGAAGG - Intergenic
1093138738 12:15481928-15481950 CATTATGGAAAACAGTATGGAGG + Intronic
1093212156 12:16320909-16320931 TATTATGAAAAATGGTATGAAGG - Intergenic
1093314410 12:17630594-17630616 CTTTGTGAAAAATAGTATGATGG - Intergenic
1093436732 12:19143196-19143218 CATTATGGAAAACAGTATGGAGG - Intronic
1093549644 12:20392571-20392593 CATTATGGAAAACAGTATGGAGG + Intronic
1093566425 12:20610468-20610490 CATTATAGAAAATAGTATAACGG + Intronic
1093850517 12:24031114-24031136 CATTATGGAAAACAGTATGGAGG + Intergenic
1094038607 12:26098476-26098498 CATTATGGAAAATGGTATGGGGG + Intergenic
1094049792 12:26206308-26206330 CTTTATGAAAAACAGTATGAGGG - Intronic
1094355789 12:29575814-29575836 CATTATGCAAAACAATATGGAGG - Intronic
1094657985 12:32439534-32439556 CATTATGGGAAACAGTATGAAGG - Intronic
1095233919 12:39774849-39774871 AAGTATGCAAAATAGATGGATGG + Intronic
1095592211 12:43915991-43916013 CATTATGGTAAATAGTGGCAGGG + Intronic
1095803697 12:46295187-46295209 CATTATGGAAAATAGTATGGTGG + Intergenic
1096017414 12:48290129-48290151 CATTATGAAAAACAGTATGGAGG + Intergenic
1096415916 12:51412986-51413008 CATTATGGAAAACAGTATGGAGG - Intronic
1096435192 12:51584286-51584308 CATTATGGAAAACAATATGAAGG - Intergenic
1096930823 12:55207760-55207782 CATTATGGAAAATAATATGGAGG + Intergenic
1096959802 12:55566907-55566929 CATTATGGAAAACAGTATGGAGG + Intergenic
1097207601 12:57336221-57336243 CATTATGGAAAGCAGTATGATGG + Intronic
1097606478 12:61760935-61760957 CATTTCACAAAAAAGTAGGAGGG - Intronic
1098072507 12:66690959-66690981 CATTATGGAAAACAGTATGGAGG - Intronic
1098324257 12:69284520-69284542 CATTATGAAGAATATTAGGCTGG - Intergenic
1098514851 12:71362932-71362954 CATTATGCAAAACAACATGAAGG + Intronic
1098596504 12:72278508-72278530 CATTATGGAAAACAGTATGGAGG - Intronic
1098800795 12:74955321-74955343 CATTATGAAAAGTAGTATGGAGG - Intergenic
1099343717 12:81471715-81471737 CACTATGGAAAATAGTATGGAGG - Intronic
1099405414 12:82254259-82254281 CATTATGGAAAACAGTATGAAGG + Intronic
1100342722 12:93696159-93696181 CATTATGGAAAACAGTATGGAGG + Intronic
1100780297 12:98018149-98018171 CATTATGGAAAATAGTATGGAGG + Intergenic
1100835678 12:98564856-98564878 CATTATGGAAAACAGTATGGAGG + Intergenic
1100968008 12:100034058-100034080 CATTATGGAAAACAGTATGGAGG + Intronic
1101228586 12:102715317-102715339 CATTATGGATAATAGTATGGAGG - Intergenic
1101378779 12:104194242-104194264 CATTATGGAAAATAGGATGGAGG - Intergenic
1101429192 12:104612761-104612783 CATTATGGAAAACAGTATGGAGG + Intronic
1101504401 12:105332298-105332320 CATTAAAAAAAATTGTAGGAAGG + Intronic
1101637016 12:106552173-106552195 CATTATGAAAAACAGTATGGAGG + Intronic
1101766081 12:107700739-107700761 CATTATGGAAAATAGTATGGTGG - Intronic
1102138623 12:110596226-110596248 CATTATGGAAAACAGTATGGTGG + Intergenic
1102248145 12:111368183-111368205 CATTTTGCAAAATACTTGGTGGG + Intronic
1102711239 12:114929481-114929503 CACTATGGAAAATAGTATGGAGG - Intergenic
1102725120 12:115056514-115056536 CATTATGGAAAACAGTATGGCGG - Intergenic
1103103520 12:118202436-118202458 CATTATGGAAAACAGTATGGAGG - Intronic
1103169283 12:118799813-118799835 CATTATGGAAAACAGTATGGAGG - Intergenic
1103271697 12:119678923-119678945 CATTATGGAAAATGGCATGAAGG - Intronic
1104867961 12:131971551-131971573 CATTATGGAAATCAGTATGAAGG - Intronic
1105534538 13:21252555-21252577 CATTATGGAAAATAGTATGGCGG + Intergenic
1106029445 13:25986780-25986802 CATTATGGAAAACAGTATGGAGG - Intronic
1106281065 13:28271884-28271906 CATTTCCCAAAATATTAGGAAGG - Intronic
1106709148 13:32312331-32312353 CATTATGGACAACAGTATGAAGG + Intronic
1106819518 13:33448674-33448696 CATTATGGAAAACAGTATGGCGG - Intergenic
1107101961 13:36602922-36602944 CATTATGGAAAACAGTATGGAGG + Intergenic
1107200108 13:37704869-37704891 CATTATGGAAAATAGTATGGAGG + Intronic
1107319709 13:39172861-39172883 CATTATTGAAAATAGTATGGAGG - Intergenic
1107586329 13:41852000-41852022 CATTATAGAAAATAGTATGGAGG - Intronic
1108210623 13:48136391-48136413 CATTATGGAAAATTGTATGGAGG + Intergenic
1108313818 13:49219812-49219834 CATAATGCTAAATAATAGGAGGG - Intergenic
1108451113 13:50564186-50564208 CACTATGCAAAACAGTATGGAGG - Intronic
1108530770 13:51325157-51325179 ATTTATGCAAAATAGCAGGTGGG - Intergenic
1108790356 13:53962605-53962627 CATTGTGGAAAACAGTAGGAAGG - Intergenic
1108877295 13:55061818-55061840 CATTATGGAAAAAAGTGTGAAGG + Intergenic
1108906754 13:55485347-55485369 CATTATGTAAAGCAGTAGGGAGG - Intergenic
1109151352 13:58852279-58852301 CATTTTGCAAAATAGAAGAAGGG + Intergenic
1109275942 13:60304642-60304664 CATTATTCAAAATAGCTAGAAGG - Intergenic
1109456613 13:62600885-62600907 CATTATGCAAAATAGCATGGAGG - Intergenic
1109697023 13:65974189-65974211 CATTATGAAAAATAGTGTGGAGG - Intergenic
1109820755 13:67650503-67650525 CATTATGGAAAACAGTATGGAGG - Intergenic
1110016498 13:70412150-70412172 CATTATATGAAATAGTATGAAGG - Intergenic
1110154534 13:72298848-72298870 CAAAATGCAAAATATTAGCAAGG + Intergenic
1110556573 13:76866513-76866535 CATTATGGAAAATAGTATAGAGG - Intergenic
1110557148 13:76872762-76872784 CATTATGGAAAACAGTATGGAGG + Intergenic
1110802440 13:79714527-79714549 CATTATGAAAAGTAGTATGGAGG + Intergenic
1110808535 13:79787187-79787209 CATTATGGAAAACAGTATGGAGG - Intergenic
1110952098 13:81507677-81507699 TATTATATAAAATATTAGGAAGG + Intergenic
1111010509 13:82307563-82307585 CATTATGCAAATCATTATGATGG - Intergenic
1111053368 13:82915466-82915488 CATTATGGAGAATAGTACGGAGG + Intergenic
1111093292 13:83475356-83475378 CATTATGGAAAACAGTATGAAGG + Intergenic
1111366654 13:87255663-87255685 CATTATGGAAAATAGTATTCAGG + Intergenic
1111602394 13:90491622-90491644 CATTTTGGAAAACAGTAGGGAGG - Intergenic
1111609428 13:90584218-90584240 CAGTATGCAGAACAGTATGAGGG + Intergenic
1111813949 13:93126857-93126879 CATTATGGAAAACAGTATGTAGG + Intergenic
1112127516 13:96484906-96484928 CATTATGAAAAACAGTATGGAGG - Intronic
1112217366 13:97446908-97446930 CATCATGCAATATAGTAAAATGG + Intronic
1112553595 13:100445984-100446006 CATTATGGAAAACAGTACGGAGG - Intronic
1112683386 13:101793648-101793670 CATTATGGAAAATTGTATGGAGG - Intronic
1112815882 13:103272531-103272553 CATTACGGAAAAGAGTATGAAGG + Intergenic
1112913265 13:104516097-104516119 CATTATGCTAAATGGTATAATGG - Intergenic
1113033708 13:106024729-106024751 TATTATGGAAAAGAGTATGAAGG + Intergenic
1113664126 13:112129070-112129092 CATTATGGAAAACAGTACGGAGG + Intergenic
1114169651 14:20259334-20259356 TATTATGAAAAATAGAAGGCTGG - Intronic
1114339226 14:21725426-21725448 CATTATGGAAAACAGTAGGGAGG + Intergenic
1114698685 14:24653588-24653610 CATTATGGAAAACAGTATGGAGG - Intergenic
1115039485 14:28906064-28906086 CATTATGAAAAACAGTATGGAGG - Intergenic
1115297010 14:31840024-31840046 CATTAAGGAAAATAGTATGGAGG + Intronic
1115305977 14:31933938-31933960 CATTGTGGAAAACAGTAGGGAGG - Intergenic
1115388512 14:32826208-32826230 CAGTATGCAAAATTGAAGAAAGG + Intronic
1115792152 14:36892173-36892195 CATTATGAAAAATAGTATGGAGG + Intronic
1115825627 14:37269766-37269788 CTTAATGCAAAATATTTGGAAGG - Intronic
1115867405 14:37762393-37762415 CATTATGAAAAACAGTATGGTGG - Intronic
1116081893 14:40185312-40185334 CATTATGGAGAATAGTATGGAGG - Intergenic
1116096469 14:40376802-40376824 CATTATGGAAAATAATGTGAAGG - Intergenic
1116369034 14:44106660-44106682 CATTATGGAAAACAGTATGGAGG + Intergenic
1116427764 14:44810982-44811004 CATTATGGAAAATAATATGGAGG + Intergenic
1116579175 14:46616711-46616733 CATTATGGAAAATAGTATATAGG + Intergenic
1116633311 14:47360644-47360666 CATTATGGAAAACAGTATGGAGG + Intronic
1116844701 14:49854197-49854219 CATTGTGCAAAACAGTATAAAGG + Intergenic
1117132434 14:52699363-52699385 CATTTTGAAAAATAGTATGGAGG + Intergenic
1117210126 14:53488643-53488665 CATTATGGAAAACAGTATGGAGG + Intergenic
1117441893 14:55767716-55767738 CATTATGGAAAATTGTATGAAGG + Intergenic
1117608511 14:57457544-57457566 CATTATGGAAAATAGTATGGCGG + Intergenic
1117627475 14:57654661-57654683 CATTATGGAAAACAGTATGAAGG - Intronic
1117782354 14:59246620-59246642 CATTATGGAAAACAGTATGGTGG - Intronic
1118141019 14:63082722-63082744 CATTATGAACAATAGTATGGAGG + Intronic
1118526167 14:66646393-66646415 CATTATGAAAAACAGTATAATGG + Intronic
1118528586 14:66674888-66674910 CATTATGAAAAACAGTATGGAGG - Intronic
1118548788 14:66925819-66925841 CACTATGCAGAATAGTATGGAGG - Intronic
1118702619 14:68448901-68448923 AATCAAGCAATATAGTAGGAGGG + Intronic
1118956367 14:70485970-70485992 CATTATGGAAAACAGTATGGAGG + Intergenic
1119058657 14:71450824-71450846 CATTATGCAAAACAATATGGAGG + Intronic
1119102523 14:71893500-71893522 CACCATGCTAAATAGTAGAAAGG + Intergenic
1119123417 14:72100774-72100796 CATTAAGATAAATGGTAGGAGGG - Intronic
1120065683 14:80038506-80038528 CATTATGGAAAATAGTATGGAGG + Intergenic
1120230025 14:81831830-81831852 CATCATGCAAAATACCAAGAGGG + Intergenic
1120304760 14:82755109-82755131 CACTATGGAAAACAGTATGAAGG + Intergenic
1120572497 14:86138857-86138879 CATTATGGAAAACAGTAGGGAGG + Intergenic
1120593105 14:86399547-86399569 CATTATGGAAAACAGTATGAAGG + Intergenic
1120604467 14:86556869-86556891 CATTATGAAAAATAATATGGAGG + Intergenic
1120640604 14:87007192-87007214 CATTATGAAAAACAGTATGGAGG - Intergenic
1120660638 14:87246204-87246226 CATTATGGAAAATAGTATAGAGG - Intergenic
1120687578 14:87555808-87555830 CATTTTGCAAAACAGTATGGAGG + Intergenic
1121903747 14:97720597-97720619 CATTATGGAAAACAGTATGGAGG - Intergenic
1122338827 14:101011600-101011622 CATTAAGCAGAATATTAGGGTGG - Intergenic
1123145562 14:106126834-106126856 CATTATGCAAAACAGTGTGGTGG + Intergenic
1123985953 15:25646181-25646203 CACTATGGAAAATAGTATGGAGG + Intergenic
1124085936 15:26550562-26550584 CATTATGGAAAACAGTATGGAGG + Intronic
1124359159 15:29022210-29022232 TATTATGGAAAATAGTATGGAGG - Intronic
1124554696 15:30713562-30713584 CATTATGGAAAACAGTATGGAGG - Intronic
1124676552 15:31692118-31692140 CATTATGGAAAACAGTATGGAGG + Intronic
1124791617 15:32732310-32732332 CATTATGGGAAATAGTGGAATGG - Exonic
1124866595 15:33498256-33498278 TATTATGCAAAACAGTATGGAGG - Intronic
1124909190 15:33901584-33901606 CATTATGGAAAACAGTATGGAGG - Intronic
1125054946 15:35347695-35347717 CAATATGGAAAATAGTATGGCGG - Intronic
1125170991 15:36766475-36766497 CACTATGAAAAATAGTATGGAGG - Intronic
1125190175 15:36982722-36982744 CATTATGGAAAATAGTATGAAGG - Intronic
1125435875 15:39645206-39645228 CATTGTGGAAAACAGTATGAAGG + Intronic
1125829130 15:42700349-42700371 CATTATGGCAAACAGTATGAAGG - Intronic
1126128444 15:45317034-45317056 CATTATGAAAAACAGTATGGAGG - Intergenic
1126217069 15:46168094-46168116 CATTATGGAAAATGGTAGGCTGG - Intergenic
1126222283 15:46228152-46228174 CATTATGGAAAACAGTATGGAGG + Intergenic
1126292271 15:47095191-47095213 CATTATGGAAAACAGTATGGAGG + Intergenic
1126374245 15:47979138-47979160 CATTATGGAAAACAGTATGGAGG + Intergenic
1126659510 15:51018582-51018604 CATTATGGAAAATAGTATGGAGG - Intergenic
1126944240 15:53801056-53801078 CATTATGGAAAACAGTATGGAGG + Intergenic
1127020819 15:54746325-54746347 CATTATGGAAAACAGTATGCAGG + Intergenic
1127316591 15:57800771-57800793 CATTATGGAAAACAGTATGGAGG - Intergenic
1127639619 15:60903756-60903778 AATTATGCAAAATCGGAGGTCGG + Intronic
1127730132 15:61792890-61792912 CATTATGGAAAACAATATGAAGG - Intergenic
1127952602 15:63824209-63824231 CATTATGGAAAACAGTATGTAGG + Intronic
1127957609 15:63866517-63866539 CAATCTGAAAAATAGCAGGAAGG - Intergenic
1129075107 15:72988023-72988045 CATTATGGAAAACAGTATGAAGG + Intergenic
1129982970 15:79891322-79891344 CAAAATACAAAATAGAAGGATGG + Intronic
1130602198 15:85283794-85283816 CACTTTGCAAAACAGGAGGAAGG + Intergenic
1130766808 15:86879199-86879221 CATTTTGCAAAACAGGAGGAAGG - Intronic
1131448969 15:92523230-92523252 CATCATGGAACATAGTAGAAAGG + Intergenic
1131734848 15:95321026-95321048 CACTATGGAAAACAGTATGAAGG - Intergenic
1132136668 15:99347848-99347870 CATTATGGAAAACAGTATGGAGG - Intronic
1132324226 15:100953752-100953774 CATTATGGGAAAAAGTATGAAGG - Intronic
1132848671 16:2013505-2013527 ATTTATGCCACATAGTAGGAGGG - Intronic
1134362877 16:13548783-13548805 CATTATGGAAAACAGTATTAAGG + Intergenic
1135090605 16:19512139-19512161 CATTATGGAAAACAGTATGGAGG - Intronic
1135774990 16:25249769-25249791 CATTATGGAAAACATTAGGGAGG + Intronic
1135802473 16:25510745-25510767 CCAAATTCAAAATAGTAGGAAGG + Intergenic
1135876808 16:26208917-26208939 CATTAAGGAAAATAGTATGGAGG + Intergenic
1136674307 16:31886932-31886954 CATTATGAAAAATGGCACGAAGG - Intronic
1136693544 16:32054961-32054983 CATTATGCAAAACAGTGTGGTGG - Intergenic
1136794036 16:32998184-32998206 CATTATGCAAAACAGTGTGGTGG - Intergenic
1136875875 16:33856195-33856217 CATTATGCAAAACAGTGTGGTGG + Intergenic
1137030169 16:35516544-35516566 CATTATGAAAAATAGTACAGAGG + Intergenic
1137242386 16:46667037-46667059 CATTATGGAAAACAGTATGGAGG - Intronic
1137258178 16:46795690-46795712 CATTATGGAAAATGGTATGGAGG + Intergenic
1137269252 16:46892502-46892524 CATTATGGAAAACAGTATGGAGG - Intronic
1137420084 16:48325824-48325846 CATTATGGAAAACAGTATGGAGG - Intronic
1137459169 16:48643099-48643121 CATTATGGAAAACAGTATGGAGG - Intergenic
1137485449 16:48886918-48886940 CATTATGAAGAATAGTATGGAGG - Intergenic
1138557247 16:57779002-57779024 CACTATGGAAAACAGTATGATGG + Intronic
1139173507 16:64659952-64659974 CATTATGGAAAACAGTAGGGAGG - Intergenic
1139196931 16:64930382-64930404 CATTATGAAAAATATTATGGAGG + Intergenic
1139304357 16:65970692-65970714 CATTTTGGAAAATAGTATGGAGG - Intergenic
1139321902 16:66121610-66121632 AATGATGGAAAACAGTAGGAAGG - Intergenic
1140061575 16:71574768-71574790 AATTTTGCAAAATATTATGATGG - Intronic
1140153160 16:72393079-72393101 AATACTCCAAAATAGTAGGAAGG + Intergenic
1140641373 16:76977425-76977447 CATTATGGAAAGTAGTATGAAGG - Intergenic
1140679612 16:77372188-77372210 CATTATGGAAAATGGTATGAAGG + Intronic
1140766137 16:78159384-78159406 CATTATGAAAAACAGTATGGAGG - Intronic
1141038434 16:80650540-80650562 CACTATGCAAAACAGTTGGATGG + Intronic
1203096298 16_KI270728v1_random:1259877-1259899 CATTATGCAAAACAGTGTGGTGG - Intergenic
1143613638 17:8036453-8036475 CATTGTGGAAAATAGTATGGCGG + Intergenic
1143814619 17:9502124-9502146 CATTATGGAAAACAGTATGGAGG + Intronic
1143916383 17:10296371-10296393 CATTTTGCAAGAGAGTAGGAGGG + Intergenic
1144122689 17:12171230-12171252 CATTATGGAAAACAGTATGGAGG - Intergenic
1145173021 17:20675818-20675840 CATTATGGAAAACAGTATGGAGG - Intergenic
1145190083 17:20832528-20832550 CATTATGGAAAACAGAAGGGAGG + Intergenic
1145220134 17:21081813-21081835 CATTATGGAAAACAGTATGGAGG + Intergenic
1146044517 17:29492842-29492864 CAATATGGTAAATAGTAGGCTGG + Intronic
1146102099 17:29992859-29992881 CATTGTGGAAAATGGTAGGGAGG - Intronic
1146433350 17:32820188-32820210 CATTATGGAAAACAGTATGTAGG + Intronic
1146755264 17:35425871-35425893 CATTATGGAAAATAGTATGGAGG - Intronic
1147005582 17:37400962-37400984 CATTTTGGAAAATAGTATGGAGG - Intronic
1147507278 17:41031757-41031779 CATTATGGAAAACAATATGAAGG + Intergenic
1147508576 17:41045747-41045769 CATTATGGAAAACAGTATGGAGG + Intergenic
1147512011 17:41078123-41078145 CATTATGGAAAACAGTATGGAGG + Intergenic
1148528573 17:48366582-48366604 CATTGTGAATAATAGTATGATGG + Intronic
1149283199 17:55131087-55131109 CATTTTGGAAAATAGTACGTAGG - Intronic
1149379934 17:56083420-56083442 GATATGGCAAAATAGTAGGAGGG - Intergenic
1150467860 17:65409995-65410017 CATTATGGAAAACAGTATGGAGG + Intergenic
1150895619 17:69207311-69207333 CATTATGAAAAATATGATGAAGG + Intronic
1150955196 17:69850679-69850701 CATTAGGAAAAACAGTACGATGG - Intergenic
1203168896 17_GL000205v2_random:128285-128307 CATTATAGAAAATAGTATGGAGG + Intergenic
1153083662 18:1257947-1257969 CACTATGGAAAACAGTATGAAGG + Intergenic
1154261496 18:12838041-12838063 TATTATGTAAAATAGTAAAAAGG + Intronic
1155467668 18:26156221-26156243 CATTATGGAAAATAGTATGGAGG + Intronic
1156007605 18:32462186-32462208 CATTATGGAAAACAGTATGGAGG - Intronic
1156144733 18:34161370-34161392 CATTATGGAAAATAGTGTGGAGG - Intronic
1156822056 18:41384736-41384758 CAATATTCTAAGTAGTAGGATGG + Intergenic
1157232141 18:45927378-45927400 CACTATGGAAAACAGTATGATGG + Intronic
1157377640 18:47181079-47181101 CATAATTCACATTAGTAGGAAGG + Intergenic
1157982829 18:52401770-52401792 CATTATGCTCAATTTTAGGAAGG + Intronic
1158108618 18:53914423-53914445 CATTATGGAAAACAGTATGATGG - Intergenic
1158171031 18:54599876-54599898 CATTATGGACAATAGTATGGAGG + Intergenic
1159058810 18:63493275-63493297 CATTATGGAAAAGAGGAGGGGGG - Intronic
1159192505 18:65065250-65065272 CAGCATGAAAAACAGTAGGACGG - Intergenic
1159291279 18:66424767-66424789 CATTGTGCAAAATAGAATGGAGG + Intergenic
1159302448 18:66592975-66592997 CATTATGTAAAACAGTATGAAGG - Intronic
1159340743 18:67129460-67129482 AATTATGAAAAACAGTAGGGAGG - Intergenic
1159398687 18:67900833-67900855 CATTATGGAAAACAGTATGGAGG + Intergenic
1159483242 18:69018345-69018367 CATTATGGAGAACAGTATGAGGG - Intronic
1159543449 18:69810871-69810893 CATTATGGAAAACAGTATGGAGG + Intronic
1159792272 18:72797099-72797121 CATTATTCTTAATAGTAAGAAGG - Intronic
1159801580 18:72906683-72906705 CAGCATGCAAAATAGTGGAAAGG - Intergenic
1159824051 18:73183868-73183890 CACTATGGAAAACAGTATGAAGG + Intronic
1159854978 18:73575400-73575422 CATTATGGACAACAGTATGAGGG - Intergenic
1160057854 18:75502294-75502316 CATTATGGAAAACAGTATGGAGG - Intergenic
1162085209 19:8244683-8244705 CATTATTCAAAATAGAACCAAGG + Intronic
1162221874 19:9184068-9184090 CATTATGGGAAATAGTGTGAGGG + Intergenic
1162225736 19:9220780-9220802 CATTATGGAAAAGAGTATGGAGG - Intergenic
1162227833 19:9239076-9239098 CATTATGGAAAACAGTATGAAGG - Intergenic
1164209244 19:23083502-23083524 CATTATAGAAAATAGTATGGAGG - Intronic
1164871351 19:31646777-31646799 CATTATACAAAACAGTATGAAGG - Intergenic
1164946469 19:32297506-32297528 CATTAGGGAAAATAGTATGAAGG - Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165264896 19:34652778-34652800 TATTATGAAAAACAGTATGAGGG + Intronic
1165605392 19:37099251-37099273 CATTATGGAAAATAGTATGGAGG - Intronic
1166026287 19:40088569-40088591 CATTATGGAAAACAGTATGGAGG + Intronic
1166580379 19:43893441-43893463 CATTATGTAAAACAGTATGAAGG - Intronic
1166610229 19:44185320-44185342 CATTATGGAAAATAATATGGAGG - Intergenic
924972125 2:137935-137957 CATTATGCAAAACAGTATGGAGG - Intergenic
925619357 2:5776022-5776044 CATAATGGAAAATAGTATGGAGG + Intergenic
925840664 2:7989075-7989097 CATGATGACAAAAAGTAGGATGG + Intergenic
926511721 2:13789741-13789763 CGATATGAAAAATAGAAGGAAGG + Intergenic
927008446 2:18876958-18876980 CATTATATAAAACAGTATGAAGG - Intergenic
927078561 2:19604389-19604411 CGTTATGGAAAACAGTATGAAGG - Intergenic
927389149 2:22573401-22573423 CACTATGGAAAACAGTATGAAGG + Intergenic
927543883 2:23936164-23936186 CATTATTCAAGATAGCAGAAAGG + Intronic
927609277 2:24521799-24521821 CATTATGAAAAATAGTAGGGAGG - Intronic
927610179 2:24531160-24531182 CATTATGTAAAACAGTATGGAGG + Intronic
927803655 2:26125034-26125056 CATTATTCACAATAGTAAAAGGG - Intronic
928262119 2:29777465-29777487 CAATAAGCAAAATAGATGGATGG - Intronic
929233361 2:39582320-39582342 CATTATGGATAATGGTATGAAGG - Intergenic
930593037 2:53353072-53353094 CATTATGGAAAACAGTATGGAGG - Intergenic
930613419 2:53568178-53568200 CATTATGTCAAGTAGGAGGATGG - Intronic
930674874 2:54189777-54189799 CATTATGTAAAACAGTAGGGAGG - Intronic
930838585 2:55821647-55821669 CATTATGAAAAATAGTATGGAGG + Intergenic
930922953 2:56779453-56779475 TATTATGGAAAACAGTATGAAGG + Intergenic
930986616 2:57596521-57596543 CATTATGTAAAACAGTATGGAGG + Intergenic
931006179 2:57851942-57851964 CATTATGGAAAACAATATGAAGG + Intergenic
931409982 2:62019992-62020014 AATTCTGCAGAATAATAGGAGGG - Intronic
933033980 2:77368912-77368934 CATTATCAAAAATAGTATGGAGG - Intronic
933404024 2:81835063-81835085 CATTTTGGAAAAGAGTATGAAGG + Intergenic
933432053 2:82194727-82194749 TATTATGAAAAACAGTAGGAAGG + Intergenic
933562602 2:83907079-83907101 CATTATGGAAAACAGTATGGAGG - Intergenic
933819973 2:86102205-86102227 CACTATGGAAAACAGTAGGGTGG - Intronic
933992333 2:87642715-87642737 CATTATTCTAAATAGGAGGCTGG + Intergenic
934155213 2:89192902-89192924 CATTATGGAAAACAGTATGGAGG + Intergenic
934212105 2:89989833-89989855 CATTATGGAAAACAGTATGGAGG - Intergenic
934898238 2:98137221-98137243 CACTATGGAAAACAGTATGAAGG - Intronic
935511164 2:103976121-103976143 CATTATGGAAAATAATATGGAGG - Intergenic
935845100 2:107157063-107157085 CATTATGGAAAACAGTATGGAGG - Intergenic
935848622 2:107195057-107195079 AATTCAGAAAAATAGTAGGATGG - Intergenic
936301517 2:111308124-111308146 CATTATTCTAAATAGGAGGCTGG - Intergenic
936431632 2:112469658-112469680 CACTATGGAAAATAGTATGGAGG + Intergenic
936587594 2:113771933-113771955 CATTATGCAAAATAGCCAAAAGG + Intergenic
937432162 2:121848175-121848197 CATTATGAAAAACAGTATGGAGG - Intergenic
937568541 2:123328281-123328303 CATTATGGAAAACAATAGGGAGG + Intergenic
937618693 2:123959630-123959652 CATTTTGGAAGACAGTAGGAAGG - Intergenic
937704599 2:124905355-124905377 CATTATGGAAAAGAGTAGAGAGG + Intronic
937745317 2:125405236-125405258 CATTATGGAAAATAGTATAGCGG - Intergenic
937817344 2:126266250-126266272 CATTATGGAAAACAGTATGGTGG - Intergenic
938177352 2:129145848-129145870 CATTATGAAAAACAGTATGGAGG - Intergenic
938963970 2:136370368-136370390 CATTATGGAAAATGGTATGGAGG + Intergenic
939021750 2:136965673-136965695 CAGTAAGATAAATAGTAGGAGGG - Intronic
939039042 2:137165949-137165971 CATTAAGAAAAAAAGTAGAAAGG + Intronic
939268087 2:139901670-139901692 AATTTTGCAAGATAGTAAGAAGG + Intergenic
939756095 2:146113875-146113897 CATTATGGAAAATAGTATGAAGG + Intergenic
939910834 2:147980787-147980809 CATTATGGAAAACAGTATGGAGG + Intronic
940502505 2:154510997-154511019 CATTATTCAAAATAGTCAAAAGG - Intergenic
940956613 2:159735751-159735773 CATTATTCATAATAGTCAGAAGG - Intronic
941446926 2:165612989-165613011 CATTATGGAATATAGTATGGAGG - Intronic
941538693 2:166755291-166755313 TATTATGCAAAATTGTAGTGAGG - Intergenic
941796329 2:169602955-169602977 CATTATCCAAACCATTAGGAAGG - Intronic
942190884 2:173469068-173469090 CATTATGGAAAACAGTATGGAGG - Intergenic
942340650 2:174942079-174942101 CATTATGGAAAATGGTATGGAGG + Intronic
942495003 2:176530918-176530940 GATTATACTAAATATTAGGAAGG + Intergenic
942529064 2:176888785-176888807 CATTATGAAAAACAGTATGGAGG - Intergenic
942675256 2:178420340-178420362 CATTATCCAAAACAGTATGTAGG - Intergenic
943125483 2:183790673-183790695 CATTATGGAAAACAGTATGAAGG - Intergenic
943129127 2:183835900-183835922 CATTATCAAAAACAGTATGAAGG - Intergenic
943218993 2:185079499-185079521 CATTATGAAAAACAGTATGGAGG + Intergenic
943293652 2:186109148-186109170 CATTATGGAAAATGGTATGGAGG - Intergenic
943318688 2:186419280-186419302 CATTATGGAAAATAGTTTGGAGG + Intergenic
943361981 2:186930750-186930772 CATTATGGAAAATAGTATGGAGG - Intergenic
943518909 2:188923090-188923112 CATTATGGAAAATGGTATGGAGG - Intergenic
943581149 2:189684970-189684992 CATTATGTAAATTAGCTGGAAGG - Intronic
943858121 2:192825054-192825076 CATTATGGAAAATAGTATGGAGG + Intergenic
944267607 2:197746218-197746240 CATTTTGGAAAACAGTAGGGTGG + Intronic
945174670 2:207030537-207030559 CATTATGGAAAACAGTATGGAGG + Intergenic
945384103 2:209176495-209176517 CATACTACAAAATAATAGGATGG - Intergenic
945475678 2:210279328-210279350 CACTATGGAAAACAGTATGAAGG - Intergenic
945519541 2:210807348-210807370 CATTATGGAAATTAATAAGAGGG - Intergenic
945686953 2:212983116-212983138 CATTATGAAGAATAGTATGGAGG + Intergenic
945789320 2:214285044-214285066 CATTATGGAAAACAGTATGGAGG - Intronic
946093930 2:217255781-217255803 CATTATGGAAAATAGTATGAAGG - Intergenic
946151459 2:217775075-217775097 CATTATGGAAAACAGTTTGAAGG + Intergenic
946700509 2:222408175-222408197 CATTATGGAAAATAGTATGGAGG - Intergenic
947075281 2:226336620-226336642 CATTATGGAAAACAGTATGGAGG + Intergenic
947458275 2:230278051-230278073 CATTATGGAAAACAGTATGGAGG - Intronic
947997477 2:234540598-234540620 CATTATGGAAAACAGTATGGAGG + Intergenic
1168746384 20:246131-246153 CATTAAGGAAAACAGTATGAAGG - Intergenic
1169310800 20:4538178-4538200 CATTATGGAAAACAGTATGGAGG + Intergenic
1169457001 20:5760718-5760740 GATTATGAAAAAGAGGAGGAAGG + Intronic
1169515158 20:6309027-6309049 CATTATGGAAAATAGTATGGAGG - Intergenic
1170086167 20:12534845-12534867 CATTATGCATAATGATAGGAGGG + Intergenic
1170377802 20:15720368-15720390 CATTATGGGAAATAGTATGGAGG - Intronic
1170631400 20:18069583-18069605 CACTGTGGAAAATAGTAGGGAGG - Intergenic
1170760723 20:19248569-19248591 CATTATGGAAAACAGTATGAAGG + Intronic
1170908555 20:20540178-20540200 CATTATGGAAAACAGTATGGAGG - Intronic
1171510506 20:25679725-25679747 CATTATGGAAAATGGTATGGAGG + Intronic
1171814010 20:29767464-29767486 CATTATGAAAATTAGTAAGCAGG - Intergenic
1171933677 20:31253013-31253035 CATTATGGAAAATAGTATGGAGG + Intergenic
1173048326 20:39534289-39534311 CATTATGGAAAACAGTATGGAGG - Intergenic
1173126816 20:40344909-40344931 CATTATGGAAAATAGTATAAAGG + Intergenic
1173449972 20:43155119-43155141 CATTATGAAAAACAGTATGGAGG + Intronic
1174785919 20:53432542-53432564 CACTATGGAAAATAGTATGGAGG - Intronic
1174974154 20:55311933-55311955 CACTATGGAAAACAGTATGAGGG - Intergenic
1176402858 21:6330869-6330891 CATTATAGAAAATAGTATGGAGG - Intergenic
1176434299 21:6658235-6658257 CATTATAGAAAATAGTATGGAGG + Intergenic
1176458561 21:6985305-6985327 CATTATAGAAAATAGTATGGAGG + Intergenic
1177258419 21:18695338-18695360 CATTATGGAAAACAGTAGGCAGG + Intergenic
1177353683 21:19979303-19979325 GATGATGAAAAATAGTAGAATGG + Intergenic
1177376886 21:20281915-20281937 TAATATGAAAAATAGAAGGAGGG + Intergenic
1177432764 21:21012044-21012066 CATTATGGCAAATAGTATGGAGG + Intronic
1177560673 21:22747443-22747465 CACTATGTAAAACAGTATGAAGG - Intergenic
1177767841 21:25478727-25478749 CATTATGAAAAACAGTATGGAGG - Intergenic
1177916684 21:27097309-27097331 CATTATGGAAAACAGTATGGAGG - Intergenic
1178139365 21:29664895-29664917 CTTTATTCAAAATTGTAGGAAGG - Intronic
1178162102 21:29929738-29929760 CATTATGGAAAACAGTATGTAGG + Intronic
1178427205 21:32488370-32488392 CATTATGGAAAAGAGCATGAAGG - Intronic
1178766428 21:35456903-35456925 CATTATGCACAATACTAGTACGG - Intronic
1179263733 21:39783283-39783305 CATTATGGAAAACAGTATGAAGG - Intronic
1180317461 22:11288066-11288088 CATTATGAAAATTAGTACGCAGG - Intergenic
1181848169 22:25729982-25730004 CATTTTGCAAAATAGTTGACAGG + Intergenic
1181912415 22:26249747-26249769 CATTATGGAAAACAGTATCAAGG - Intronic
1182216017 22:28718348-28718370 CATTTTGGAAAATAGTATAAAGG + Intronic
1182909935 22:33974401-33974423 AATTATGCAAAACAGTAGGGAGG + Intergenic
1182983207 22:34692178-34692200 CATTATGGAAAATAGTATAGAGG - Intergenic
1183536964 22:38408185-38408207 CATTATGGAAAACAGTATGGAGG + Intergenic
1184740476 22:46426015-46426037 CATTATTCAAAAAAGAAGGGAGG - Intronic
949144105 3:674260-674282 CATTATGGAAAAGAGTATGGAGG + Intergenic
950826401 3:15827188-15827210 CATTATGGAAAACAGTATGAAGG + Intronic
950850380 3:16056723-16056745 CATGATGCAAAAATGTAGGTAGG - Intergenic
950881309 3:16324893-16324915 CATTATGGAAAATAGTACAGAGG - Intronic
951148687 3:19261168-19261190 CATTATGAAAAACAGTATGGGGG - Intronic
951176126 3:19602454-19602476 CATTATGGAAAACAGTATGGAGG + Intergenic
951418916 3:22460554-22460576 CATTATGGAAAACAGTATGGAGG + Intergenic
951673156 3:25207451-25207473 TATTCTGAATAATAGTAGGAAGG + Intronic
951735998 3:25865096-25865118 CATTATGAAAAACAGTATGGAGG + Intronic
951853817 3:27172029-27172051 CATTATGGAAAACAGTATAAAGG + Intronic
951977713 3:28531776-28531798 CATTATGGAAAACAGTATGGAGG + Intronic
952078941 3:29733435-29733457 CATTATGGAAAACAGTATGAGGG - Intronic
952345261 3:32477804-32477826 CATTATGAAAAACAGTATGGAGG + Intronic
952463375 3:33553773-33553795 CATTATGAAAAATAATATGGAGG + Intronic
952490491 3:33866938-33866960 GATTATGCAAAATAGCATAATGG - Exonic
952566036 3:34659461-34659483 TTTGATGCAAATTAGTAGGAGGG - Intergenic
952605305 3:35140555-35140577 TATTATGGAAAATAGTATGGAGG + Intergenic
952869067 3:37882009-37882031 CATAATGAAAAATATTAGGCCGG + Intronic
953283888 3:41586069-41586091 CATTATGGAAAACAGTATGGAGG + Intronic
953297285 3:41732541-41732563 CATTATGAAAAACAGTATGGGGG + Intronic
953630783 3:44614810-44614832 CATTATGGAAAACAGTGTGAAGG + Intronic
953731732 3:45455564-45455586 CATTATGGAAAACAGTATGGAGG + Intronic
954944341 3:54406116-54406138 CATTATGAAAAACAGTATGGAGG + Intronic
954949278 3:54455165-54455187 CATTATGGAAAACAGTATGGAGG - Intronic
955549727 3:60070824-60070846 CTTTCTTCAAAATAGTTGGATGG + Intronic
955716627 3:61836534-61836556 CATTATGCAAAGTACCCGGAAGG - Intronic
956496711 3:69834743-69834765 CATTTTGGAAAACAGTAGGAAGG - Intronic
956506794 3:69949305-69949327 CATTATGCAATATTTTAAGACGG + Intronic
956517429 3:70064543-70064565 CATTATGCTAGGCAGTAGGAAGG - Intergenic
956912976 3:73839953-73839975 CATTATGGAAAACAGTATGGAGG + Intergenic
957481423 3:80801944-80801966 CATTATGAAAAGCAGTATGAAGG + Intergenic
957498719 3:81025484-81025506 CATTATGAAAAACAGTATGGAGG + Intergenic
958537989 3:95429149-95429171 CATTTTGAAAAATAGTATTATGG - Intergenic
958673929 3:97241702-97241724 CATCATGCAAATTGGTATGAGGG + Intronic
958686200 3:97399505-97399527 CATTATGAAAAATAGTATGGAGG - Intronic
958721808 3:97852746-97852768 CATTATGGAAAACAGTATGGAGG - Intronic
958770515 3:98420853-98420875 CATTATAGAAAACAGTACGAGGG + Intergenic
958792345 3:98666427-98666449 CATTATGAAAAACAATATGAAGG - Intergenic
958881139 3:99671740-99671762 CATTATGGGAAACAGTAAGAAGG + Intronic
959172741 3:102861982-102862004 CATTATGGAAAACAGTAGAGAGG + Intergenic
959241586 3:103802809-103802831 CATTATGAAAAAGAGTATGGAGG + Intergenic
959254951 3:103997757-103997779 CATTATGAAAAATAGTATAGAGG + Intergenic
959407874 3:105983125-105983147 CATTATGGAAAACAGTATGGAGG - Intergenic
959625882 3:108450127-108450149 CATTATGGAAAACAGTATGAAGG + Intronic
959680091 3:109085680-109085702 CATTTTGGAGAATAGTATGAAGG + Intronic
960469594 3:118046159-118046181 CATTATGAAAACTAGTATGGAGG + Intergenic
960471117 3:118066213-118066235 CATTATGGAAAACAGTATGGTGG + Intergenic
960894433 3:122487331-122487353 CACTATGAAAAACAGTAGGGAGG + Intronic
961151886 3:124645872-124645894 CATTTTGGAAAACAGTAGGGAGG - Intronic
961226190 3:125249589-125249611 CATTATGGAAAACAGTATGGAGG + Intronic
961704909 3:128776765-128776787 CATTATGGAAAACAGTATGGAGG - Intronic
962057751 3:131890516-131890538 CATTATGGAAAACAGTATGGCGG + Intronic
962157910 3:132968171-132968193 AATTATGCAAATGAGAAGGAAGG + Intergenic
962288920 3:134113893-134113915 CATTATGAAAAACAGTATGGAGG + Intronic
962291382 3:134139645-134139667 CATTATGGAAAACAGTATGGAGG + Intronic
962306975 3:134296885-134296907 CATTATGGAAAACAGTATGGAGG + Intergenic
962489605 3:135880390-135880412 CATTCTGGAAAATAGTAGAGAGG + Intergenic
962593082 3:136911321-136911343 CATTATGAAAAAGAGTATGGAGG - Intronic
962762919 3:138533640-138533662 CATTTTGAGAAACAGTAGGAAGG + Intronic
962860844 3:139399661-139399683 CATTATGAAAAACAGTATGGAGG + Intergenic
962893593 3:139694188-139694210 CTCTATGCAAAAAAGTAGCATGG + Intergenic
963285220 3:143428506-143428528 CATTATGGAAAATAGTATGAAGG + Intronic
963985976 3:151595186-151595208 CATTATGGAAAACAGTATGGAGG + Intergenic
963996788 3:151718727-151718749 CATTATGGAAAACAGTATGGAGG - Intergenic
964312283 3:155407320-155407342 CATTTTGGAAAATAATATGAAGG + Intronic
964883861 3:161457769-161457791 CATTAGGGAAAACAGTATGAAGG - Intergenic
964911382 3:161785535-161785557 CATTATTGAAAAAAGTATGAAGG - Intergenic
964929381 3:161998028-161998050 CAATATGAAAAATAGTATGGAGG - Intergenic
964998898 3:162926587-162926609 CAATATGAAGAACAGTAGGAAGG + Intergenic
965800571 3:172489369-172489391 CATTATGGAAAACAGTATGGAGG + Intergenic
965911680 3:173785477-173785499 CATTGTACAAGATAGTAGGGTGG + Intronic
966434087 3:179863750-179863772 CATTATGGAAAACAGGACGAGGG + Intronic
966486161 3:180472875-180472897 CATTATGGAAAATAGTATAAAGG + Intergenic
967448313 3:189594161-189594183 CATTATGGAAAACAGTATAAAGG + Intergenic
967454731 3:189671459-189671481 CATTATGGAAAAGAGTATGGAGG + Intronic
967738390 3:192978792-192978814 CACTATGGAGAATAGTATGAAGG + Intergenic
968173888 3:196532277-196532299 CATTATGAAAAACAGTATGGAGG + Intergenic
968256697 3:197280557-197280579 CATTATGGAAAACAGTATGCAGG - Intronic
968879151 4:3290222-3290244 CATTATGGAAAAGAGTATGGAGG - Intergenic
969165814 4:5310608-5310630 CATTATGGAAAACAGTATGGAGG + Intronic
970417485 4:15873774-15873796 CCTTAAACAAAATAGTAAGAAGG - Intergenic
970764298 4:19529006-19529028 CATTATGAAAAACAGTATGGAGG + Intergenic
971101463 4:23470281-23470303 CATTATGGAAAACAGTATGAAGG - Intergenic
971217794 4:24677292-24677314 CATTATGGAAAACAGTATGGAGG - Intergenic
971590769 4:28466666-28466688 CATTATGAAAAACAGTATTACGG + Intergenic
971997034 4:33978089-33978111 CATTATGGAAAACAGTATAAAGG + Intergenic
972091035 4:35283944-35283966 CATTATGGAAAATAGTATGCAGG - Intergenic
972098200 4:35376614-35376636 CATTATGGAAAACAGTATGGTGG + Intergenic
972194283 4:36634247-36634269 AATTATGGAAAACAGTATGAAGG + Intergenic
972218757 4:36928014-36928036 CATTATGGAAAACAGTATGAAGG - Intergenic
972309959 4:37871443-37871465 CATTATGGAAAACAGTATGAAGG + Intergenic
972668592 4:41192210-41192232 CATTATGGAAAACAGTATGGAGG + Intronic
972920634 4:43936938-43936960 CTTTATAAAAAATAGTATGAAGG + Intergenic
973017831 4:45163874-45163896 TATTATGCAAAACAGTATGGGGG - Intergenic
973031231 4:45343086-45343108 CATTGTGCAAAACAGTATGGAGG + Intergenic
973144995 4:46814086-46814108 CATTATGGAAAATAGCATGGAGG + Intronic
973176947 4:47218406-47218428 CATTATGCAAAAAACTATGGAGG - Intronic
973545277 4:51974735-51974757 CATTAAGGAAAATAGTATGGAGG - Intergenic
973586158 4:52393828-52393850 CATTATGGAAAATAGTATGGAGG + Intergenic
973590050 4:52432164-52432186 AATTATGCCAAAGAGGAGGAAGG + Intergenic
973724489 4:53761480-53761502 CATTATGGAAAACAGTAGAGAGG + Intronic
973815958 4:54619219-54619241 GCATAAGCAAAATAGTAGGAAGG + Intergenic
973922408 4:55701369-55701391 CATTATGGAAAATAGTATGGAGG + Intergenic
974086960 4:57271863-57271885 CATTATGAAAAACAGTATGAAGG - Intergenic
974420952 4:61672744-61672766 CATTATGGAAAACAGTATGTAGG + Intronic
974476042 4:62381770-62381792 CATTATGAAAAATGGTATGGAGG + Intergenic
974528932 4:63081619-63081641 CATTATGGAAAACAGTATGAAGG + Intergenic
974544821 4:63288267-63288289 CATTATGAAAAACAGTATGGAGG - Intergenic
974816405 4:67010503-67010525 AATTATGAAAATTAGTAGGAGGG + Intergenic
975599619 4:76085730-76085752 CATTATGGAAAACAGTATGGAGG + Intronic
975758643 4:77596392-77596414 CATTTTGGAAAATAGTATGGAGG + Intronic
975952519 4:79790753-79790775 CATTATGGAAAAGAGTATGGAGG - Intergenic
976138870 4:81968719-81968741 CATTGTGAAAAACAGTATGAAGG + Intronic
976207111 4:82633552-82633574 CATTATGGAAAACAGTATGGAGG - Intronic
976420073 4:84831909-84831931 CATTATGAAAAACAGTATGGAGG + Intronic
976430085 4:84952854-84952876 CATTATGGAAAATAGTATGGAGG + Intronic
976578646 4:86707210-86707232 CATTCTGCACAATACTAGAAAGG + Intronic
976628942 4:87218203-87218225 CATTTTTCAAAATAGCAGGTGGG + Intronic
976869033 4:89768320-89768342 CATTATGGACAATAGTACGGAGG - Intronic
977024965 4:91806391-91806413 CATTATGGAAAACAGTACGGAGG - Intergenic
977274759 4:94962890-94962912 CATTATGGAGAACAGTATGAAGG - Intronic
977829571 4:101574767-101574789 CATTATGAAAAACAGTATGGAGG - Intronic
977921166 4:102644207-102644229 CATTATGCAAAACAGTATGGAGG + Intronic
977942220 4:102871045-102871067 ACTTATGCAAATTAGTAAGAAGG - Intronic
978020973 4:103811179-103811201 CATTTTGAAAAATAGTATGGAGG - Intergenic
978111135 4:104964817-104964839 CATTATGGAAAACAGTATGGAGG - Intergenic
978166036 4:105608136-105608158 CATTATGGAAAATAGTATGGAGG - Intronic
978267218 4:106840711-106840733 CATTAAGAAAAACAGTATGAAGG - Intergenic
978410601 4:108420536-108420558 CATTATGGAAAACAGTATGGAGG + Intergenic
979050463 4:115923807-115923829 CACTATGGAAAATAGTATGGAGG - Intergenic
979429074 4:120604988-120605010 CATTATGGAAAACAGTATGGAGG + Intergenic
979470312 4:121088379-121088401 CATTATGGAAAACAGTATGGAGG + Intergenic
979490236 4:121318237-121318259 CATTTTGGAAAATAGTATGGAGG + Intergenic
979496453 4:121389014-121389036 CATTATAGAAAATAGTATGGTGG + Intergenic
979506068 4:121498546-121498568 CATTATAGAAAATAATATGAAGG - Intergenic
979909046 4:126336806-126336828 CATTTTGGAAAATAGTATAAAGG + Intergenic
980155441 4:129098769-129098791 CATTTTCCAGAAAAGTAGGAAGG + Intronic
980230812 4:130043936-130043958 CACTGTGCAGAATAGAAGGAAGG - Intergenic
980312143 4:131144501-131144523 CATTATGGAAAATTGTATGGAGG + Intergenic
980624122 4:135350102-135350124 CATTTTGGAAAATAGTATGGAGG + Intergenic
980639328 4:135555039-135555061 CATTATACAGAATTGGAGGAAGG - Intergenic
980745486 4:137007594-137007616 CATTATGAAGAATAGCATGAGGG - Intergenic
980771325 4:137377341-137377363 CATTATGCAGATTAGTAAGTGGG + Intergenic
980870407 4:138604982-138605004 CATTATGGAAAACAGTATGGAGG - Intergenic
981521463 4:145666800-145666822 CATTATGCAAAACAGTATGGAGG - Intergenic
981556114 4:145996620-145996642 CATTATGGAAAACAGTAGAGAGG - Intergenic
981683977 4:147432379-147432401 CATTATGGAAAACAGTATGGAGG - Intergenic
981689379 4:147489901-147489923 CATTTTGGGAATTAGTAGGAAGG - Intronic
982318186 4:154052425-154052447 CACTATGAAAAACAGTGGGAAGG - Intergenic
982346219 4:154363134-154363156 CATTATGGAAAACAGTATGGAGG + Intronic
982552814 4:156823658-156823680 CATTGTGCAAAATACTGTGAAGG + Intronic
982751724 4:159169987-159170009 CATTATGGAAAACAGTATGGAGG - Intronic
982797163 4:159660184-159660206 CATTATGGAAAATAGTGTGGAGG - Intergenic
982987223 4:162225686-162225708 CATTATGCAGAACAGTATGGAGG - Intergenic
983023120 4:162703982-162704004 CATGATGGAAAATAGTATGAGGG + Intergenic
983339531 4:166441025-166441047 CATTATGGAAAAGAGTATGGAGG - Intergenic
983440282 4:167773819-167773841 CATTATGAAAAATAGTATGAAGG - Intergenic
983440286 4:167773870-167773892 CATTGTGAAAAACAGTATGAAGG + Intergenic
983508442 4:168581321-168581343 CATTATGGAAAACAGTATGAAGG - Intronic
983666026 4:170184620-170184642 CATTGTACAAAACAGTATGAAGG - Intergenic
983668190 4:170206320-170206342 CATTATGGAAAATGGTATGAGGG + Intergenic
983910475 4:173233305-173233327 CATTATGGAAAACAGTATGGAGG - Intronic
984334281 4:178368898-178368920 CTTTATGAAAAATAGTATGAAGG - Intergenic
984673725 4:182522867-182522889 CGTTATGGAAAACAGTAGGAAGG - Intronic
984889768 4:184481301-184481323 CATTATGGAAAACAGTATGGAGG - Intergenic
985179648 4:187243928-187243950 CATTATGGAAAAGAGTATGGTGG - Intergenic
985218886 4:187681842-187681864 CATTCTGCAAATTAGGAAGAGGG + Intergenic
985232147 4:187830733-187830755 CATTATAGAAAACAGTATGAAGG - Intergenic
985474347 5:70330-70352 CATTATGGAAAATAGTATGGAGG + Intergenic
985969959 5:3367290-3367312 CATTATGAAAAATAGTATGGAGG - Intergenic
986411277 5:7482552-7482574 CATTATGCACAACAGTATGGAGG + Intronic
986547520 5:8914701-8914723 CATTATGGAAAATACTATGGAGG - Intergenic
986652863 5:9981708-9981730 CACTATGGAAAATAGTATGATGG + Intergenic
987240074 5:15987519-15987541 CATTATGGAAAACAGTATGGAGG - Intergenic
987256453 5:16158245-16158267 CATTATGGAAAGCAGTATGATGG + Intronic
987264619 5:16239933-16239955 CATTATGGAAAACAGTAAGGAGG + Intergenic
987565315 5:19576659-19576681 CATTTTGGAAAAAAGTATGAAGG + Intronic
987891469 5:23883657-23883679 CATTATGAAAAACAGTATGGAGG + Intergenic
988315027 5:29614269-29614291 CATTATAGAAAACAGTATGAAGG - Intergenic
988734826 5:34009970-34009992 CATTATGGAAAACAGTATGGAGG + Intronic
988947161 5:36216007-36216029 CATTATGGAAAACAGCATGAAGG - Intronic
989145924 5:38250164-38250186 CCTTATCCAAAAAAGTAGGAGGG - Intergenic
989322510 5:40152994-40153016 CATTATGGAAAACAGTACGGAGG + Intergenic
989359284 5:40581742-40581764 CATTTTGTATAATAGTATGAAGG + Intergenic
989440537 5:41467125-41467147 CATTATGGAAAATTGTATGGAGG - Intronic
989448315 5:41556847-41556869 CATTATGGAAAACAGTACGCAGG - Intergenic
990004340 5:50927808-50927830 CATTATGGAAAATACTATGGAGG + Intergenic
990031352 5:51263082-51263104 CATTATAGAAAACAGTATGAAGG - Intergenic
990118022 5:52413424-52413446 ATTTAAGCAAAACAGTAGGAGGG - Intergenic
990229672 5:53699080-53699102 CATTATGGAAAACAGTATGGAGG + Intergenic
990752397 5:59031151-59031173 CATTATTGAAAATAGTATGAAGG + Intronic
990767556 5:59203408-59203430 CACTATGGAAAACAGTATGAAGG + Intronic
990801040 5:59603567-59603589 CATTATAAAAAATAGTATGGAGG + Intronic
991324170 5:65411358-65411380 CACTATGGAAAACAGTATGAAGG - Intronic
991353101 5:65739583-65739605 CATTATGGAAAACAGTATGGAGG - Intronic
991556977 5:67906453-67906475 CAGTATGGAAAACAATAGGAAGG + Intergenic
992187084 5:74254797-74254819 CATTATGGAAAACAGTATGGAGG + Intergenic
992433120 5:76729078-76729100 CATTACGAAAAACAGTATGAAGG - Intronic
992474690 5:77089718-77089740 CATTATGGAAAACAGTATGGCGG + Intergenic
992932314 5:81661419-81661441 CATTATGGAAAACAGTACGGAGG - Intronic
993182790 5:84576205-84576227 CATTATGGAAAACAGTATGGAGG - Intergenic
993446664 5:88020896-88020918 CATTACGGAAAACAGTATGAAGG + Intergenic
993470069 5:88296492-88296514 CATTATGGAAAACAGTATGGAGG + Intergenic
993599037 5:89897397-89897419 CATTATGGAAAATAGCGTGAAGG + Intergenic
993639902 5:90390006-90390028 CATTAAGCCAAAGAGGAGGAGGG - Intergenic
994048530 5:95336135-95336157 CATGGTGCTAAATAGTAGAAAGG + Intergenic
994071635 5:95609606-95609628 CATTATGGAAAACAGTAAAATGG - Intergenic
994113410 5:96034377-96034399 CATTATGGAAAACAGTATGGAGG + Intergenic
994241338 5:97424941-97424963 CATTATGGAAAAGAGTATGGAGG - Intergenic
994313587 5:98305916-98305938 CATTATGGAAAATGGTATGGAGG + Intergenic
994562946 5:101399889-101399911 CACTATGGAAAACAGTACGATGG - Intergenic
994872723 5:105374131-105374153 CAATATGAAAAACAGTATGAAGG - Intergenic
995167076 5:109056142-109056164 CATTATGGCAAACAGTATGAAGG + Intronic
995186293 5:109275082-109275104 CATTATGGAAAACAGTATGGAGG + Intergenic
996102922 5:119463426-119463448 CATTATGGAAAATAGTATGGAGG - Intronic
996144793 5:119960964-119960986 CATTATGGAAAACAGTATGGAGG + Intergenic
996244470 5:121244156-121244178 CATTATGGAAAATAATATGGAGG + Intergenic
996266374 5:121545969-121545991 CATTATGAAAAATGGTATGGAGG - Intergenic
996577576 5:124993278-124993300 CATTATGAAAAAGAATATGAAGG - Intergenic
996741585 5:126803896-126803918 TTTTATGCAAAATATTAGGGAGG + Intronic
996852972 5:127973283-127973305 CATTATGGAAAACAGTATGGAGG + Intergenic
997794081 5:136790370-136790392 CATTATGGAAAACAGTATGGAGG + Intergenic
997905627 5:137814173-137814195 CATTATGGAAAACAGTATGGAGG - Intergenic
998042792 5:138963690-138963712 AATGATGCAAAATATTTGGATGG - Intronic
998055485 5:139073125-139073147 CATTATGAAAAATAGTATGGAGG + Intronic
998153964 5:139773885-139773907 CAGTATGCAAAATAGTATGGTGG - Intergenic
998668119 5:144322333-144322355 CTTTATACCAAACAGTAGGATGG - Intronic
999219612 5:149963709-149963731 AAATATGCAAAATAGCAGGCCGG - Intronic
999513232 5:152274761-152274783 CATTTTGGAAAACAGTATGAAGG - Intergenic
999714234 5:154346371-154346393 CATTATGGAAAACAGTATGGAGG - Intronic
999739207 5:154536987-154537009 CATTATGGAAAACAGTATGGAGG - Intergenic
999911123 5:156200657-156200679 CATTATGCAAACTAGTATGGAGG + Intronic
1000108644 5:158085569-158085591 CATTATGGAAAACAGTATGGAGG - Intergenic
1000360771 5:160444964-160444986 CATTATGGGAAAGAGTAGGGAGG + Intergenic
1000371799 5:160543754-160543776 CCTTATGGAAAACAGTATGAAGG + Intergenic
1000494419 5:161962321-161962343 GATGATGCAAAAAAGTAAGATGG - Intergenic
1000680340 5:164176221-164176243 CTCTATGCAAAATAGGAAGATGG - Intergenic
1000778476 5:165448850-165448872 CATTATCAAAAACAGTATGAAGG + Intergenic
1001016696 5:168148305-168148327 CATTATGCAAAATTGAAGAGTGG + Intronic
1001850453 5:174959923-174959945 CATTATGGAAAATAGTGTGGAGG - Intergenic
1003281391 6:4695398-4695420 CATTATGGAAAACAGTATGGAGG + Intergenic
1003305514 6:4923632-4923654 CATTATGGAAAAGAGTATGCAGG - Intronic
1003355182 6:5362650-5362672 CATTATGGGAAATAGTATGGAGG - Intronic
1003742604 6:8960177-8960199 AAGTATGCAAAATAGTACAATGG - Intergenic
1004116019 6:12768747-12768769 CATTATGGAAAACAGTATGGAGG - Intronic
1004438182 6:15618074-15618096 CATTATGAAAAATAGTATGGAGG - Intronic
1005254242 6:23982970-23982992 CATTCTCCAAAACAGGAGGATGG - Intergenic
1005261135 6:24062006-24062028 CATTATGGAAAACAGTATGGAGG - Intergenic
1005596797 6:27387275-27387297 CATTATGGAAAACAGTTTGATGG + Intronic
1005769842 6:29057367-29057389 CTTTATGGAAAATAGTAAGGGGG - Intergenic
1006278358 6:33024753-33024775 CATTATGGAAAACAGTATGGAGG - Intergenic
1006555810 6:34865599-34865621 CATTATGGAAAACAGTATGAAGG - Intronic
1006635988 6:35461500-35461522 CAATTTCCAAAAAAGTAGGAGGG - Intronic
1007805465 6:44441529-44441551 CATTATGGAAAACAGTATGGAGG - Intronic
1008119568 6:47596829-47596851 CATTATGGAAAACAGTACAAAGG - Intronic
1008202560 6:48609483-48609505 CATTACGGAAAACAGTACGAGGG + Intergenic
1008733228 6:54508747-54508769 CATTATGGAAAACAGTATGAAGG + Intergenic
1008774651 6:55022982-55023004 CATTATGGAAAACAGTATGGAGG + Intergenic
1008864853 6:56197773-56197795 CATTATGAAAAATAGTATAGAGG + Intronic
1009034047 6:58094825-58094847 CATTATGCACAATAGCCAGAAGG - Intergenic
1009209657 6:60846528-60846550 CATTATGCACAATAGCCAGAAGG - Intergenic
1009315054 6:62208650-62208672 CATTATGGAAAACAGTATGGAGG - Intronic
1009319641 6:62271291-62271313 CATTGTGCTAGATATTAGGATGG - Intronic
1009445702 6:63739657-63739679 CATAAAGTAAAATAGTAGCAAGG - Intronic
1009665940 6:66679919-66679941 CATTTTGGAAAATAATACGAAGG - Intergenic
1009781067 6:68271545-68271567 CATTATGGAAAACAGTATGGAGG + Intergenic
1009907364 6:69886401-69886423 CATTATGGAAAACAGTATGGCGG + Intronic
1010061632 6:71629122-71629144 CATTATGAAAAACAGTATCAAGG - Intergenic
1010466564 6:76173923-76173945 GATTGTGGAAAACAGTAGGAAGG + Intergenic
1010605404 6:77883941-77883963 CATTATGGAAAACAGTATGGAGG - Intronic
1010676209 6:78746767-78746789 CATTATTCATAATAGTCAGAGGG + Intergenic
1011045877 6:83082091-83082113 CATTATGGAAAACAGTAAGGAGG + Intronic
1011061952 6:83279997-83280019 CATGATGCAGAATTGTAGGTTGG - Intronic
1011160434 6:84383267-84383289 CATTATGGAAAACGGTAGGGAGG - Intergenic
1011446685 6:87449075-87449097 CATTATGGAAAATAGTATGAAGG - Intronic
1011523284 6:88234701-88234723 CATTATGGAAAACAGTATGGAGG + Intergenic
1011574137 6:88776106-88776128 CATTATGGAAAACAGTATGGAGG - Intronic
1011602816 6:89075846-89075868 CATTAAGCAAAACAGAAGGCCGG + Intergenic
1012003471 6:93683927-93683949 CATTATGCAAAACAGTATGGAGG - Intergenic
1012214597 6:96566571-96566593 CATTATGGAAAACAGTTTGAAGG - Intronic
1012499274 6:99870780-99870802 AAAGATGCAAAATAGTCGGAAGG - Intergenic
1012578780 6:100837307-100837329 CATTATGAAAAACAGTATGAAGG + Intronic
1012601340 6:101101218-101101240 CATTATGGAAAACAGTGGGGAGG - Intergenic
1012642857 6:101642806-101642828 CATTATGGAAAACAGTATGATGG - Intronic
1012801506 6:103834970-103834992 CATTATGGAAAACAGTATGGAGG - Intergenic
1013047378 6:106500229-106500251 CATTATGGAAAATAGTGTGGAGG - Intergenic
1013131394 6:107236821-107236843 CATTAAGAAAAATAACAGGAGGG - Intronic
1013568429 6:111394209-111394231 CATTATGCAAAACAGTATGGAGG - Intronic
1013694118 6:112681227-112681249 CATTATGTAAAGGAGGAGGATGG - Intergenic
1013702310 6:112787795-112787817 CATTATGGAAAATAGTATGGAGG - Intergenic
1013778135 6:113701514-113701536 CATTAAGAAAAATGGTAGGCCGG - Intergenic
1013936186 6:115597760-115597782 CATTATGCAAATTGAAAGGAAGG - Intergenic
1014207901 6:118676756-118676778 CATTATGGAAAATAATATGGAGG - Intronic
1014257866 6:119181949-119181971 CATTATGGAAAACAGTATGGAGG - Intronic
1014335420 6:120127654-120127676 CATTATGGAAGATAGTATGATGG - Intergenic
1014347493 6:120292642-120292664 CATTATGAAAAATGGTATGGAGG - Intergenic
1014751458 6:125261489-125261511 CATTATGAAAAACAATGGGAGGG + Intronic
1014887535 6:126799799-126799821 CATTATGGAAAACAATATGAAGG + Intergenic
1014965407 6:127741976-127741998 CATTGTGGAAAACAGTATGAAGG + Intronic
1015354881 6:132265998-132266020 CATTTTGAAAAATAGTATGGGGG - Intergenic
1015808625 6:137139285-137139307 CATTATGCAAAATAATACAGAGG + Intergenic
1016444171 6:144116206-144116228 CATTATGAAAAACAGTAGAGAGG - Intergenic
1016491780 6:144612775-144612797 CATTATGTAAAATGGTATGAAGG + Intronic
1017060412 6:150479171-150479193 CATTTTGCAAAATAATAAGTTGG + Intergenic
1017284204 6:152655590-152655612 CATTATGGAAAAAAGTATGGAGG + Intergenic
1017288521 6:152707076-152707098 CATTGTGGAAAATAGTATGAAGG - Intronic
1017370200 6:153696268-153696290 CATTATACAAAATAATATGATGG + Intergenic
1017424935 6:154310459-154310481 CATTTTGGAAAATAGTATGGAGG + Intronic
1017624229 6:156331945-156331967 CAATATGCTCAATAGTAGAATGG - Intergenic
1018210129 6:161473065-161473087 CTTTATGGAAAACAGTACGAAGG + Intronic
1018377331 6:163225630-163225652 CATTATGGAAAACAGTATGGAGG + Intronic
1018555070 6:165040639-165040661 CATTATGGAAAATAGTATGGAGG - Intergenic
1018600695 6:165536867-165536889 CATTATGGAAAACAGTATGGAGG + Intronic
1019090112 6:169522847-169522869 CATAATTCAAAAAAGTAGAAAGG + Intronic
1020527959 7:9288065-9288087 CATTATGGAAAACAGTATGGAGG - Intergenic
1020627948 7:10606189-10606211 CATTATGGAAAACAGTATGGAGG - Intergenic
1020916048 7:14194119-14194141 CATTATGGAAAACAGTATGGAGG + Intronic
1021061961 7:16124132-16124154 CATTATGGAAAACAGTATGGAGG - Intronic
1021538384 7:21730051-21730073 CATTATGGAAAACAGTATGGAGG + Intronic
1021739766 7:23674699-23674721 CATTATGCAAAACAATATGAAGG - Intergenic
1021768505 7:23973497-23973519 CATTATGGAAAACAGTATGAAGG - Intergenic
1022751350 7:33229828-33229850 CATTATGGAAAATAGGATGGAGG - Intronic
1023155221 7:37244296-37244318 AATTATGCAGGAAAGTAGGAAGG + Intronic
1024127325 7:46313061-46313083 CATTATGTAAAACAGTATGGAGG - Intergenic
1024155286 7:46615931-46615953 CATTATGGAAAAAAGTATGGAGG - Intergenic
1024204114 7:47140256-47140278 CATTTTGGAAAATAGTATGGAGG + Intergenic
1024424944 7:49214687-49214709 CATTATGGAAAAAAGTATGGAGG - Intergenic
1024533763 7:50413252-50413274 CATAATGCAAAAAAGGAGAATGG + Intergenic
1024615853 7:51111241-51111263 CATTATGAAAAATAGTATGGGGG - Intronic
1024807324 7:53158650-53158672 CATTTTGGAAAATAGTTTGATGG - Intergenic
1024933048 7:54684724-54684746 CACTATGGAAAATAGTATGGAGG + Intergenic
1025159957 7:56648399-56648421 CATTATGAAAACCAGTATGAAGG + Intergenic
1025726800 7:64071182-64071204 CATTATGAAAACCAGTATGAAGG - Intronic
1026260551 7:68751581-68751603 CATTATGGAAAACAGTATGGAGG - Intergenic
1026364425 7:69633516-69633538 CATTGTGAAAAATAGTATGGAGG - Intronic
1027454342 7:78369452-78369474 TCTCATGCCAAATAGTAGGATGG + Intronic
1027920871 7:84392630-84392652 CATTATGGAAAATTGTATGAAGG - Intronic
1028085453 7:86631389-86631411 CATTATGGAAAATAATATGGAGG - Intergenic
1028105626 7:86874794-86874816 CATTTTGCAAAACAGTATGGAGG + Intergenic
1028177749 7:87677048-87677070 CATTATGGAAAACAGTATGGAGG + Intronic
1028224277 7:88231868-88231890 CACTATGGAAAATAGTATGGAGG + Intergenic
1028288698 7:89038235-89038257 CATTATGGAAAAGAGTATGGAGG - Intronic
1028510176 7:91616284-91616306 CATTTTGGAAAATAGTATGGAGG + Intergenic
1028514870 7:91666358-91666380 CATTATGGAAAATATTATGGAGG + Intergenic
1028945034 7:96570094-96570116 CTTTATGGAAAATAGTATGAAGG - Intronic
1029062134 7:97809599-97809621 CATTATGAAAAATAGTATAGAGG + Intergenic
1030391710 7:108936507-108936529 CATTATGGAAAAGAGTATGGAGG + Intergenic
1030821636 7:114099443-114099465 CATTATGGAAAACAGTATGGAGG + Intronic
1031270064 7:119637036-119637058 CATTATGAAAAACAGTATGGAGG - Intergenic
1031433603 7:121705043-121705065 CATTATGGAGAACAGTATGAAGG + Intergenic
1031495017 7:122435592-122435614 CACTATGAAAAATAGTATGGAGG + Intronic
1031609192 7:123805270-123805292 AATTATGTGAAATAATAGGAGGG - Intergenic
1031623294 7:123962100-123962122 CATTATGAAAAACAGTATGGAGG - Intronic
1031909249 7:127497192-127497214 CATTATGAAAAACGGTATGAAGG + Intergenic
1032112923 7:129092077-129092099 CCTTTTGCAAAATACTAGAAAGG - Intergenic
1032416630 7:131740457-131740479 CATTATGGAAAACAGTATGGAGG - Intergenic
1032574770 7:133041593-133041615 CATTCTGCATAATAGCAGCAAGG + Intronic
1032585029 7:133138504-133138526 CATCATGAAAAACTGTAGGAAGG - Intergenic
1032909268 7:136410832-136410854 AATTATGCAAAAGATTATGAGGG - Intergenic
1033266011 7:139887841-139887863 CACTATGGAAAACAGTATGACGG - Intronic
1033412994 7:141137133-141137155 CATTATGGAAAACAGTATGGAGG + Intronic
1033512697 7:142075854-142075876 CATTATGGAAAATAGAATGGAGG + Intronic
1033638166 7:143232556-143232578 CATTATGGAAAACAGTATGGAGG - Intergenic
1033832162 7:145267791-145267813 CATTATAGAAAACAGTATGAAGG - Intergenic
1034318601 7:150158262-150158284 CATTATGGAAAGTAGTATGGAGG + Intergenic
1034459281 7:151189316-151189338 CATTTTGAAAAATAGAATGAAGG - Intergenic
1034647252 7:152659040-152659062 CATTATGGAAAACAGTATGGAGG - Intronic
1034774150 7:153808966-153808988 CATTATGGAAAGTAGTATGGAGG - Intergenic
1035086218 7:156260680-156260702 CATTATGAAAAACAGTACGGCGG + Intergenic
1035128014 7:156624314-156624336 CATTATGGAAAATAGTATGGAGG + Intergenic
1035835546 8:2748026-2748048 CATTATGGAACATATTATGAAGG + Intergenic
1035913013 8:3589160-3589182 CATTATGGAAAATAGTATAGGGG + Intronic
1036238069 8:7059128-7059150 CATTTTGGAAAATAGTATGGCGG - Intergenic
1036481428 8:9143077-9143099 CATTATGGAAAATAGTAGGGAGG - Intronic
1036582477 8:10088254-10088276 CATTATGGAAAACAGCATGAAGG + Intronic
1036582859 8:10091935-10091957 CATTATGGAAAACAGTATGGAGG - Intronic
1036913425 8:12780218-12780240 CATTATGGAAAACAGTATGGAGG - Intergenic
1037376077 8:18230552-18230574 CACTATGGAAAATAGTATGGAGG + Intergenic
1037383005 8:18308311-18308333 CACTACGGAAAACAGTAGGATGG + Intergenic
1037628104 8:20626136-20626158 CATATTACAAAAAAGTAGGAAGG + Intergenic
1037799059 8:22022108-22022130 CATTATGGAAAGTAGTATGGAGG + Intergenic
1037962929 8:23112887-23112909 CATTATGGAAAACAGTATGGAGG - Intronic
1037968543 8:23153792-23153814 CATTATGGAAAACAGTATGGAGG + Intronic
1038897207 8:31797532-31797554 CATTATGGAAAATAGTAGAGAGG + Intronic
1039149801 8:34491317-34491339 CCTTAAGCAAAATGGTAGAAGGG + Intergenic
1039378819 8:37065439-37065461 CATTATGGAAAATGGTATGAAGG + Intergenic
1039625221 8:39043343-39043365 CACTATGGAAAATAGTACGAAGG - Intronic
1039680145 8:39725921-39725943 CATTATGGAAAACAGTATGACGG - Intronic
1039687961 8:39827305-39827327 CATTATGGAAAATAATAAGGAGG + Intronic
1039964793 8:42276162-42276184 CATTATGGAAAATAGTATGGAGG - Intronic
1040061378 8:43106063-43106085 CATTATGGAAAACAGTATGGAGG - Intronic
1040642931 8:49361470-49361492 CATTATGGAAAACAGTATGGAGG - Intergenic
1040643052 8:49363071-49363093 CATTATGGAAAACAGTATGGAGG - Intergenic
1040733089 8:50473489-50473511 CATTATGAAGAACAGTATGATGG + Intronic
1040742611 8:50597624-50597646 CATTATGGAAAACAGTATGGTGG - Intronic
1040898944 8:52397052-52397074 CATTATGAAAAACAGTATGGAGG - Intronic
1040988260 8:53319899-53319921 CACTATGGAAAACAGTATGAAGG + Intergenic
1041759396 8:61347844-61347866 CATTATGGAAAACAGTAGGTAGG - Intronic
1041817360 8:61989407-61989429 CATTATGGAAAACAGTATGGAGG + Intergenic
1043133564 8:76492304-76492326 CATTATGGAGAACAGTATGAAGG - Intergenic
1043321022 8:78987041-78987063 CATTATGAAAAACAGTATGGAGG + Intergenic
1043371397 8:79597905-79597927 CATTGTGGAAAACAGTATGAAGG + Intergenic
1043427558 8:80163047-80163069 TATTATGGAAAACAGTATGAAGG + Intronic
1043828479 8:84959008-84959030 CATTATGCAAAAATGTATGGAGG + Intergenic
1043840388 8:85095673-85095695 CACTATGGAAAACAGTATGAAGG + Intergenic
1044152471 8:88798648-88798670 CGTTATGGAAAACAGTATGAAGG - Intergenic
1044287274 8:90423673-90423695 CACTATGGAAAATAGTATGGAGG - Intergenic
1044360598 8:91279366-91279388 CATTATGGAAAACAGTATGGAGG - Intronic
1044431712 8:92115244-92115266 CATTAAGGAAAACAGTATGAAGG - Intergenic
1044500089 8:92944276-92944298 CATTATGGAAGAGAGTATGAAGG + Intronic
1044810131 8:96052313-96052335 CATTATGAAAAATAGTATGGAGG + Intergenic
1044826719 8:96205622-96205644 CATTATGGAAAAATGTATGAAGG - Intergenic
1045447559 8:102283066-102283088 CATTATGCATAATAGTGGAAAGG + Intronic
1045455180 8:102371172-102371194 CATTATGGAAAACAGTATGGAGG - Intronic
1045856899 8:106774732-106774754 CATTATGGAAAACAGTATGGAGG - Intergenic
1046076964 8:109324478-109324500 CATTATGGAAAATAGTAAAGAGG + Intronic
1046120892 8:109845381-109845403 CATTATGAAAAAAAGTATGGAGG - Intergenic
1046190017 8:110782403-110782425 CATTATGGAAAACAGTATGGTGG - Intergenic
1046318816 8:112543649-112543671 CACTATGGAAAATATTATGAAGG + Intronic
1047030690 8:120876489-120876511 CATTATGGAAAACTGTACGAAGG - Intergenic
1047081231 8:121463246-121463268 TATTATGGAAAATAGTATGGAGG + Intergenic
1047082888 8:121483205-121483227 CATTATGGAAAATAATATGGAGG + Intergenic
1047090112 8:121565287-121565309 CATTATGAAAAACAGTATGGAGG + Intergenic
1047163013 8:122402740-122402762 CATTTTGAAAAACAGTATGAAGG + Intergenic
1047465766 8:125112317-125112339 CATTATGGAAAACAGTATGGAGG + Intronic
1047525611 8:125631803-125631825 CATGATGGAAATTAGCAGGAAGG + Intergenic
1047553369 8:125901099-125901121 CACTATGGAAAATAGTATGGAGG + Intergenic
1047669795 8:127133206-127133228 CATTTTGGAAAATAGTATGGAGG + Intergenic
1047797010 8:128267869-128267891 CATTATGCAAATGAGCAGCAGGG - Intergenic
1049735106 8:144200665-144200687 AATTTTGCAAAATAGTAAGTAGG - Intronic
1050762923 9:9095674-9095696 CATTATGGAAAACAGTATGGAGG + Intronic
1050777878 9:9290027-9290049 CATCATGGAAAACAGTATGAAGG - Intronic
1051113479 9:13666963-13666985 CATTATGAAAAATAGTGTAAAGG - Intergenic
1051234808 9:14988231-14988253 CATTATGAAAAACAGTATGGAGG + Intergenic
1051766798 9:20533478-20533500 CATTATAGAAAATAGTATGGAGG + Intronic
1051983613 9:23055488-23055510 CATTATGGAAAATAGTATGAAGG + Intergenic
1052072656 9:24101526-24101548 CATTATGGAAAACTGTATGAAGG - Intergenic
1052152925 9:25141784-25141806 CATTATGGAAAACAGTATGGAGG + Intergenic
1052255511 9:26451530-26451552 CACTATGGGAAATAGTATGACGG - Intergenic
1052264559 9:26556810-26556832 CATTATTGAAAACAGTATGATGG - Intergenic
1052454659 9:28680530-28680552 CATTATGGAATACAGTATGATGG - Intergenic
1052528380 9:29650749-29650771 CATTATGAAAAACAGTATGTAGG + Intergenic
1052541110 9:29812458-29812480 CATTATGAAAAACAGTATGGAGG + Intergenic
1052686127 9:31758550-31758572 CATTATGGAAAATAGTATGCAGG - Intergenic
1052717786 9:32138353-32138375 CATTATGAAAAACAGTATGGAGG + Intergenic
1053180837 9:35968373-35968395 TATTATGGAAAAGAGTATGAAGG - Intergenic
1053467821 9:38323967-38323989 CATTATGAAAAACAGTATGGAGG + Intergenic
1053563382 9:39220362-39220384 CATTATGGAAAGCAGTAGGGAGG - Intronic
1054133765 9:61398704-61398726 CATTATGGAAAGCAGTAGGGAGG + Intergenic
1054601392 9:67129164-67129186 CATTATGGAAAGCAGTAGGGAGG + Intergenic
1054748942 9:68884880-68884902 CATTTTGGAAAACAGTAGGGAGG + Intronic
1055022967 9:71689849-71689871 CATTTTGCAAAATGGTGGGAAGG - Intronic
1055802638 9:80056899-80056921 CATTATGGAAAACAGTATGGAGG + Intergenic
1055910764 9:81348188-81348210 CATTATGGAAAACAGTATGGAGG - Intergenic
1056288484 9:85115558-85115580 CATTATGGAAAACAGTATGGAGG - Intergenic
1056349462 9:85734677-85734699 CACTATGAAAAACAGTATGAAGG + Intronic
1056429929 9:86516954-86516976 CATTATGGAAAACAGTATAAAGG - Intergenic
1056435001 9:86567086-86567108 CATTTTGGAAAATAGTATGAAGG - Intergenic
1057475455 9:95397313-95397335 CATTATGAAAAACAGTATGGAGG + Intergenic
1057997933 9:99836779-99836801 CATTATGGAAAACAGTATGGGGG - Intronic
1058113693 9:101059886-101059908 CATTATGGAAAACAGTATGAAGG + Intronic
1058304154 9:103415911-103415933 CATTATGCACAATAGTCAAAAGG - Intergenic
1058352855 9:104047020-104047042 CATTATGGAAAACAGTATGAAGG + Intergenic
1058403150 9:104640356-104640378 CATTATGGAAAACAGTATGAAGG + Intergenic
1058652251 9:107187519-107187541 CATTATGGAAAACAGTATGGTGG + Intergenic
1058728757 9:107829154-107829176 CATTATGAAAAACAGTATGGGGG - Intergenic
1058920941 9:109614163-109614185 CATTATGGAAAAGAGTATGGAGG + Intergenic
1059018232 9:110545336-110545358 CATTATGGAAAACAGTATGGAGG - Intronic
1059235497 9:112757570-112757592 CATTATGGAAAACAGTATGGAGG - Intronic
1059614712 9:115936592-115936614 CATTATGGAAAACAGTATGTAGG + Intergenic
1059641599 9:116222041-116222063 CATCATGGAAAATAGTATGGGGG + Intronic
1059951621 9:119469389-119469411 CATTATGAAAAATAGTATGAAGG - Intergenic
1060326559 9:122621753-122621775 CATTATGGAAAACAGTATGGAGG + Intergenic
1061640035 9:131946318-131946340 CATTATGGAAAATAGTATGGCGG - Intronic
1061751509 9:132780799-132780821 CATTCAGCAAAATGGTAGCAGGG - Intronic
1061979950 9:134096564-134096586 CATTATGGAAAACAGTATGGAGG + Intergenic
1203437237 Un_GL000195v1:150408-150430 CATTATAGAAAATAGTATGGAGG - Intergenic
1203365692 Un_KI270442v1:253783-253805 CATTATGAAAATTAGTATGCAGG - Intergenic
1185985799 X:4831628-4831650 CATTATGAAAAACAGTATGGAGG + Intergenic
1186259278 X:7759036-7759058 CATTATGGAAAACAGTATGGAGG - Intergenic
1186266716 X:7841479-7841501 CATTATGAAAAACAGTATAATGG - Intergenic
1186381014 X:9059065-9059087 CATTATGGAAAACAGTATGGAGG + Intronic
1186458998 X:9733526-9733548 CATTATGAAAAATTGTAAAAAGG + Intronic
1186900315 X:14047944-14047966 CATTATGGAAAACAGTATGGTGG - Intergenic
1187024819 X:15423990-15424012 CATTATGGAAAGCAGTATGAAGG + Intronic
1187633483 X:21201326-21201348 CATTATGGAAAAGAGTATGGAGG + Intergenic
1187771035 X:22696257-22696279 CATTATGGAAAATAGTAAGGAGG + Intergenic
1187780189 X:22812870-22812892 CATTATGGAAAACAGTATGGAGG + Intergenic
1187840473 X:23481935-23481957 CTCTATGGAAAATAGTATGAAGG - Intergenic
1187983599 X:24786240-24786262 CATTATGGAAAACAGTATGGAGG - Intronic
1188248514 X:27862931-27862953 CATTATGGAAAACAGTATGAAGG + Intergenic
1188321912 X:28749332-28749354 CATTATGAAAAACAGTATGAAGG - Intronic
1188429999 X:30095853-30095875 CATTATGGAAAATAGTATGGAGG + Intergenic
1188523560 X:31064698-31064720 CATGATGGAAAACAGTATGAAGG + Intergenic
1188649851 X:32618883-32618905 CATCATGGAAAACAGTATGAAGG + Intronic
1188722279 X:33537768-33537790 AATTATGGAAAACAGTATGAAGG + Intergenic
1188724313 X:33562705-33562727 CATTATGGAAAACAGTATGAAGG - Intergenic
1188724596 X:33566824-33566846 TATTATGAAAAATAGTGTGAAGG - Intergenic
1188826613 X:34842633-34842655 CAATTTGAAAAATAGTAGGGAGG + Intergenic
1188998266 X:36913042-36913064 AATTATGGAAAATAGTATGGAGG + Intergenic
1188999393 X:36926799-36926821 CATTATGGAAAATAGTGTGGCGG + Intergenic
1189157728 X:38775952-38775974 CATTATGGAAAAAAGTATGCTGG - Intergenic
1189799200 X:44676310-44676332 CAGTATGCATAACAGTAGAAAGG - Intergenic
1190459298 X:50655835-50655857 CATTATGGAAAACAGTAGGGGGG - Intronic
1190475149 X:50819877-50819899 CATTATGGAAAACAGTATGGAGG - Intergenic
1190482914 X:50895404-50895426 CATTATGGAAAACAGTATGGAGG + Intergenic
1190485978 X:50925486-50925508 CATTATGGAAAATAGTATGGTGG - Intergenic
1190512542 X:51188348-51188370 CATTATGAAAAACAGTACGACGG + Intergenic
1190863657 X:54366753-54366775 CATTATGGAAAATGGTAGGGAGG + Intergenic
1190905890 X:54727679-54727701 CATTATGGAAAACAGTATGTAGG + Intergenic
1191058431 X:56268373-56268395 CTTTATGGAAAATAGTATGGAGG - Intronic
1191961238 X:66704618-66704640 CATTATGGAAAATAGTATGAAGG + Intergenic
1191970381 X:66808090-66808112 CATTATGAAAGATAGTATGGAGG - Intergenic
1192021264 X:67394245-67394267 CACTATGGAAAATAGTATGGAGG - Intergenic
1192092651 X:68176606-68176628 CACTATGCAACATAGTATGGTGG + Intronic
1192115229 X:68404131-68404153 CATTATGGAAAACAGTATGGTGG + Intronic
1192128324 X:68523558-68523580 CATTTTGCTAAAGACTAGGAAGG + Intronic
1192399629 X:70821840-70821862 CATTATGCAAAATAGTAGGAAGG + Intronic
1192637846 X:72836662-72836684 CATTATGGAAAACAGTGTGAAGG + Intronic
1192643868 X:72884153-72884175 CATTATGGAAAACAGTGTGAAGG - Intronic
1192725240 X:73743654-73743676 CATTATGGAAAAAAGTATGGAGG - Intergenic
1192744408 X:73924694-73924716 CATTATGGAAAACAGTATGGAGG - Intergenic
1192789052 X:74363002-74363024 CATTATGAAAAACAGTACGGAGG + Intergenic
1193178606 X:78425909-78425931 CATTATGGAAAGTAGTATGGAGG + Intergenic
1193375110 X:80750645-80750667 CATTTTGGAAAATAGTATGGAGG + Intronic
1193442076 X:81554613-81554635 CATTATGAAAAACAGTATGGGGG - Intergenic
1193577597 X:83221064-83221086 TGTTATGGAAAATAGTATGAAGG + Intergenic
1193618517 X:83720804-83720826 CATTATGAAAAACAGTATGCAGG - Intergenic
1193806355 X:86000426-86000448 CATTATGGAAAACAGTATGGAGG + Intronic
1193869361 X:86778208-86778230 CATTATGGAAAACAGTATGGAGG - Intronic
1193894229 X:87092056-87092078 CATTATGGAAAACAGTATGGGGG - Intergenic
1194015891 X:88620462-88620484 CATTATGGAAAACAGTATGAAGG + Intergenic
1194178638 X:90685699-90685721 CATTATGGAAAACAGTATGGAGG - Intergenic
1194477410 X:94375798-94375820 CATTATAGAAAATAGTATGAAGG + Intergenic
1194616834 X:96114766-96114788 CATTATGGAGAATAGTATGGAGG + Intergenic
1194747486 X:97644420-97644442 CATTATGGAAAATAGTATGGAGG - Intergenic
1194897608 X:99464522-99464544 CATTATGTAAAACAGTATGGAGG - Intergenic
1195031514 X:100931281-100931303 CATTTTGGAACAAAGTAGGAAGG - Intergenic
1195072669 X:101295615-101295637 CATTATGGAAAACAGTATGGAGG + Intergenic
1195169699 X:102254443-102254465 CATTATGGAAAACAGTATGGAGG - Intergenic
1195189158 X:102432657-102432679 CATTATGGAAAACAGTATGGAGG + Intronic
1195407310 X:104529469-104529491 CATTATGGAAAACAGTATGGAGG + Intergenic
1195538000 X:106030838-106030860 CATTATGGAAAACAGTATGGAGG - Intergenic
1195612168 X:106880113-106880135 CATTATGGAAAACAGTGGGGAGG + Intronic
1195767520 X:108312114-108312136 CATTAAACAAAAAAGTTGGATGG - Intronic
1195791128 X:108587689-108587711 CATTATGAAAAAAAGTATGGAGG - Intronic
1195848355 X:109254199-109254221 GAGCATGCAAAATAGTATGAGGG - Intergenic
1196066464 X:111469896-111469918 CATAATGGAAAATAGTAAAAAGG + Intergenic
1196119357 X:112032318-112032340 CATTATGGACAACAGTATGAAGG + Intronic
1196126503 X:112106592-112106614 CATTATGGAAAACAGTATGGAGG - Intergenic
1196164485 X:112523328-112523350 CTATATGTAAAATAGTAGAATGG - Intergenic
1196302302 X:114061289-114061311 CATTATGGAAAAAAGTATGGAGG - Intergenic
1196487190 X:116225805-116225827 CATTATGGAAAACAGTATGGAGG + Intergenic
1196620690 X:117820260-117820282 CATTATGGAAAACAGTACGGAGG + Intergenic
1196622910 X:117844171-117844193 CATTATGGAAAACAGTATGGAGG + Intergenic
1196727157 X:118906113-118906135 CATTATGGAAAATAGTATGAAGG - Intergenic
1196793529 X:119484855-119484877 CATTATGGAAAATGGTATGAAGG - Intergenic
1197085055 X:122462669-122462691 CATTATGAAAAACAGTATGGGGG - Intergenic
1197122860 X:122912885-122912907 CATTATGGAAAACAGTACGGAGG + Intergenic
1197164742 X:123364540-123364562 CATTATGGAAAACAGTATGGAGG + Intronic
1197180272 X:123527944-123527966 CATTATGGAAAACAGTATGGAGG - Intergenic
1197213500 X:123847314-123847336 CATTATGGAAAGCAGTATGAAGG + Intergenic
1197348726 X:125357049-125357071 CATTATGAAAAACAGTATGAAGG + Intergenic
1197436935 X:126441241-126441263 CATTATGAAAAACAGTATGGAGG - Intergenic
1197448107 X:126577832-126577854 CATTATGGAAAACAGTATGAAGG - Intergenic
1197451706 X:126628034-126628056 CATTATGGAAAACAGTATGAAGG - Intergenic
1197651762 X:129072917-129072939 CATGAGGCAAAATAGAAGCAGGG + Intergenic
1197847656 X:130820382-130820404 CATTATGGAAAAGAGTATGGAGG + Intronic
1197950674 X:131892731-131892753 CATTATGGAAAACAGTATGGAGG + Intergenic
1198007495 X:132511876-132511898 CATTATGAAAAATAGTATGGAGG + Intergenic
1198145279 X:133850034-133850056 TATTATGCAAAATATTATGATGG + Intronic
1198152896 X:133928504-133928526 CATTATGGAAAACAGTATGGAGG - Intronic
1198164707 X:134043372-134043394 CATTATGAAAAACAGTATGGAGG - Intergenic
1198192288 X:134320139-134320161 CATTATGGAAAACAGTATGGAGG + Intergenic
1198543227 X:137662685-137662707 CATTATGGAAAATAGTATGAAGG - Intergenic
1198654179 X:138895578-138895600 CATAATGAAAAATAGTATGGAGG + Intronic
1198940225 X:141946501-141946523 CATTATGGAAAACAGTATGGAGG - Intergenic
1199134961 X:144238249-144238271 CATTATACAAAAGGGGAGGAGGG + Intergenic
1199334557 X:146603181-146603203 CATTATGGAAAATACTATGGAGG - Intergenic
1200273315 X:154708780-154708802 CATTATGGAAAACAGTATGGAGG + Intronic
1200307677 X:155044780-155044802 CATTATGGAAAACAGTATGGAGG + Intronic
1200354063 X:155529417-155529439 AATTATGGAAAACAGTATGAAGG - Intronic
1200525302 Y:4267861-4267883 CATTATGGAAAACAGTATGGAGG - Intergenic
1201948089 Y:19534189-19534211 CATTATGAAAAACAGTATGGAGG + Intergenic
1202051590 Y:20786845-20786867 CATTATGGAAAACAGTATGGAGG - Intergenic
1202093306 Y:21216926-21216948 CATTATGGAGAATAGTATGGAGG - Intergenic
1202299424 Y:23395890-23395912 CATTATGGAAAACAGTATGGAGG + Intergenic
1202571385 Y:26274708-26274730 CATTATGGAAAACAGTATGGAGG - Intergenic