ID: 1192419837

View in Genome Browser
Species Human (GRCh38)
Location X:71019902-71019924
Sequence GAAAATGAACAGCCTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192419837_1192419840 11 Left 1192419837 X:71019902-71019924 CCCAGCTGAGGCTGTTCATTTTC No data
Right 1192419840 X:71019936-71019958 TCTCCCCATAAGTCAAGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192419837 Original CRISPR GAAAATGAACAGCCTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr