ID: 1192424088

View in Genome Browser
Species Human (GRCh38)
Location X:71060307-71060329
Sequence TGGGAGCCACAAAGGGAGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 542}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192424078_1192424088 22 Left 1192424078 X:71060262-71060284 CCCATACTGACTCACCAGCTGAT 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG 0: 1
1: 0
2: 3
3: 50
4: 542
1192424079_1192424088 21 Left 1192424079 X:71060263-71060285 CCATACTGACTCACCAGCTGATG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG 0: 1
1: 0
2: 3
3: 50
4: 542
1192424081_1192424088 8 Left 1192424081 X:71060276-71060298 CCAGCTGATGAGCAAAAATAGGC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG 0: 1
1: 0
2: 3
3: 50
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192424088 Original CRISPR TGGGAGCCACAAAGGGAGAG GGG Exonic
900034357 1:394550-394572 AGGGAGGCAGAAAGGGAGGGAGG + Intergenic
900055191 1:624442-624464 AGGGAGGCAGAAAGGGAGGGAGG + Intergenic
901142892 1:7046637-7046659 TGGGAGAGACAGTGGGAGAGAGG + Intronic
901150778 1:7099795-7099817 TGGGAGCCAAGCAGGGCGAGGGG + Intronic
901560443 1:10066088-10066110 AGGGAGGTACAAAGGGAGGGAGG - Intronic
901895813 1:12310916-12310938 TGGGAGGGAGAGAGGGAGAGAGG - Intronic
902459370 1:16561295-16561317 TGGGAGCCACACAAGGGCAGAGG + Intergenic
902670175 1:17967766-17967788 TGGGAGGGAGAGAGGGAGAGGGG + Intergenic
902698777 1:18157575-18157597 TGGGAGGCAGAAAGTCAGAGCGG - Intronic
902776876 1:18680481-18680503 TGGGAGACAGAAAGGAGGAGGGG - Intronic
903021920 1:20400696-20400718 TGGGTGGCACAAAGGGAATGTGG + Intergenic
903058992 1:20656306-20656328 TGGGGGCCACAATGAGGGAGAGG + Intronic
903152565 1:21421976-21421998 TGGGAGCCACACAAGGGCAGAGG + Intergenic
903160564 1:21486009-21486031 TGGGAGCCACACAAGGGCAGAGG - Intergenic
903970699 1:27117082-27117104 TGGGTGCCAGGAAGAGAGAGAGG - Intronic
904092818 1:27957024-27957046 TAAGAGGCACAAGGGGAGAGTGG + Intronic
904266595 1:29321889-29321911 TGGGAGCTCCAAAGGGAAACAGG - Intronic
904315362 1:29656540-29656562 TGGGAGGAAAAAAGGGAGGGAGG - Intergenic
904895557 1:33814857-33814879 TGGGAGCCAGAAGGCTAGAGGGG - Intronic
905475704 1:38226248-38226270 TGGAAATCACTAAGGGAGAGAGG - Intergenic
905952539 1:41964297-41964319 TGGGAGCCACACGGGGAAAGGGG + Intronic
906645868 1:47474511-47474533 TGGGAAACACACAGGGAGATAGG + Intergenic
906682486 1:47738846-47738868 TGGGAGCGAGGAAGGGAGAGAGG + Intergenic
910058673 1:83062607-83062629 TGGGACCCACAAGGCCAGAGAGG - Intergenic
912421610 1:109545903-109545925 TGGGACCCACACAGGGCGTGTGG + Exonic
913254432 1:116941061-116941083 GTGGAAGCACAAAGGGAGAGAGG - Intronic
914218561 1:145656410-145656432 TGGGAGCCGCACAGGGCAAGGGG - Intronic
914471120 1:147979101-147979123 TGGGAGCCGCACAGGGCAAGGGG - Intronic
914845937 1:151283384-151283406 GGGGAACCACAGAGGGAAAGGGG + Intronic
915121066 1:153629780-153629802 TGGGTGGCAGAAGGGGAGAGAGG - Intronic
915195562 1:154186607-154186629 AGGGAGAAACAAAGGGAAAGAGG - Intronic
915669203 1:157473429-157473451 AGGGAGCAAAAGAGGGAGAGAGG + Intergenic
915765453 1:158357625-158357647 GGTGAGAGACAAAGGGAGAGAGG - Intergenic
916712384 1:167423283-167423305 TAGGACACAGAAAGGGAGAGAGG + Exonic
916873971 1:168948751-168948773 TGGGAGCCAAATAGGGTGACTGG - Intergenic
917682828 1:177385057-177385079 TGGAAGCCACACAGGGTAAGGGG - Intergenic
918284377 1:183037650-183037672 AGGGAGGCAGAAAGAGAGAGAGG - Intronic
919431375 1:197496640-197496662 AGGGAGCAAGAAAGGAAGAGGGG + Intergenic
919954553 1:202399992-202400014 AGGGAGAGAGAAAGGGAGAGGGG - Intronic
920313302 1:205061115-205061137 TGGGAGGAACAGAGGGAGAGAGG - Intronic
920835883 1:209510293-209510315 CGGGAGCAAGAAAGAGAGAGTGG - Intergenic
921397971 1:214689081-214689103 TGAACGCCACAAAGGGAAAGGGG - Intergenic
921695142 1:218200691-218200713 TGGGAGGCACATAGGCAGAGCGG + Intergenic
921945527 1:220883638-220883660 TGGGAAGCAGAAAGGGAAAGGGG - Intronic
922256716 1:223898763-223898785 AGGGAGGCAGAAAGGGAGGGAGG + Intergenic
923008120 1:230067737-230067759 TGGGAAACACAAAGGGGGTGGGG + Intronic
923063754 1:230499662-230499684 TGGGAGGAACACGGGGAGAGTGG + Intergenic
924479471 1:244414889-244414911 TGGGAGCCACAGAGCTAGGGTGG - Intronic
1063209995 10:3871695-3871717 TGGGAGACAGAGAGAGAGAGAGG - Intergenic
1063321474 10:5056253-5056275 TGGGATCCTCAAAGGCAAAGAGG + Intronic
1063476843 10:6336304-6336326 AGGGAGGCAAAAAGGGAGGGAGG - Intergenic
1063717817 10:8545987-8546009 TGGTAGCCACATAGGTGGAGAGG - Intergenic
1063754991 10:8997592-8997614 TGGGAGGGAGGAAGGGAGAGGGG - Intergenic
1064505922 10:16029753-16029775 AGGGAGCTAGAAAGAGAGAGAGG + Intergenic
1064974764 10:21101958-21101980 TAGAAGCCACAAAGGTAGACAGG + Intronic
1065082654 10:22142777-22142799 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1065450168 10:25848456-25848478 AGGGAGGAAGAAAGGGAGAGTGG + Intergenic
1065789699 10:29249639-29249661 TGGGACCCATCAATGGAGAGGGG - Intergenic
1069109269 10:64425059-64425081 TGGGATACACACAGAGAGAGAGG - Intergenic
1069627246 10:69875878-69875900 TAGGAGTCACATGGGGAGAGTGG - Intronic
1070029982 10:72667625-72667647 TGGGAAGCATAAAGGGTGAGTGG - Intergenic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1071362674 10:84866074-84866096 TGAGAGCCACACCGGGAGAGTGG - Intergenic
1071467026 10:85950749-85950771 TGGGAGCCACAGAGGATGAAGGG - Intronic
1073176910 10:101562264-101562286 TGGGAGCCACAAAGGAAGGGGGG + Intergenic
1073596281 10:104803646-104803668 AGATAGCCAGAAAGGGAGAGTGG - Intronic
1073716529 10:106114573-106114595 TGAGATCCACAGAGGGAAAGGGG + Intergenic
1073827055 10:107336459-107336481 TGGGACCCACAGGGAGAGAGAGG - Intergenic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1074545235 10:114397235-114397257 CGTGAGCCACAAAGGGCGTGAGG - Intronic
1074757804 10:116638917-116638939 TGGGAACTCCAAAAGGAGAGAGG - Intronic
1075103108 10:119519636-119519658 TGGGAGACAGACAGGGAGACAGG - Intronic
1075416134 10:122265738-122265760 TAGGAGGCAGAAAGGGTGAGGGG + Intergenic
1075622262 10:123936724-123936746 AGTGAGAGACAAAGGGAGAGTGG - Intronic
1076006232 10:126949836-126949858 GGGGAGCACCAAAGGGAGAGTGG + Intronic
1076980709 11:203203-203225 AGGATTCCACAAAGGGAGAGTGG - Exonic
1077140201 11:1020877-1020899 TGGGAAGGAGAAAGGGAGAGAGG - Intronic
1077854990 11:6115584-6115606 TGGGAGCCACACAGGGCAGGGGG + Intergenic
1077902741 11:6502891-6502913 TGGGAGCCACATTGAGATAGAGG - Exonic
1078085399 11:8230607-8230629 TGGGAGCCCCAAACCTAGAGGGG - Intronic
1078461110 11:11515891-11515913 TGGGTCCCTCAACGGGAGAGAGG + Intronic
1079590478 11:22177208-22177230 TGAGAGATACTAAGGGAGAGAGG + Intergenic
1079730980 11:23937604-23937626 TGGGATCCTCAAAGGCAAAGAGG + Intergenic
1079749703 11:24181819-24181841 TGGAAGCCACAACAGAAGAGAGG - Intergenic
1081286389 11:41275071-41275093 AGGGAGCAAGATAGGGAGAGAGG - Intronic
1081421668 11:42878944-42878966 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1081550387 11:44106324-44106346 TAGGAGAGACAAAGGGAGGGAGG - Intronic
1081557165 11:44175479-44175501 TAGCAGCCACAAAGGCACAGAGG - Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1084671149 11:70607360-70607382 GGGCAGGCACATAGGGAGAGAGG - Intronic
1084947072 11:72643882-72643904 AGGGAGCCACTGAGGGTGAGTGG - Intronic
1085645396 11:78219184-78219206 TGGGAGGAAGAACGGGAGAGGGG + Exonic
1087195356 11:95299484-95299506 TGGGCCCCATAAAGGGAGGGCGG + Intergenic
1087203239 11:95367142-95367164 TGGGAGCAAGAAACAGAGAGTGG + Intergenic
1087327122 11:96738185-96738207 GGGTAGCCCCTAAGGGAGAGGGG - Intergenic
1087379313 11:97384804-97384826 TGAGAGCCCCAAAGGGAAATGGG - Intergenic
1088065236 11:105709700-105709722 TGGGAGGCAGACAGGAAGAGAGG + Intronic
1088136507 11:106562084-106562106 TGGGAGCAAGAGAGAGAGAGAGG - Intergenic
1088226534 11:107626509-107626531 AGGGAGGAACAGAGGGAGAGAGG - Intronic
1088347198 11:108840277-108840299 TGGTGGCCACAGAGTGAGAGAGG + Intronic
1088366258 11:109043009-109043031 TGAGAACTTCAAAGGGAGAGAGG + Intergenic
1089214464 11:116827393-116827415 GGGGAGCCATGATGGGAGAGAGG + Intergenic
1089309613 11:117549048-117549070 TTGGAGCCACACAGGGACACAGG - Intronic
1090419230 11:126562584-126562606 TAGGAGACACAAAGGGAGAAGGG + Intronic
1090937711 11:131359743-131359765 TGGGAGCAAGAGAGGGAGAAGGG + Intergenic
1091635257 12:2192289-2192311 TGGGAGCAGCAAAGTGGGAGAGG - Intronic
1092238721 12:6824908-6824930 TGGGGGCCACAAATGGAGTGGGG - Intronic
1092467250 12:8744194-8744216 TGTGAGCCAAAAAGGCAAAGTGG - Intronic
1092519529 12:9253663-9253685 CGGAGGGCACAAAGGGAGAGGGG + Intergenic
1093345485 12:18035255-18035277 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1093551300 12:20415197-20415219 TGAGAGCCAAAAAAGGAGCGTGG - Intronic
1094049186 12:26200144-26200166 TGGGAGCAATGGAGGGAGAGTGG - Intronic
1094176392 12:27546107-27546129 TGGGAGTCACAAAGGGAGGAGGG + Intronic
1095285890 12:40409676-40409698 TGTGATCCAGAAAGGGAGACTGG + Intronic
1096416690 12:51420720-51420742 AGGAAGCCACAAAGAAAGAGTGG + Intronic
1097191294 12:57220785-57220807 TGGAAGACTCAAAGGGAGACTGG - Intronic
1097455608 12:59795738-59795760 TGAGAGCCACACAGGGCAAGGGG + Intergenic
1100091416 12:90976619-90976641 TGGGAGACAAAAAGAGAGGGAGG - Intronic
1100263733 12:92956429-92956451 AGGGAGAAAGAAAGGGAGAGAGG + Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1101503191 12:105323218-105323240 AGGGAGAAACAAAGGAAGAGAGG - Intronic
1101529386 12:105560237-105560259 TGGAAGCTACGAAGGTAGAGAGG - Intergenic
1102187024 12:110957037-110957059 TGGAATCCACAGAGGGAAAGCGG + Intergenic
1102855349 12:116288723-116288745 TGAGAGCAACAAAGGGACCGTGG - Intergenic
1104889067 12:132131220-132131242 TGGGAGCCAAAAAGGCCGAAGGG + Intronic
1105819728 13:24069580-24069602 GGGCATCCACATAGGGAGAGAGG - Intronic
1106577899 13:30992907-30992929 TGGGAGGCAGAAATGGAAAGAGG + Intergenic
1106653876 13:31721304-31721326 TCTGAGCCAGAACGGGAGAGAGG - Intergenic
1107628127 13:42311524-42311546 TTGGAGGCACAAAGAGGGAGGGG + Intronic
1109033409 13:57223451-57223473 GGGGATCCAAAAAGGGTGAGGGG + Intergenic
1109033466 13:57224254-57224276 AGGGAGTAAGAAAGGGAGAGAGG + Intergenic
1110299900 13:73914251-73914273 AGTGAGCCACATAGGGAGAGTGG - Intronic
1111452590 13:88438657-88438679 TGGGAGGAAAAAAGGGAGGGAGG + Intergenic
1112519371 13:100082247-100082269 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1112538623 13:100284766-100284788 TGGGATCCTCAAAGGCAAAGAGG - Intronic
1112769893 13:102783540-102783562 AGGGAGCAACACAGAGAGAGGGG + Intergenic
1113236389 13:108279806-108279828 TGGGAGGGACACAGAGAGAGAGG - Intronic
1115443836 14:33466680-33466702 TGGAAGGCAAAGAGGGAGAGAGG + Intronic
1115907508 14:38216811-38216833 TGGGAGCTAAAAAGGGAAAAGGG - Intergenic
1115960970 14:38836073-38836095 GGGGAGCCCCACAGGGAGACTGG - Intergenic
1116774522 14:49165033-49165055 TGGGAGCAACAGAGGGACAGAGG + Intergenic
1117308379 14:54498315-54498337 AGGGTGCCAGAGAGGGAGAGAGG + Intergenic
1118333033 14:64828464-64828486 TGGGAACCATTAAAGGAGAGGGG + Intronic
1119203537 14:72776994-72777016 TTGGGGCCACACAGGGGGAGTGG - Intronic
1119705061 14:76778165-76778187 TGGGAGCGAAAAAGAGAGAAGGG - Intronic
1119738809 14:77000580-77000602 AGGGAGCCAGGAAGGGAGGGAGG - Intergenic
1120260515 14:82178704-82178726 TGGGAAGCCTAAAGGGAGAGTGG - Intergenic
1120292789 14:82597902-82597924 TGGGAGGAAGAAAGAGAGAGAGG + Intergenic
1120394810 14:83955514-83955536 CGGGAGGCACATAGGAAGAGAGG - Intergenic
1120500556 14:85291987-85292009 AGAGAGCAAGAAAGGGAGAGAGG + Intergenic
1121124757 14:91399030-91399052 TGGGAGGACCAGAGGGAGAGTGG - Intronic
1122054138 14:99081060-99081082 GGGGAGAGAAAAAGGGAGAGAGG - Intergenic
1122247961 14:100417518-100417540 GGGGAGCCACCAGGGAAGAGTGG - Intronic
1123102143 14:105811479-105811501 GGGGAGCCAGAATGGCAGAGGGG - Intergenic
1202923403 14_KI270724v1_random:4199-4221 AGGGAGGAACAGAGGGAGAGAGG - Intergenic
1123942341 15:25222652-25222674 TGAAAGACACAAAGGGAGAATGG - Intergenic
1123987174 15:25656243-25656265 TGGGAACTTCAAGGGGAGAGGGG + Intergenic
1125333720 15:38606860-38606882 AGGGAGGCAGAAAGTGAGAGTGG + Intergenic
1125793835 15:42389839-42389861 TGGGACAGACAAAGGGAGAGAGG - Intronic
1126869959 15:52977154-52977176 AAGGAGCCAGAAAGGGAAAGTGG + Intergenic
1127369278 15:58322100-58322122 TGGGGGCCACACAGGAAGAAGGG + Intronic
1128082247 15:64863628-64863650 TGAGAGCAACAAAGGGAGATGGG + Intronic
1128524560 15:68403456-68403478 TGGGAGCAAGAAAGAGAGGGGGG - Intronic
1128767605 15:70260718-70260740 TGGGAACGAGAAAGAGAGAGAGG + Intergenic
1128856632 15:71023592-71023614 TGAGAGCCACACAGGGCAAGGGG + Intronic
1129781033 15:78271370-78271392 GGAGGGCCACAAAGGGAGGGTGG - Intronic
1130138140 15:81198654-81198676 TGGGAACCAGAAAGGGGGAGGGG - Intronic
1131595203 15:93791545-93791567 TGAGAGCCAGAAATGAAGAGTGG - Intergenic
1132025942 15:98404438-98404460 TGGGGACCACAAATGAAGAGAGG + Intergenic
1132866189 16:2093803-2093825 TGGGAGCCACTGAAGGTGAGGGG - Exonic
1132935830 16:2480549-2480571 TGGGTGCCACACACCGAGAGAGG + Intronic
1133102585 16:3488235-3488257 TGGGGGGCAGAAAGGGAGTGTGG + Intergenic
1133270296 16:4608076-4608098 TGGGAGCCAGGAAGGGTCAGTGG + Intergenic
1133377424 16:5298805-5298827 TGGGAGAAACAAAGGAAAAGAGG + Intergenic
1135158583 16:20074076-20074098 TGGGAGCCCCGAAGGAAGACCGG + Intergenic
1135175283 16:20222248-20222270 ACTGAGCCACAAAGTGAGAGGGG + Intergenic
1135485837 16:22863844-22863866 TGGGAACCACAAAGGATGAAGGG - Intronic
1136628217 16:31474473-31474495 GGGGAGCCACAAATGGACACTGG - Intronic
1136628524 16:31476333-31476355 TGGGGGTCAGAAAGGAAGAGTGG - Intronic
1136662019 16:31771613-31771635 TGGGAACCACACAGGGCAAGGGG + Intronic
1136939656 16:34510891-34510913 AGGGAGCGAGAAAGGAAGAGAGG - Intergenic
1136960164 16:34837669-34837691 AGGGAGCGAGAAAGGAAGAGAGG + Intergenic
1137707715 16:50547529-50547551 TGAGAGCCACAAAGGTGGGGTGG + Intergenic
1138041935 16:53680771-53680793 TGGGAGTAAGGAAGGGAGAGAGG + Intronic
1138394401 16:56692774-56692796 AGGGAGCCACAAAGGGTTAAGGG + Intronic
1138578981 16:57927310-57927332 TGGGAGCCAAAAAGCCACAGAGG - Intronic
1138625433 16:58248047-58248069 TGGAAGCCAAAAATGGACAGTGG - Intronic
1138882408 16:61031605-61031627 TGGTAGCCACAAGGGGAATGGGG - Intergenic
1139410615 16:66756699-66756721 TGGCAGCCACAATGGAAAAGTGG - Intronic
1139476363 16:67204462-67204484 TGAGAGGCATGAAGGGAGAGAGG + Intergenic
1139599397 16:67977474-67977496 AGGGACCCACAAACGCAGAGAGG - Intronic
1140044380 16:71431023-71431045 AGGGAGCCAGAAAAGGAAAGGGG + Intergenic
1140297712 16:73725477-73725499 TGAGAGCCCCAAAGAGACAGGGG + Intergenic
1140923192 16:79558312-79558334 AGGGAGGCAAAGAGGGAGAGAGG + Intergenic
1141124244 16:81388721-81388743 TGCGAGCTGCAAAGGGACAGAGG - Exonic
1141289672 16:82706154-82706176 AGGGAGCGAAAAAGGGAGAAGGG - Intronic
1141566741 16:84907448-84907470 TGGGAGCCACAACGGGTAGGGGG - Exonic
1142207875 16:88792556-88792578 TGGGAGCAACAAAGGGAGAAAGG + Intergenic
1142248690 16:88981244-88981266 GGTGAGCCACAGAGGGAGTGGGG + Intergenic
1142477013 17:194530-194552 TGGGAGCCGCACAGGCAGGGAGG - Intergenic
1142916456 17:3142993-3143015 TGGGAGCCACACAGGGCAAGGGG - Intergenic
1143252034 17:5530484-5530506 GGAGAGCCACAAAGTGAGGGAGG + Exonic
1143417046 17:6757930-6757952 TTGGACCCACACAGGGAGTGTGG + Intronic
1143504561 17:7356537-7356559 TGGGAGGGACAGAGGGAGGGAGG - Intronic
1143671110 17:8396766-8396788 TGGGATTCAGAAAGCGAGAGAGG - Intronic
1143712159 17:8742530-8742552 AAGGAGCCACACAGGGCGAGGGG - Intronic
1143790046 17:9287518-9287540 TGGGAGCCAAACAGGAAGAGGGG - Intronic
1145868532 17:28255940-28255962 TGTGACCCACAAAGGGACAAAGG + Intergenic
1146209539 17:30931314-30931336 TGGGTGCCACAACTGGGGAGGGG + Intronic
1146533485 17:33630144-33630166 TGGGAGCCACAGAGGGATTGAGG - Intronic
1146627653 17:34446477-34446499 TGGGAGCCAAACAGGGGAAGGGG - Intergenic
1146955955 17:36936523-36936545 TGGGAGGGACAGAGAGAGAGCGG - Intergenic
1147854483 17:43468466-43468488 TGGGAGCAGCAAAGGGAGACTGG + Intergenic
1148086854 17:44998739-44998761 TGGGGGCCAGTAAGGCAGAGGGG + Intergenic
1148115339 17:45171936-45171958 AGGGAGCCAGACAGGGGGAGGGG - Intergenic
1148262003 17:46192747-46192769 TGGGAGCCACAGGGAGAGCGAGG + Exonic
1149297308 17:55272569-55272591 TGGGTGGCACAAAAGGAGCGGGG + Intronic
1150462945 17:65367977-65367999 AGGAAGGCAGAAAGGGAGAGGGG + Intergenic
1150477870 17:65488182-65488204 AGGGAGGGACAAAGAGAGAGAGG + Intergenic
1150511576 17:65758003-65758025 TGGGAACCACATAGTGAGACAGG + Intronic
1151702858 17:75752591-75752613 TGGGACCCACAAGAGGACAGTGG + Intronic
1151846598 17:76660278-76660300 TGGGTGACACCAAGGTAGAGCGG - Intergenic
1151871663 17:76840925-76840947 GGGGAGAAACAGAGGGAGAGAGG - Intergenic
1152650820 17:81491809-81491831 GGGGAGACAGAAAGAGAGAGAGG - Intergenic
1152694541 17:81737452-81737474 AGGCAGCCACACAAGGAGAGAGG - Intergenic
1152717561 17:81907252-81907274 AGGGGGCTACAATGGGAGAGAGG + Exonic
1153545236 18:6198026-6198048 TGGCATCAAGAAAGGGAGAGGGG - Intronic
1154567280 18:15914678-15914700 TGGGAGAAACAAAGGAAAAGAGG - Intergenic
1154591557 18:16246573-16246595 TGGGAGAAACAAAGGAAAAGAGG - Intergenic
1154605126 18:16432197-16432219 TGGGAGAAACAAAGGAAAAGAGG - Intergenic
1156454432 18:37285080-37285102 TGAGAGCCCCAAGGGGTGAGTGG + Intronic
1157277507 18:46322169-46322191 GGGGACCCAGGAAGGGAGAGAGG + Intergenic
1157601013 18:48893306-48893328 TGGGAGCCCCAGAGGGAGCCGGG - Intergenic
1158552266 18:58446226-58446248 TGGATCCCATAAAGGGAGAGGGG + Intergenic
1160194237 18:76739276-76739298 TGGGAGGAAGAAAGGGAGGGAGG - Intergenic
1160251257 18:77205157-77205179 GGGGAGAGACAGAGGGAGAGAGG - Intergenic
1160356262 18:78230281-78230303 TGGGAGCACCAGAGGCAGAGAGG - Intergenic
1160953384 19:1678344-1678366 AGAGAGACAAAAAGGGAGAGAGG - Intergenic
1161658167 19:5528864-5528886 TGGGAGGGAGGAAGGGAGAGAGG + Intergenic
1161741479 19:6023443-6023465 TGAGAGCCAGAGAGGAAGAGAGG - Intronic
1161998859 19:7730861-7730883 TGGGAGCCGCAGGGTGAGAGGGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163238991 19:16047519-16047541 AGGGAGACACAGAGAGAGAGAGG - Intergenic
1163369478 19:16893898-16893920 TGGGTGCCCCAAAGGGAGGCCGG + Intronic
1163500282 19:17672176-17672198 TGGAAGCCACATGGAGAGAGAGG + Intronic
1163537865 19:17888057-17888079 AGGGAGCCACAGAGGGTGACGGG + Intronic
1163609676 19:18294410-18294432 AGGGAGCCACAGAGGGTGTGGGG - Intergenic
1164304723 19:23995761-23995783 TGGGTGTGACAAATGGAGAGAGG - Intergenic
1164699949 19:30278199-30278221 TGGGAGGCAGAAGGCGAGAGGGG + Intronic
1164731014 19:30504475-30504497 TGGGAGGGAGGAAGGGAGAGAGG - Intronic
1165786388 19:38464319-38464341 GGGGAGCAAGAAAGGGACAGAGG + Intronic
1166146084 19:40836577-40836599 TGGGAGGAACAAAGGGAGTGTGG - Intronic
1166150185 19:40867511-40867533 TGGGAGGAACAAAGGGAGTGTGG - Intronic
1166654315 19:44599125-44599147 TGGCTGCCACACAGGAAGAGTGG - Intergenic
1166731161 19:45059811-45059833 TGGGAGCCACAAAGGGCTCTGGG - Intronic
1167672338 19:50860425-50860447 TGGGATCCACACTGAGAGAGTGG + Exonic
1167963072 19:53123030-53123052 TGGGATCCAGAGAGGGAAAGGGG - Intronic
1168063649 19:53907746-53907768 GGAGACCCACAAAGTGAGAGGGG + Intergenic
1168093252 19:54099708-54099730 TGTCAGCAACAAAAGGAGAGTGG + Intronic
1202675615 1_KI270711v1_random:3479-3501 TGGGAGCCACACAAGGGCAGAGG + Intergenic
925035465 2:681939-681961 TGGAAGAAACAAAGGGAAAGAGG - Intergenic
925719483 2:6813522-6813544 CGGGAGGCAGAAAGGGAGGGAGG + Intergenic
926446189 2:12945880-12945902 AGGGAGACACAGAGAGAGAGAGG - Intergenic
927619040 2:24632585-24632607 TGGGAGCCAATAATGGAGAAGGG - Intronic
928617385 2:33054019-33054041 TGGGATCCTCAAAGGCAAAGAGG + Intronic
929073628 2:38059141-38059163 TGGAAGCCACATGGGGATAGTGG - Intronic
929167719 2:38900411-38900433 TGGGAGGAACAAAGGCATAGAGG + Intronic
929659615 2:43770554-43770576 TTAGAGCCACATAGTGAGAGAGG - Intergenic
929863356 2:45697729-45697751 TGGGAACCTCAAAGTAAGAGAGG - Intronic
930741378 2:54836027-54836049 TGGTGGGCACACAGGGAGAGCGG - Intronic
931120512 2:59213343-59213365 TGGGTGGAACAAAGGGAGATTGG - Intergenic
931569661 2:63655166-63655188 TGGGAGACACAAAGAAAGTGTGG + Intronic
932428024 2:71655918-71655940 AGGGAGCCAGAAAGGAACAGAGG - Intronic
932593502 2:73080603-73080625 TGTGAGCCCCAAGGGGAGCGAGG - Intronic
933256023 2:80081507-80081529 TGAGAGACAGAAAGGGAGGGAGG - Intronic
933266463 2:80186034-80186056 TGCCATCCACAAAGGGAGAAAGG - Intronic
933502095 2:83126329-83126351 TGGGAGAGACAGAGAGAGAGAGG + Intergenic
933700719 2:85253656-85253678 TTGGAGCCTCAAAGAAAGAGGGG + Intronic
934622968 2:95826781-95826803 TGGGAGCCACATGGGGCAAGGGG - Intergenic
934715788 2:96542532-96542554 TGTGAGCCACAGGGCGAGAGGGG - Intronic
934810798 2:97275307-97275329 TGGGAGCCACATGGGGCAAGGGG + Intergenic
934826894 2:97432632-97432654 TGGGAGCCACATGGGGCAAGGGG - Intergenic
935211649 2:100943927-100943949 GGTAAGCCACAAAGTGAGAGAGG - Intronic
935744545 2:106179101-106179123 ATGGAGCCACAGAGGGAGACTGG - Intronic
936010830 2:108924324-108924346 TGGGAGCCCCAAGGAGAGGGTGG - Intronic
937077680 2:119118704-119118726 TGGTTGCCAAAAAGAGAGAGAGG + Intergenic
937689526 2:124739144-124739166 AGTGAGCCAGAAAGAGAGAGGGG - Intronic
938248737 2:129797825-129797847 TGGGAGCCACAAGGTGTGGGAGG + Intergenic
938344565 2:130557746-130557768 GGGGACCCACAGAGGAAGAGAGG - Intergenic
938345268 2:130562976-130562998 GGGGACCCACAGAGGAAGAGAGG + Intergenic
939287960 2:140156898-140156920 TTGGAGACAAAAAGGGACAGAGG - Intergenic
940853833 2:158714512-158714534 TGGAAACCACAAAGGGAGCTTGG - Intergenic
940972273 2:159906739-159906761 AGGCAGCCACAGAGGCAGAGGGG - Intergenic
942856444 2:180555322-180555344 TGGGAGCCACAGGGGGAAAGGGG + Intergenic
942860840 2:180609950-180609972 TTGGAGCCATAAAGGGAGATGGG - Intergenic
943446271 2:187991961-187991983 TGGGAGGCATAGAGGGAGGGAGG + Intergenic
943666711 2:190616659-190616681 TGTGAGCCCCAAGGGAAGAGAGG - Intergenic
944035447 2:195290039-195290061 TAGGAGCCACACAGGGCAAGGGG + Intergenic
944439474 2:199727521-199727543 TGGGAGCCTCACAGGGTAAGGGG - Intergenic
944665502 2:201955828-201955850 TGGGAGGCACAGAGGGCCAGAGG + Intergenic
945910203 2:215640208-215640230 GGGGAGGGAGAAAGGGAGAGAGG - Intergenic
946369635 2:219272804-219272826 TGGCTGCCACACAGGGAGAATGG + Intronic
947077766 2:226364042-226364064 AGGGAGACAGGAAGGGAGAGAGG + Intergenic
947327350 2:228992798-228992820 TGGGTGCCAGAAATGGGGAGAGG + Intronic
947357502 2:229312215-229312237 TGGTAGCCAGAAAGGGAAACCGG - Intergenic
947675367 2:231974229-231974251 TAGGGGCCAAAAAGGGACAGGGG + Intronic
947989241 2:234473887-234473909 TGGGAGCGAGAGAGAGAGAGTGG + Intergenic
948570582 2:238914848-238914870 TGGGAGCCAGAGGAGGAGAGAGG + Intergenic
948877407 2:240837012-240837034 TGGGAGCAGCAAAAGCAGAGGGG - Intergenic
948915066 2:241030260-241030282 TGGGAGGCAGAAAGCCAGAGCGG - Intronic
948930530 2:241129021-241129043 TGGGAGACATGGAGGGAGAGAGG - Intronic
1169009827 20:2241278-2241300 AGGGAGACAGAAAGGGAGGGAGG - Intergenic
1170539596 20:17374638-17374660 TTGATGCCAGAAAGGGAGAGTGG + Intronic
1170600842 20:17840352-17840374 TGGGAGCCACATGAGGAAAGAGG + Intergenic
1171043022 20:21783132-21783154 AGGGGGCCACAAAGTGAAAGGGG + Intergenic
1172099707 20:32477823-32477845 TGGGACCCATCAAGGGAGTGAGG - Intronic
1172566717 20:35936319-35936341 TGCTAGCCACTAAGGAAGAGGGG - Intronic
1172620144 20:36313301-36313323 TGGCAGCCACGGAGGGAGAAAGG - Intronic
1172776017 20:37407517-37407539 TGAGAGGCAGAAAGGGAGGGTGG - Intergenic
1172996312 20:39072570-39072592 TGGGAGCTACCCAGGGGGAGCGG + Intergenic
1173052247 20:39574713-39574735 TTGGAGGCAAAAAGAGAGAGAGG - Intergenic
1173168163 20:40700730-40700752 TGGGAGCCACAAGGGGTGTGGGG - Intergenic
1174462428 20:50692020-50692042 TGGGAGGCGCAAAGGGGGAAAGG - Intergenic
1174992245 20:55523279-55523301 TGGGAGCCACATGGGGAAAGAGG + Intergenic
1175129496 20:56778900-56778922 TGGGAGGCAGGAAGAGAGAGAGG - Intergenic
1175302307 20:57951591-57951613 TGGGGGCCAGGAAGGGAGGGAGG - Intergenic
1175938060 20:62524076-62524098 AGGGAGCATCAAAGGGAGGGTGG - Intergenic
1177395607 21:20532236-20532258 TGAGAGAGACAAAGAGAGAGAGG - Intergenic
1178947061 21:36957384-36957406 TGCGAGCCATACAGGAAGAGTGG - Intronic
1179171778 21:38978566-38978588 TGGGGACTCCAAAGGGAGAGAGG - Intergenic
1179277316 21:39904235-39904257 ATGGAGCCACAAAGGGCCAGGGG - Intronic
1179485869 21:41710512-41710534 TGGCTCCCACAAAGGGAGAGAGG + Intergenic
1179714132 21:43279112-43279134 TGGCAGGCACACGGGGAGAGAGG + Intergenic
1179958221 21:44752684-44752706 AGGGAGGGACAAAGGGAAAGAGG + Intergenic
1179996159 21:44975409-44975431 TGGGAGCCACACAGTGCCAGGGG + Intronic
1180465317 22:15604943-15604965 TGGGAGGGACTAAAGGAGAGGGG - Intergenic
1181432312 22:22888844-22888866 TTGGAGCAATAAAGGGAGAGGGG + Intronic
1181539946 22:23567650-23567672 TGGAAGACACCAGGGGAGAGCGG + Intergenic
1181546153 22:23603718-23603740 TTGGAGCAATAAAGGGGGAGGGG - Intergenic
1181963768 22:26642420-26642442 AGGGAGGCAGAGAGGGAGAGAGG + Intergenic
1181963811 22:26642654-26642676 GGAGAGACACAAAGAGAGAGAGG + Intergenic
1182752990 22:32656866-32656888 TGGGAGGGAGACAGGGAGAGAGG + Intronic
1182764242 22:32746981-32747003 TGAGAGCCAAAAAGGGCGGGAGG + Intronic
1182973033 22:34595352-34595374 AGGGAGGGACAAAGGGAGGGAGG + Intergenic
1183663331 22:39234003-39234025 CGGGAGCCACGGAGGGAGGGAGG + Intronic
1183986871 22:41574930-41574952 GGGGAGCCACACAGGGTGAACGG + Exonic
1185128675 22:49025507-49025529 TTGGAGCCACACAGGAAAAGGGG + Intergenic
949987569 3:9552839-9552861 TGGGAGCTGCTAAGGGAGAGAGG + Exonic
950530598 3:13550362-13550384 TGGCAGCAAAAAAGGGAGGGAGG - Intronic
950580400 3:13858307-13858329 AGGGAGAAACCAAGGGAGAGGGG - Intronic
950883724 3:16344936-16344958 TGAGAGCCACAGATGAAGAGAGG - Intronic
952453262 3:33450610-33450632 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
952572213 3:34731474-34731496 TGGGAGCCACATGGGGCAAGGGG + Intergenic
953311020 3:41879356-41879378 AGGGAGAGAAAAAGGGAGAGGGG + Intronic
953386418 3:42508757-42508779 TGGGAGGCAAGAGGGGAGAGAGG - Intronic
953926751 3:46986429-46986451 TGTGAACCACAGAGGGGGAGAGG + Intronic
954139243 3:48596386-48596408 TGGGTGACACTAAGGCAGAGAGG + Intergenic
954288261 3:49634956-49634978 TGGGAGCCAGAGTGGCAGAGGGG + Intronic
954529357 3:51304716-51304738 TGGGAGCCACATGGGGTAAGGGG - Intronic
955502962 3:59603295-59603317 TGGGGATCACCAAGGGAGAGTGG - Intergenic
955754598 3:62215011-62215033 TGGGAGGGGCAAAGGCAGAGAGG + Intronic
956121833 3:65974303-65974325 TGGGAGGGAAGAAGGGAGAGTGG + Intronic
957113314 3:75993375-75993397 TAGCAGGCACAAAGAGAGAGAGG - Intronic
959299049 3:104576063-104576085 TGGGAGCCACATGGGGCAAGGGG - Intergenic
959580354 3:107976908-107976930 TGTGAGCCACGCAGGGACAGGGG + Intergenic
959596128 3:108130277-108130299 TGGGAGGCAGCAAGGGAGAAGGG + Intergenic
959883616 3:111474069-111474091 TGGGAGCCACACAGGGCAAGGGG - Intronic
960151517 3:114253494-114253516 TTAGAGCCATAAAGGAAGAGGGG + Intergenic
961456961 3:127029128-127029150 TGGAAGCCCCAAGGGGAGGGAGG - Intronic
961468949 3:127099456-127099478 TCGGAGCCACCAAAGGACAGGGG + Intergenic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
963066251 3:141266634-141266656 AGGGAGAGACAGAGGGAGAGAGG + Intronic
963580330 3:147118241-147118263 TGTGAGACAGAAAGAGAGAGAGG + Intergenic
964022348 3:152028285-152028307 TAGGAGACTCAGAGGGAGAGAGG + Intergenic
964040211 3:152252284-152252306 AGGGAGGAACAAAGGGAGGGAGG - Intronic
964646862 3:158967870-158967892 TAGGAGACACAAGGAGAGAGAGG + Intronic
965039061 3:163482756-163482778 AGGGAAGCACAGAGGGAGAGGGG - Intergenic
965186916 3:165476575-165476597 AGGGAGCGACGGAGGGAGAGAGG + Intergenic
965875259 3:173309956-173309978 TGGGAGCCATAAAGCAAGTGCGG + Intergenic
965883411 3:173414109-173414131 TGGGGGCCTGGAAGGGAGAGGGG + Intronic
966250601 3:177860674-177860696 TGAGAGCCACACCGGGAAAGGGG - Intergenic
966371968 3:179260173-179260195 TGGGAGCCACACAGAGAATGTGG - Intronic
968615187 4:1574604-1574626 TGAGGGCCACAGAGGAAGAGAGG - Intergenic
968633522 4:1665715-1665737 TGGGAGCCCTACAGGGTGAGTGG - Intronic
969378419 4:6778431-6778453 TGGGAGGGACAGAGGAAGAGGGG + Intergenic
969618294 4:8266300-8266322 TGAGGCCCACAAAGGGAAAGTGG - Intergenic
970760567 4:19480962-19480984 AGGGAGGGACAGAGGGAGAGAGG - Intergenic
971114451 4:23628618-23628640 TGGGAGAGACAAAGGTAAAGAGG - Intergenic
971280975 4:25242411-25242433 TGGGATCCTCAAAGGCAAAGAGG + Intronic
971286133 4:25291632-25291654 TGGGAGCCACACGGGGTAAGGGG - Intergenic
971717160 4:30193564-30193586 TGGGAGGAAGAAAGGGAGGGAGG - Intergenic
972004519 4:34083132-34083154 TGGAAGGGAGAAAGGGAGAGAGG - Intergenic
972924168 4:43983633-43983655 AGGGAGGGACAGAGGGAGAGAGG + Intergenic
973704954 4:53572105-53572127 TGGGAGCCACACTGGGCAAGGGG - Intronic
973786609 4:54338206-54338228 TAAGAGCCACAAAGGAGGAGAGG - Intergenic
974174726 4:58308325-58308347 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
974913390 4:68149591-68149613 TGGGAGCCACATGGGGCAAGGGG - Intergenic
977659228 4:99563636-99563658 TGGGAGCCTAGAAGGGATAGTGG - Exonic
977834713 4:101634310-101634332 TGGGATCCTCAAAGGCAAAGAGG + Intronic
978795123 4:112701181-112701203 TGGGAGCCAGAGGGAGAGAGAGG + Intergenic
979618913 4:122776155-122776177 GGGGAGCCAGAGAGGGAGGGAGG + Intergenic
979708157 4:123746203-123746225 TGGGAAACACAAAGGGGAAGAGG - Intergenic
980533729 4:134088107-134088129 TGGGAGACAGAAGGGGAGATCGG - Intergenic
981021200 4:140030662-140030684 GGAGAGCCAAAAAGGGAGGGAGG - Intronic
983567149 4:169165336-169165358 TCAGAAACACAAAGGGAGAGGGG + Intronic
984083591 4:175280850-175280872 AGCAAGCCACAAGGGGAGAGAGG + Intergenic
984098183 4:175456930-175456952 TGGTACCCACAAAGCGAAAGTGG + Intergenic
985006063 4:185536109-185536131 TGTGATTCCCAAAGGGAGAGGGG + Intergenic
985720042 5:1484140-1484162 TGGCAGCCACTCAGAGAGAGAGG - Intronic
986049862 5:4079450-4079472 TGGAAGCCACCAAGGAACAGAGG - Intergenic
986609438 5:9551935-9551957 TGGGTGGGAGAAAGGGAGAGGGG - Intergenic
986743549 5:10724969-10724991 GGGGAGCCTGAAGGGGAGAGGGG - Intronic
987175340 5:15302242-15302264 AGTGAGCCTCAAAGGGTGAGTGG + Intergenic
988567605 5:32331844-32331866 TGGGAGCCAGAAAGGGGGCGGGG + Intergenic
989484649 5:41975996-41976018 TGGGAGCAAGAAAGAGAGAGGGG + Intergenic
990729352 5:58791337-58791359 TGGGACTCACAATGGGAGAAGGG + Intronic
992035276 5:72767784-72767806 TGGGACCCATAGAGGGAGACGGG + Intergenic
992646908 5:78819752-78819774 AGGGGGCCACAGAGGTAGAGAGG + Intronic
993025195 5:82637303-82637325 TGGAAGACACACAGGGAGAAGGG - Intergenic
993274199 5:85835433-85835455 GGCGAGCCACATAGTGAGAGAGG + Intergenic
994350619 5:98742270-98742292 TGGGAGCCACACAGGGCAAAGGG + Intergenic
994585473 5:101703698-101703720 TGGGAGCAAGAGAGAGAGAGTGG + Intergenic
995130852 5:108629110-108629132 TGAGAGCCACAAGAGGAGAAGGG - Intergenic
995180327 5:109224741-109224763 AGGAACACACAAAGGGAGAGAGG - Intergenic
995570467 5:113474720-113474742 AGGAAACCAAAAAGGGAGAGAGG + Intronic
996451701 5:123632903-123632925 GGGCAGCCACATAGGAAGAGAGG + Intergenic
996491927 5:124108057-124108079 TGGCAGCGGCAAAGGGAGAAGGG - Intergenic
997391899 5:133524071-133524093 GGGGAGCCGCTCAGGGAGAGGGG + Intronic
997438830 5:133894264-133894286 AGGGAGGCAGAAAGGAAGAGAGG - Intergenic
997442415 5:133918257-133918279 TGGCAGCTACAGAGAGAGAGGGG - Intergenic
997616375 5:135248976-135248998 AGGGAGCCACAAGGGGAGAAAGG + Intronic
997659624 5:135579289-135579311 TGGGCTCCCCAAAGGCAGAGCGG - Intergenic
997955393 5:138274810-138274832 TGGGATCCAGAAAGTGAGAAAGG - Intergenic
998131402 5:139653191-139653213 TGGAAGCCGCAGAGGGAGACAGG + Intronic
998678900 5:144442560-144442582 AGGGAGGCAGAAAGGGAGGGAGG - Intronic
1000071533 5:157744422-157744444 TAGGAGCAACAGAGGGAGAGTGG + Intronic
1000115345 5:158148838-158148860 AGGGAGAGAGAAAGGGAGAGAGG - Intergenic
1000115349 5:158148858-158148880 AGGGAGGGAGAAAGGGAGAGAGG - Intergenic
1000401995 5:160838954-160838976 TGGGAGCAAGAGAGGGAGAAGGG - Intronic
1000753840 5:165132230-165132252 TGGGAGGGAAAAAGGGAAAGGGG - Intergenic
1000820911 5:165982292-165982314 TGAGAGAGAGAAAGGGAGAGAGG - Intergenic
1001587605 5:172844134-172844156 TGGGTACCACAAAGGGAGAGGGG - Intronic
1001673234 5:173491607-173491629 AGGGAGGTAGAAAGGGAGAGAGG - Intergenic
1002204279 5:177552599-177552621 TGTTATCCAAAAAGGGAGAGTGG - Intronic
1002299520 5:178249301-178249323 GGGGACCCACAAAGAGAAAGTGG - Intronic
1002739463 5:181424318-181424340 AGGGAGGCAGAAAGGGAGGGAGG - Intergenic
1003008122 6:2400562-2400584 TGGGAGCAAGAGAGGGAGTGGGG + Intergenic
1003016061 6:2468396-2468418 AGGGAGCGAGAGAGGGAGAGAGG + Intergenic
1003714115 6:8627046-8627068 TGGCAGCTAAACAGGGAGAGTGG - Intergenic
1004328580 6:14700309-14700331 TGGGAGCAAGAGAGAGAGAGGGG - Intergenic
1004613962 6:17272077-17272099 TGGGAGCAAGAGAGAGAGAGGGG + Intergenic
1005561075 6:27041364-27041386 AGGGAGAGAGAAAGGGAGAGGGG + Intergenic
1006130341 6:31865281-31865303 AGGGAGCCACAAAGCGGGGGGGG + Intronic
1006199143 6:32270749-32270771 TGGGAGGCCCAAGGGAAGAGGGG - Intergenic
1006335629 6:33419046-33419068 TGTGACCCAAAAATGGAGAGAGG + Intergenic
1006712088 6:36083229-36083251 TGGGAGCTGCAAAGGGCAAGGGG + Intronic
1007220695 6:40276476-40276498 TCCTAGCCACAAAGGGAGAGCGG + Intergenic
1007659507 6:43475049-43475071 TGGGGTTCACAAAGGGAGAAAGG - Intergenic
1008583641 6:52929336-52929358 CTGGAGCCACTAATGGAGAGGGG + Intergenic
1008936845 6:57000814-57000836 TGGGAGGAACAAAGGGAGTGTGG - Intronic
1010062891 6:71645518-71645540 AGGGAGCAGGAAAGGGAGAGCGG + Intergenic
1010062903 6:71645564-71645586 AGGGAGTGAGAAAGGGAGAGGGG + Intergenic
1010062912 6:71645592-71645614 AGGGAGCAGGAAAGGGAGAGGGG + Intergenic
1010155028 6:72782644-72782666 TAGGAGACACAAAGGGACAAGGG - Intronic
1010266938 6:73878210-73878232 AGTGAGCCACAAAGGCAGACTGG - Intergenic
1010768656 6:79804237-79804259 TGGGTGCCAAAAAGGGAGCATGG + Intergenic
1011737026 6:90321256-90321278 TGGGGGCCACACTGGGAAAGAGG - Intergenic
1011746806 6:90414181-90414203 TGGGAGACAGAGAGAGAGAGAGG + Intergenic
1011802519 6:91033710-91033732 AGGGAGAGACAAAGAGAGAGAGG - Intergenic
1012323877 6:97888963-97888985 TGGAAGGAACAAAGGGAGAAAGG - Intergenic
1016423850 6:143913380-143913402 ATGGAGCCTCAAGGGGAGAGTGG - Intronic
1017572919 6:155766613-155766635 AGGGAGCAAGAAAGGGAGAGAGG - Intergenic
1019055486 6:169220138-169220160 TGGCACCCAGAAAGGGAAAGGGG - Intronic
1019244579 6:170699889-170699911 AGGGAGGCAGAAAGGGAGGGAGG - Intergenic
1019553473 7:1616765-1616787 TGGGAGCCAAGCAGGGAGATGGG - Intergenic
1019740092 7:2668422-2668444 AGGGAGCTGCAAAGGAAGAGGGG + Intergenic
1019884581 7:3892840-3892862 TGAGATCCACAGAGGGAAAGTGG - Intronic
1020210141 7:6152865-6152887 TTGGACCCTCAAAGGTAGAGGGG - Intronic
1020852110 7:13367483-13367505 TGGGAGGGAGGAAGGGAGAGAGG - Intergenic
1021267941 7:18547896-18547918 AGGGAGGGAGAAAGGGAGAGAGG - Intronic
1021298587 7:18941228-18941250 AGGGAGGGAGAAAGGGAGAGAGG - Intronic
1021994657 7:26168079-26168101 GGGGAGGCAGGAAGGGAGAGAGG - Intronic
1022611781 7:31882672-31882694 TGTAAGCCCCAAATGGAGAGAGG - Intronic
1023925634 7:44667486-44667508 TGAGAGGAACAGAGGGAGAGAGG - Intronic
1024730884 7:52252707-52252729 TGGGAGCCACAGAGGAGGTGTGG + Intergenic
1025041615 7:55650961-55650983 TGGGAGCCACATGGGGCAAGGGG + Intergenic
1026793837 7:73353079-73353101 GGAGAGACAGAAAGGGAGAGAGG - Intronic
1026955005 7:74371564-74371586 GGGGAGACAGGAAGGGAGAGAGG + Intronic
1028027600 7:85866452-85866474 TGGGAGCCGCATAGGGCAAGGGG + Intergenic
1028567290 7:92246559-92246581 TCGGAGCCACAAATGGGTAGAGG - Intronic
1028714524 7:93949008-93949030 AGGGAGGGAAAAAGGGAGAGAGG + Intergenic
1028903549 7:96127910-96127932 TGGCAACCACAAAGGGAATGTGG + Intronic
1029620946 7:101689347-101689369 TGGGAGTCTCAGAGGGACAGAGG - Intergenic
1032191552 7:129768831-129768853 TGGGAGCCACGCAGCCAGAGGGG - Intergenic
1032997535 7:137464498-137464520 TGGGAGCCCCAAAGGTGGTGGGG - Intronic
1033114205 7:138610990-138611012 TGGGTGTTTCAAAGGGAGAGTGG - Intronic
1033648692 7:143323717-143323739 TGGGAGCTACAAAGGGATGGGGG - Intronic
1033873911 7:145791515-145791537 AGGGAACCATAAAGGAAGAGAGG - Intergenic
1034375183 7:150636621-150636643 TGGTATTCACATAGGGAGAGAGG - Intergenic
1035308858 7:157952339-157952361 TGGGGGACACGAAGGGAGACAGG + Intronic
1035503547 8:108287-108309 AGGGAGGCAGAAAGGGAGGGAGG + Intergenic
1036405972 8:8455631-8455653 TTGGAGCCATGAAGGGAGATGGG + Intergenic
1037249652 8:16877420-16877442 TGGGAGCCACACAGGGCAAGGGG - Intergenic
1037480585 8:19301936-19301958 TGGGAGGGAGAAAGGAAGAGAGG + Intergenic
1037769146 8:21788936-21788958 AGGGAGCCGCGAAGGGAGAAGGG - Intronic
1038245912 8:25855889-25855911 TGGGAGACAGAAAGAGAGACGGG - Intronic
1038476921 8:27875158-27875180 AGGGAGGAACAGAGGGAGAGAGG - Intronic
1039151523 8:34512162-34512184 AGGGAGGCAGAAAGGGAGGGAGG - Intergenic
1039467254 8:37793477-37793499 TGGGAGTCACATAAGGAAAGTGG - Intronic
1039669974 8:39584769-39584791 TGGGATCCCAGAAGGGAGAGGGG - Intronic
1040841744 8:51792313-51792335 TGGGAGCCACACAGGGCAAGGGG + Intronic
1041341149 8:56847159-56847181 TTGGAGCCACACAGGGCAAGGGG + Intergenic
1041500984 8:58538476-58538498 TGGGAGACAGAGAGGGAGAAGGG + Intergenic
1041854721 8:62438500-62438522 TGGGAGCCAGAGCAGGAGAGAGG - Intronic
1041925310 8:63230143-63230165 TTGAAGCCAGCAAGGGAGAGAGG + Intergenic
1043486899 8:80706615-80706637 TGTGTGCCACAAAGGCAGTGGGG + Intronic
1044896649 8:96899590-96899612 TGGGAGCAAGAGAGAGAGAGTGG + Intronic
1045417512 8:101982035-101982057 TGGGAGCAAGAAAGAGACAGAGG - Intronic
1045554533 8:103202870-103202892 TGAGAGGAGCAAAGGGAGAGAGG + Intronic
1046270882 8:111896734-111896756 TGGGAGCCACAGAGAGAGGAAGG - Intergenic
1047762796 8:127966767-127966789 TGTGAGCCACAATGGGACATAGG + Intergenic
1048879485 8:138860850-138860872 TGGGGGCAATAGAGGGAGAGAGG - Intronic
1048962886 8:139594874-139594896 AGGGAACCAGGAAGGGAGAGTGG + Intergenic
1049219026 8:141420475-141420497 TGAGACCCAGAAAGGGAGAGAGG + Intronic
1049341392 8:142114456-142114478 GGGGAGCCATGGAGGGAGAGCGG + Intergenic
1049747362 8:144268709-144268731 AGGGAGCCACGCCGGGAGAGAGG + Intronic
1050163089 9:2738099-2738121 TGAGAGGCAGAAAGGGAGTGAGG + Intronic
1050320674 9:4449027-4449049 TGGGAGGCACAAGGGGTCAGGGG + Intergenic
1051015005 9:12463379-12463401 TGGGAGGGAGAGAGGGAGAGAGG - Intergenic
1051830298 9:21268411-21268433 TGGGATCCAGAAAAGCAGAGAGG + Intergenic
1052154029 9:25159995-25160017 TGGGTACTACAAAGAGAGAGAGG - Intergenic
1053100407 9:35366966-35366988 CGGGAGCCACTGAGGCAGAGAGG - Exonic
1055040630 9:71867845-71867867 TGGGAGCCACATAGGGAAAATGG - Intronic
1055523755 9:77109139-77109161 GGGAAGCAAGAAAGGGAGAGGGG - Intergenic
1056004271 9:82250433-82250455 TGGGAGGAAGAAAGAGAGAGAGG - Intergenic
1056829461 9:89903161-89903183 TGGGACCCACAAAGGCAAAGTGG + Intergenic
1057241737 9:93417330-93417352 TGGGAGCCACACAGGGCAAGGGG - Intergenic
1057757957 9:97852577-97852599 TGGGGCCCAAAAAGGGAAAGCGG + Intergenic
1057909288 9:99005329-99005351 TGGGAGCCAGAATGGAGGAGTGG + Intronic
1059147018 9:111908940-111908962 TGGGTGACAGAGAGGGAGAGAGG - Intronic
1059437448 9:114285229-114285251 AAGGAGCCACCAAGGCAGAGGGG + Intronic
1059680468 9:116580610-116580632 TGGCAGCCAGAAAAAGAGAGCGG - Intronic
1060043998 9:120325732-120325754 TGCAAGCCACAAATGGAGAGAGG + Intergenic
1060424343 9:123492263-123492285 AAGGAGGCACAAAGGAAGAGAGG + Intronic
1060653124 9:125347850-125347872 AGGAAGCCTCAGAGGGAGAGTGG + Intronic
1061014602 9:127974486-127974508 TGGGAGCCTTGAAGGCAGAGGGG - Intronic
1061088923 9:128415611-128415633 GGGGATCCAGGAAGGGAGAGGGG + Intronic
1061483063 9:130906632-130906654 TGGGGCCCAGAGAGGGAGAGCGG - Intronic
1061493612 9:130959531-130959553 TGGGAGGACCCAAGGGAGAGGGG + Intergenic
1061629211 9:131860983-131861005 TGGGACCCAGAAAGTGAAAGTGG - Intronic
1062264821 9:135682123-135682145 TGGCAGCCACTGGGGGAGAGGGG - Intergenic
1062524881 9:136974152-136974174 AGGCAGCCAGAAAGGGTGAGCGG + Intergenic
1062564395 9:137157496-137157518 TGCCAGCCACACAGGGAGAGGGG - Intronic
1203604769 Un_KI270748v1:49119-49141 AGGGAGGCAGAAAGGGAGGGAGG - Intergenic
1185918134 X:4058887-4058909 AGGGAGGAACAAAGGGATAGAGG + Intergenic
1186686173 X:11926926-11926948 TGGTATCCAAATAGGGAGAGAGG + Intergenic
1186733755 X:12439207-12439229 TGGAAGACACAAAGAGAGTGAGG - Intronic
1186752774 X:12638891-12638913 TGGGAGCCACCGAAGTAGAGTGG - Intronic
1186776763 X:12872526-12872548 TGGGTGAGAGAAAGGGAGAGAGG + Intronic
1186944854 X:14554377-14554399 TGGAAGCCACAGAGGAACAGAGG + Intronic
1189928965 X:45987575-45987597 TGAGACCCAGAGAGGGAGAGTGG - Intergenic
1189940220 X:46113270-46113292 TGGGAGCCACATGGGGCAAGGGG - Intergenic
1189990168 X:46586529-46586551 TGTGATCCACTAAGTGAGAGTGG - Intronic
1189997377 X:46651909-46651931 TGGGAGACACAAAGGTTGAGAGG - Intronic
1190073207 X:47295702-47295724 TGGAAGAGACAAAGGTAGAGTGG + Intergenic
1190262557 X:48806573-48806595 GGGGAGCCAGAAAGGGAGTAAGG - Intronic
1190339900 X:49287750-49287772 TGGGAGCCAGGGAGGAAGAGTGG + Exonic
1190988955 X:55526079-55526101 TGGGAGGGGAAAAGGGAGAGTGG + Intergenic
1191662567 X:63666132-63666154 TGGTAGAGACAGAGGGAGAGAGG + Intronic
1191717561 X:64204170-64204192 GGGGAGCCACACTGGGGGAGGGG + Intronic
1191757313 X:64607420-64607442 TGGGAAGCACAAGGGGTGAGGGG - Intergenic
1192176775 X:68891183-68891205 TGAGGGACAGAAAGGGAGAGAGG - Intergenic
1192184829 X:68939916-68939938 TGGGAGAAAGAAAGGGAGAGAGG - Intergenic
1192424088 X:71060307-71060329 TGGGAGCCACAAAGGGAGAGGGG + Exonic
1192437624 X:71152765-71152787 AGAGAGCCAGAGAGGGAGAGAGG - Intronic
1192549357 X:72041786-72041808 TTGGACCCAGAAAGGGAAAGAGG - Intergenic
1193164422 X:78264584-78264606 TGGGAGCTACAAGGGGCAAGGGG - Intergenic
1194717697 X:97306165-97306187 GGGGAGGCAAAAAAGGAGAGAGG - Intronic
1195153337 X:102097030-102097052 TGAGAGCCACACAGGGAAAGGGG + Intergenic
1195411067 X:104567941-104567963 TGGGCGGCACAGATGGAGAGGGG - Intronic
1196381716 X:115098409-115098431 TGGGAGCCACACAGGGCAAGAGG + Intergenic
1196599832 X:117589463-117589485 TGGGAGCCACATGGGGCAAGGGG + Intergenic
1197376354 X:125686373-125686395 TGGGAGCCAAAATGGGAGGCAGG + Intergenic
1197758757 X:130013771-130013793 TGGGAGCCAGAACCGGAGTGGGG - Exonic
1197766912 X:130065369-130065391 AGGGAGCCACGAAGAGAGAGAGG + Exonic
1198116536 X:133549951-133549973 TGGGAGACAGAAAGACAGAGGGG - Intronic
1199564449 X:149199480-149199502 TGGGAGCCACACGGGGCAAGGGG - Intergenic
1199832207 X:151558240-151558262 TGGGATCCTCAAAGGCAAAGAGG + Intergenic
1201540068 Y:15096500-15096522 GGAGAGAAACAAAGGGAGAGAGG - Intergenic
1202271850 Y:23080953-23080975 TGGGATCCTCAAAGGCAAAGAGG + Intergenic
1202294176 Y:23339729-23339751 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1202386955 Y:24335499-24335521 AGGGAGGCAGAAAGGGAGGGAGG - Intergenic
1202424847 Y:24714697-24714719 TGGGATCCTCAAAGGCAAAGAGG + Intergenic
1202445942 Y:24955388-24955410 TGGGATCCTCAAAGGCAAAGAGG - Intergenic
1202483831 Y:25334629-25334651 AGGGAGGCAGAAAGGGAGGGAGG + Intergenic
1202580071 Y:26371316-26371338 AGGGAGAGAGAAAGGGAGAGGGG + Intergenic