ID: 1192428105

View in Genome Browser
Species Human (GRCh38)
Location X:71095264-71095286
Sequence CTGGAGAATATCGGTGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192428099_1192428105 15 Left 1192428099 X:71095226-71095248 CCTGTTGAATGAGAAGTGAAGCC No data
Right 1192428105 X:71095264-71095286 CTGGAGAATATCGGTGTTGAAGG No data
1192428102_1192428105 -6 Left 1192428102 X:71095247-71095269 CCGTTGGAGATGTGAACCTGGAG No data
Right 1192428105 X:71095264-71095286 CTGGAGAATATCGGTGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192428105 Original CRISPR CTGGAGAATATCGGTGTTGA AGG Intergenic
No off target data available for this crispr