ID: 1192408697

View in Genome Browser
Species Human (GRCh38)
Location X:70912980-70913002
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192408694_1192408697 3 Left 1192408694 X:70912954-70912976 CCTAGTTGGCAAGATCTAAATAT No data
Right 1192408697 X:70912980-70913002 CTGGAAACCCAAATCAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192408697 Original CRISPR CTGGAAACCCAAATCAAAAA GGG Intergenic
No off target data available for this crispr