ID: 1192429720

View in Genome Browser
Species Human (GRCh38)
Location X:71103688-71103710
Sequence CACCTAACCCCTGCAGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192429712_1192429720 10 Left 1192429712 X:71103655-71103677 CCGGGGAGGTGGTGGAGTGTGGG 0: 1
1: 0
2: 6
3: 62
4: 544
Right 1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
1192429710_1192429720 11 Left 1192429710 X:71103654-71103676 CCCGGGGAGGTGGTGGAGTGTGG 0: 1
1: 0
2: 5
3: 61
4: 584
Right 1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 161
1192429709_1192429720 12 Left 1192429709 X:71103653-71103675 CCCCGGGGAGGTGGTGGAGTGTG 0: 1
1: 0
2: 2
3: 27
4: 256
Right 1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG 0: 1
1: 0
2: 1
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192429720 Original CRISPR CACCTAACCCCTGCAGGAGT AGG Intergenic
900484506 1:2915028-2915050 CCCCTGAGCCCTGCAGGGGTGGG + Intergenic
901235321 1:7664511-7664533 CACGTGACCGCTGCAGGAGCTGG - Exonic
902723559 1:18320745-18320767 CAGCTAACTCCTGGAGGAATTGG - Intronic
903044937 1:20557453-20557475 CAGCCCACCCCTGCTGGAGTGGG - Intergenic
905715244 1:40143961-40143983 CAGATCAGCCCTGCAGGAGTTGG - Intergenic
907159360 1:52359525-52359547 CACCGAATCTCTGCAGAAGTTGG + Exonic
907268152 1:53275233-53275255 CACCTGCCCTCTGCAGGAGCAGG - Intronic
910991646 1:93062776-93062798 CACCAAAGCCCTGAAGGAGAAGG + Intergenic
914676417 1:149910233-149910255 CTCCTAACCCCAGCAGGATTAGG - Intronic
1062921664 10:1284962-1284984 CACCTGTCCTCTGCAGGAGCTGG - Intronic
1064620690 10:17213796-17213818 CACTTAAGCCCTGGAGGACTAGG - Intergenic
1067303833 10:45039884-45039906 CACCTTACTCCTGCAAGAATAGG + Intergenic
1067681014 10:48441082-48441104 CAACTTACCGCTCCAGGAGTGGG + Intergenic
1072885817 10:99272725-99272747 CACCTTACTCCTGCAAGTGTGGG + Intergenic
1075887415 10:125913364-125913386 CACCTAAACCCTTTAGCAGTCGG + Intronic
1077059012 11:609665-609687 CACCTGGAACCTGCAGGAGTCGG + Exonic
1084006231 11:66325034-66325056 CATCTACCCCAGGCAGGAGTTGG + Intergenic
1084083187 11:66842693-66842715 CACCAAAACCCTGCAGCTGTGGG - Intronic
1085121253 11:73968962-73968984 CCCCTAAACCATTCAGGAGTGGG - Intronic
1085577076 11:77615317-77615339 CACTGAAACCCTGCAGCAGTGGG + Exonic
1086663231 11:89447867-89447889 CATCTAACACCTGCAGAGGTGGG + Intronic
1089054007 11:115569937-115569959 CACCTGAGCCCTGCAGGTGGAGG + Intergenic
1089151583 11:116368626-116368648 CAGGGAACCCCAGCAGGAGTGGG + Intergenic
1089375833 11:117994035-117994057 CTCCTAACCTCTGGAGAAGTGGG + Exonic
1090037312 11:123260228-123260250 CACCTAACCCCAGGAGGTGGAGG - Intergenic
1090296500 11:125592840-125592862 CACCCAACCCTGGCAGGAGCCGG - Exonic
1091833480 12:3567649-3567671 CCCCTAACCCCTGTGGTAGTCGG - Intronic
1091889388 12:4041114-4041136 CTCCTCACCCCAGTAGGAGTTGG + Intergenic
1091922211 12:4314150-4314172 CACATAGGCCTTGCAGGAGTTGG + Intergenic
1092481180 12:8860467-8860489 CACCTAATCTCTGCTGGAGAAGG + Intronic
1094460055 12:30686429-30686451 CACCTAAGCCCTGGAGGTGGAGG - Intronic
1095966007 12:47867590-47867612 CTCCCAGCCCCAGCAGGAGTAGG + Intronic
1096631098 12:52927267-52927289 CACCTATTTCCTGCTGGAGTTGG - Intronic
1096749720 12:53751253-53751275 CTCCCAACGCCTGCAGGGGTTGG + Intergenic
1096749724 12:53751256-53751278 CCCCCAACCCCTGCAGGCGTTGG - Intergenic
1101908675 12:108846773-108846795 GACCCAGCACCTGCAGGAGTCGG + Intronic
1102477112 12:113195880-113195902 CCCCTCACCCCAGGAGGAGTTGG - Exonic
1102527898 12:113524965-113524987 CACTTCACCCCTGGAGGAGGAGG - Intergenic
1103195416 12:119039547-119039569 CACCTGATCCCTGCTGGTGTAGG + Intronic
1107960893 13:45557126-45557148 CACCTTACTCCTGCAAGAATGGG - Intronic
1109155087 13:58900009-58900031 CCCCCAACCCCAGCAGGAGATGG + Intergenic
1109596683 13:64565238-64565260 CACCTTACTCCTGCAAGAGAGGG - Intergenic
1113707398 13:112443657-112443679 CCCCTCACCACTGCAGGCGTGGG - Intergenic
1115537478 14:34386726-34386748 CACCTTACCCCTCCACAAGTGGG + Intronic
1119072193 14:71597799-71597821 CATCTAAACCTTGCAGGAGAGGG - Intronic
1119917275 14:78413715-78413737 CAGCCAACACCTGCAGCAGTTGG + Intronic
1122204847 14:100143250-100143272 CTGCTGACCCCTGCAGGAGCTGG + Intronic
1202870715 14_GL000225v1_random:160720-160742 CACCTAAACCCTTTAGTAGTCGG - Intergenic
1124037680 15:26071029-26071051 CACCTAACCCATCCCGGAGGTGG - Intergenic
1124291538 15:28456867-28456889 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1126919111 15:53500713-53500735 CACCTTACTCCTGCAAGAATGGG - Intergenic
1128697866 15:69781853-69781875 CACATAACTGCTGCAGGACTGGG + Intergenic
1129221120 15:74132223-74132245 CTCTAAACCCCTGCAGAAGTTGG + Intronic
1130064445 15:80592582-80592604 CAGCTGACCCCGGCAGGAGAGGG - Intronic
1130427077 15:83812192-83812214 CACCTCACCATAGCAGGAGTGGG + Intronic
1130830256 15:87591853-87591875 CACCACACCCCTGAAGGACTTGG + Intergenic
1132231248 15:100185873-100185895 CACTTAACCCCTGAAGGGCTTGG + Intronic
1136576838 16:31130251-31130273 CACCTGCCTCCTGCAGGAGAAGG + Exonic
1136707240 16:32200803-32200825 CGCCTGGCCCCTGCAGGAGCGGG - Intergenic
1136760670 16:32728614-32728636 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1136807433 16:33141772-33141794 CGCCTGGCCCCTGCAGGAGCGGG - Intergenic
1136909804 16:34135921-34135943 CTCCCAACCGCTCCAGGAGTTGG - Intergenic
1136910568 16:34141439-34141461 CTCCCAACCGCTCCAGGAGTCGG - Intergenic
1138482755 16:57314731-57314753 GACCTAATGCCTGCAGGAGGAGG - Intergenic
1141549492 16:84795835-84795857 CACTTCACCCCTGCAGGTGCAGG + Intergenic
1141578485 16:84981220-84981242 CACCTCACCCCTGCTGGTCTTGG - Intronic
1203062822 16_KI270728v1_random:988928-988950 CGCCTGGCCCCTGCAGGAGCGGG + Intergenic
1143633068 17:8149790-8149812 CACCTATACCCTGGAGGAGCTGG - Exonic
1148072359 17:44915684-44915706 CACCTGCCTCATGCAGGAGTTGG - Intronic
1152560452 17:81076047-81076069 CCCCTGACCCCAGCAGGAGCTGG - Intronic
1157359112 18:46962623-46962645 CACTTGACACCTGCAGGATTCGG + Intronic
1157360106 18:46968550-46968572 CACTTGACACCTGCAGGATTCGG + Intronic
1157360706 18:47022142-47022164 CACTTGACACCTGCAGGATTCGG + Intronic
1157361695 18:47028057-47028079 CACTTGACACCTGCAGGATTCGG + Intronic
1157460528 18:47888515-47888537 CACCTAACCCCTGAAACACTGGG - Intronic
1158038952 18:53069541-53069563 CACTGGACCCCTGCTGGAGTTGG - Intronic
1159657761 18:71052927-71052949 CACTTTACCCCAGCAGAAGTGGG - Intergenic
1160029960 18:75249737-75249759 CACCTCACCCCTGCAGTAGGTGG + Intronic
1160029985 18:75249825-75249847 CACCTCACCCCTGTAGTAGGCGG + Intronic
1160030013 18:75249911-75249933 CATCTCACCCCTGCAGTAGGTGG + Intronic
1160030035 18:75249995-75250017 CATCTCACCCCTGCAGTAGGTGG + Intronic
1163477332 19:17533975-17533997 CCCCTCACCCTTGCAAGAGTGGG - Intronic
1164682379 19:30144578-30144600 CACTGAAGCCCTGCAGGAGTGGG - Intergenic
1165064631 19:33221761-33221783 CCACAAACCCCTGCAGGAGCCGG + Intronic
1168145829 19:54419676-54419698 CATCTTACCCCCGCAGGAGGTGG - Intronic
928167678 2:28982491-28982513 CACCAATGCCCTGCAGGAGACGG + Intronic
929117027 2:38453100-38453122 CACCCAACCCCTGCATGGGGAGG - Intergenic
931595760 2:63941306-63941328 CACCTAACCCCAGCAGGTCAAGG - Intronic
932593638 2:73081208-73081230 ATCCTGGCCCCTGCAGGAGTGGG - Intronic
935007540 2:99094705-99094727 CACCTTACTCCTGCAAGAATTGG + Intronic
938080007 2:128364835-128364857 CACCTTACCCCTGCACCAGTGGG + Intergenic
944445551 2:199784811-199784833 CAACTAACTCTTCCAGGAGTTGG + Intronic
945828642 2:214756284-214756306 CACCTTACTCCTGCAAGAATGGG + Intronic
948432210 2:237926618-237926640 CACCTAAGCCCTGGAGGCGGAGG + Intergenic
949030589 2:241795226-241795248 TACCTGACCCCTGCAGGTGTGGG + Intronic
1170274000 20:14563071-14563093 GACCTTACCATTGCAGGAGTAGG + Intronic
1171190811 20:23157994-23158016 CACCGAGCCCCTCCAGGGGTGGG + Intergenic
1171813203 20:29762169-29762191 CTCCCAACCCCTCCAGGAGCCGG + Intergenic
1175467944 20:59205268-59205290 CACCCAGGCCCTGCAGGATTTGG + Intronic
1180339452 22:11606267-11606289 CTCCCAACCACTCCAGGAGTCGG - Intergenic
1182180924 22:28347528-28347550 CACCTAACCCCTTTAGGAGCAGG + Intronic
1184122411 22:42460699-42460721 CACCCAAGCCCTGCTGGAGCTGG - Intergenic
1184286907 22:43477056-43477078 CACCAAACCCCTTCTGGAGCAGG - Intronic
1185144239 22:49121336-49121358 CAGGAAACCCCTGCAGCAGTGGG - Intergenic
1185334563 22:50265837-50265859 CCCCTAATGCCTGCAGGAGCTGG + Intronic
950610450 3:14123757-14123779 CACCTAACCCCTCCAGGCCCTGG - Intronic
951512997 3:23525355-23525377 CACCCAACACCTGCATGTGTGGG - Intronic
951519855 3:23601236-23601258 CACCTCTGCCCTGCAGGAGCCGG + Intergenic
951587960 3:24234613-24234635 CACCTAAGCCTTGCAGGAGTGGG - Intronic
953523655 3:43668120-43668142 CACCTTACTCCTGCAAGAATGGG - Intronic
954100599 3:48369706-48369728 CACCTAACCTCTGTATGTGTTGG + Intergenic
956832923 3:73071001-73071023 CACCTATCCCCTGTAAGAGGCGG - Intergenic
957710766 3:83856186-83856208 CACCTGACCATTGCAGCAGTTGG - Intergenic
958065131 3:88535169-88535191 CACGTCACCTCTGCAGGAGATGG - Intergenic
968105128 3:195995318-195995340 CACCCAATCCATGCAGGTGTTGG + Intergenic
969406014 4:6992274-6992296 CACCTAAGCCGTGTAGGACTCGG + Intronic
969423223 4:7109113-7109135 CATCTAACACCTGCAGGGTTTGG - Intergenic
973926298 4:55741889-55741911 CACCTTACTCCTGCAAGAATGGG + Intergenic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
984204266 4:176767521-176767543 CACCTTGCCCCTGCAGGACTAGG + Intronic
985520144 5:370413-370435 CACCTCTCCCGTCCAGGAGTTGG - Intronic
986371554 5:7085569-7085591 CGCCCAACCCCTGCAAGAGCTGG + Intergenic
986750174 5:10779931-10779953 CACCCCACCCCTCCAGTAGTGGG + Intergenic
990544960 5:56814443-56814465 CAGCCAGGCCCTGCAGGAGTGGG + Intergenic
992232086 5:74673418-74673440 TGCCTAACTCCTGCAGAAGTGGG - Intronic
995054447 5:107743892-107743914 CAGCTAACTTCTGCAGGATTTGG - Intergenic
995722716 5:115153213-115153235 CACCAAAAGCCAGCAGGAGTAGG + Intronic
996561710 5:124837066-124837088 CACCTTACTCCTGCAAGAATGGG + Intergenic
998913032 5:146981925-146981947 ACCCTAACCTCTGCAGCAGTTGG + Intronic
998964169 5:147520599-147520621 CACCTAACACCAGCACTAGTAGG - Intergenic
1001939362 5:175729613-175729635 AACCCAACCCGGGCAGGAGTGGG - Intergenic
1003563391 6:7202434-7202456 CACCTAAGCTCTGTAGGAGGAGG - Intronic
1006007049 6:31010819-31010841 CACATAAGCCCTGAAGGAGATGG + Intronic
1007166627 6:39832928-39832950 CACCTGGGCCCTCCAGGAGTGGG - Intronic
1007630365 6:43269962-43269984 CACCTGCCCCCTCCAGGAGGGGG - Intronic
1007689489 6:43690281-43690303 CACCTGAACCCTGCAGGTGGAGG + Intergenic
1009438539 6:63647175-63647197 CACCTTAGGCCTGCTGGAGTCGG + Intronic
1015857558 6:137641266-137641288 CATCTAAGCCCTGCAGGATTTGG + Intergenic
1017454150 6:154584755-154584777 CACCAAAACCCAACAGGAGTGGG - Intergenic
1019339283 7:500921-500943 CACCGGACACCTGCAGGTGTGGG + Intronic
1020995869 7:15263383-15263405 CACCTCACTCCTGCAAGAATGGG + Intronic
1027236786 7:76303086-76303108 CTCCTCTCCCCTGCAGGAGCAGG - Intronic
1027655548 7:80926113-80926135 CACTTGAGCCCAGCAGGAGTTGG - Intergenic
1027663374 7:81014799-81014821 AACCTAACCCATGCTGTAGTGGG - Intergenic
1028818751 7:95180825-95180847 CACCTTACTCCTGCAAGAATTGG + Intronic
1029091400 7:98051189-98051211 CCCCTACCCCCTGCAGGCTTAGG - Intergenic
1029787236 7:102804984-102805006 CACCTTACTCCTGCAAGAATGGG + Intronic
1030396096 7:108988612-108988634 CACTTCATACCTGCAGGAGTAGG - Intergenic
1031261551 7:119527022-119527044 CACCAAAAGCCAGCAGGAGTAGG + Intergenic
1032482372 7:132257168-132257190 CACCTGGCCCCTGCAAGAGAGGG - Intronic
1033295745 7:140133073-140133095 CACACAACCACTGCAGGGGTGGG - Intronic
1034269558 7:149797020-149797042 CACCCCACCCCTGCAGGTCTGGG - Intergenic
1035049673 7:155991567-155991589 CGCATAACTCCAGCAGGAGTCGG - Intergenic
1041781666 8:61584129-61584151 CACCAAAGACCTGCAGGAGAAGG + Intronic
1045066095 8:98446213-98446235 AAACAAAGCCCTGCAGGAGTAGG - Intronic
1049513075 8:143039550-143039572 CACCTCACAGCTGCAGGGGTCGG - Exonic
1057433184 9:95014357-95014379 CACCTCAGCCCTGGAGGAGCTGG - Intronic
1058764038 9:108164242-108164264 CACCCAAGCCCTGCAGCAGAAGG + Intergenic
1059244336 9:112836888-112836910 CAACTCCCCCATGCAGGAGTGGG - Intronic
1060242981 9:121920640-121920662 CACCTCATCTCTACAGGAGTGGG + Intronic
1060550363 9:124482131-124482153 CACCTGACCTCTGCAAGAGGGGG - Exonic
1060672672 9:125483695-125483717 CACCTAACCACTGTGTGAGTTGG + Intronic
1062029330 9:134355058-134355080 CACCGCATCCCTGCAGGAGATGG - Intronic
1062456240 9:136640592-136640614 GTCCTCAGCCCTGCAGGAGTCGG + Intergenic
1203733742 Un_GL000216v2:115871-115893 CACCTAAACCCTTTAGTAGTCGG + Intergenic
1186989005 X:15047609-15047631 CACCTTATCCCTGCAGGCTTAGG - Intergenic
1189288705 X:39870300-39870322 AACCTAGTCCCTGCAGGAGAGGG + Intergenic
1192429720 X:71103688-71103710 CACCTAACCCCTGCAGGAGTAGG + Intergenic
1194998848 X:100622265-100622287 CACCTCACCCCTCCAGTAGCTGG - Intergenic
1196372003 X:114989679-114989701 CACCTTACTCCTGCAAGAATGGG + Intergenic
1201497091 Y:14599714-14599736 CACATAATACATGCAGGAGTAGG + Intronic
1202627273 Y:56872550-56872572 CACCTAAACCCTTTAGTAGTCGG - Intergenic