ID: 1192418124

View in Genome Browser
Species Human (GRCh38)
Location X:71002753-71002775
Sequence CTTTATAAGCAGCATGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192418123_1192418124 -6 Left 1192418123 X:71002736-71002758 CCTAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG No data
1192418121_1192418124 7 Left 1192418121 X:71002723-71002745 CCTTTATAAATTACCTAGTCTCA 0: 118
1: 2195
2: 3406
3: 4091
4: 3278
Right 1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG No data
1192418120_1192418124 22 Left 1192418120 X:71002708-71002730 CCATTAAACTTTTTTCCTTTATA No data
Right 1192418124 X:71002753-71002775 CTTTATAAGCAGCATGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192418124 Original CRISPR CTTTATAAGCAGCATGAGAA CGG Intergenic
No off target data available for this crispr