ID: 1192420257

View in Genome Browser
Species Human (GRCh38)
Location X:71023026-71023048
Sequence CAGAAGGACAGGAGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192420246_1192420257 18 Left 1192420246 X:71022985-71023007 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG No data
1192420247_1192420257 8 Left 1192420247 X:71022995-71023017 CCAGCCTGGGCAACAGAATGAGA 0: 1607
1: 27454
2: 84338
3: 178637
4: 234008
Right 1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG No data
1192420248_1192420257 4 Left 1192420248 X:71022999-71023021 CCTGGGCAACAGAATGAGACCCT 0: 480
1: 6212
2: 28216
3: 80388
4: 160520
Right 1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192420257 Original CRISPR CAGAAGGACAGGAGGGGAGG AGG Intergenic
No off target data available for this crispr