ID: 1192429733

View in Genome Browser
Species Human (GRCh38)
Location X:71103727-71103749
Sequence CCTCCCAAGGGGAGGTAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192429725_1192429733 8 Left 1192429725 X:71103696-71103718 CCCTGCAGGAGTAGGCGGGCTGT 0: 1
1: 0
2: 0
3: 1
4: 109
Right 1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 111
1192429724_1192429733 9 Left 1192429724 X:71103695-71103717 CCCCTGCAGGAGTAGGCGGGCTG 0: 1
1: 0
2: 1
3: 20
4: 133
Right 1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 111
1192429726_1192429733 7 Left 1192429726 X:71103697-71103719 CCTGCAGGAGTAGGCGGGCTGTG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 111
1192429721_1192429733 14 Left 1192429721 X:71103690-71103712 CCTAACCCCTGCAGGAGTAGGCG 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192429733 Original CRISPR CCTCCCAAGGGGAGGTAGTC TGG Intergenic
902763148 1:18597523-18597545 GCTCCCAAGGGCAGGTGCTCCGG + Intergenic
903277333 1:22230528-22230550 CCTCCAAAGGGGAGGAAATTGGG + Intergenic
904853780 1:33479585-33479607 CCTCCCTAGGCAAGATAGTCAGG - Exonic
905339105 1:37266184-37266206 CCTGCCATGGTGAGGTATTCAGG + Intergenic
912262535 1:108123370-108123392 CCTCCCAAGTGGAGGAGGCCAGG - Intergenic
912561424 1:110554489-110554511 CCTCCCAAGGAGAAGCAGACAGG + Intergenic
921856268 1:219988617-219988639 CTTCTCAAGGGGAAGTAGTTCGG - Exonic
923446531 1:234076828-234076850 CCACCCAAGGGGAGAGAGCCTGG + Intronic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063368305 10:5504787-5504809 CCTCTCCAGGAGAGGGAGTCGGG - Intergenic
1070823452 10:79376428-79376450 CCCCTCTAGAGGAGGTAGTCAGG + Intergenic
1071267917 10:83980772-83980794 CCTGCCATGGAGAGGTAGTGTGG - Intergenic
1075177215 10:120176658-120176680 CCTGCCAAGGGGAGGAATACAGG - Intergenic
1076541803 10:131219627-131219649 CCTCCCCAGGGAAGGTTGCCCGG + Intronic
1084290411 11:68161956-68161978 CCTCGAAAGGGGACGTCGTCAGG - Intronic
1092330578 12:7583504-7583526 CCTCTCAAAGGGAGGGAGACAGG - Intergenic
1095823387 12:46506021-46506043 CCTCCCACGGGGAGAGAGTATGG + Intergenic
1095962373 12:47843842-47843864 CCTCCCCAGGGGAGAGGGTCTGG - Exonic
1096336062 12:50757442-50757464 CCTCCCACTGGGATGTTGTCAGG - Intergenic
1096840060 12:54374606-54374628 AGACCCAAGGGGAAGTAGTCAGG - Intronic
1102247653 12:111365386-111365408 CCACCCTAGGACAGGTAGTCTGG - Intronic
1102304072 12:111791595-111791617 CCTCCCAAGGGCAGCTAGTGTGG - Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1115128456 14:30024721-30024743 CCACCCAAGGGGAGGGAGGTGGG - Intronic
1116146148 14:41071771-41071793 CCTGCAAAGGGGAGGGAGACTGG + Intergenic
1120768684 14:88355695-88355717 CCTCCCAAGTAGAAGTAGCCAGG + Intergenic
1122273121 14:100577322-100577344 ACCTCCAAGGGGAGGCAGTCCGG + Intronic
1122517539 14:102319474-102319496 TCTCCCAGGGGGAGGTCTTCGGG - Intronic
1122839180 14:104446577-104446599 GCTCCCACGGGCAGGTAGTGAGG + Intergenic
1122862365 14:104588366-104588388 CCTCCCTCGGGGAGGGAGTGAGG - Intronic
1124187203 15:27541506-27541528 CCTCCAGATGGGAGGTAGGCCGG + Exonic
1131138870 15:89961019-89961041 CCTCCCAAGGGGAGGATTACAGG - Intergenic
1132642147 16:982786-982808 CCACCCATGGGGAGGGAGTGCGG + Intronic
1134285677 16:12860181-12860203 CCTCCGGAGGGGAGGAAGGCTGG - Intergenic
1137024523 16:35459429-35459451 CTTCCCAAGGGGATTGAGTCAGG + Intergenic
1137488066 16:48908227-48908249 CCTACCAAGAGGAGCTTGTCTGG - Intergenic
1137753984 16:50887055-50887077 CCTCCCTGGGGGAGGTGGTGGGG + Intergenic
1137760988 16:50940215-50940237 CCTCCCAAGGAGAGGGAGCTGGG - Intergenic
1139397194 16:66649727-66649749 CCCCCCATGAGGAGGGAGTCGGG - Intronic
1140045002 16:71434555-71434577 CTTCCCAAGGACAGGTAGCCTGG - Intergenic
1140202459 16:72905585-72905607 CCTCCCAGGGGGAGTAACTCAGG + Intronic
1140618870 16:76702743-76702765 CTTCCAAAGGGAAGGTAGACAGG - Intergenic
1142164266 16:88577396-88577418 CCTCGCAGGGGGAGCTGGTCGGG - Exonic
1142743230 17:1942427-1942449 GCTCCCAAGAGCAGGCAGTCTGG + Intronic
1144677758 17:17172829-17172851 CCTCCCAAGGGCAGATGGGCAGG - Intronic
1148092258 17:45029724-45029746 CCTCTCAGTGGGAGGTGGTCAGG - Intronic
1149444770 17:56705081-56705103 CCTGCCCTGGGGAGATAGTCTGG + Intergenic
1149613004 17:57971371-57971393 CCTACCAAGGGCAGTCAGTCTGG + Intergenic
1152012229 17:77725662-77725684 CCTCCCAAGATGAGGAAGTGTGG + Intergenic
1152603015 17:81274584-81274606 GCTCCCAAGGGGAGGCAGGAGGG + Intronic
1154070131 18:11146515-11146537 CCTCCCAAGGGGAGCTGGCCTGG - Intronic
1157193559 18:45601102-45601124 CATCCTGAGGGGAGGCAGTCAGG - Intronic
1157709830 18:49842757-49842779 CCTCCCAAGGTGAGGCAACCTGG - Intronic
1160350608 18:78174988-78175010 CCTCTCAGGAGGAGGGAGTCAGG + Intergenic
1161139568 19:2639648-2639670 CCATCCAAGGGGAGGGATTCAGG + Intronic
1161650534 19:5481685-5481707 CTGCCCAAGGGCAGGTGGTCTGG + Intergenic
1163115306 19:15185408-15185430 CCTGGCAGGGGAAGGTAGTCAGG + Exonic
1163392384 19:17038485-17038507 CCTGCCGAGGTGAGGTAGGCAGG + Intergenic
1164968692 19:32510851-32510873 CAGCCCAGGGGGAGGGAGTCAGG + Intergenic
1168291159 19:55358392-55358414 CCTCCCACGGTGAGGCGGTCAGG + Exonic
925064485 2:919179-919201 CCTCCCATAGGGATGGAGTCAGG - Intergenic
925743903 2:7029001-7029023 CCCCACAAGGAGAGGAAGTCCGG + Intronic
928125359 2:28611828-28611850 CCTTTCAAGGAGAGGTACTCAGG - Intronic
930568940 2:53060412-53060434 CTTCCCAAGGGAAAGAAGTCAGG + Intergenic
933646153 2:84814206-84814228 CCTGCCAATGGGAGGTGGTGGGG - Intronic
936271928 2:111055575-111055597 CCTCTCAAGTGGAGGCACTCAGG + Intronic
937984026 2:127630569-127630591 CCTCCCAAGGGAAAGGAGACAGG + Intronic
938781268 2:134587112-134587134 CCTGCCAAGGGGTGGTACTTTGG - Intronic
944423176 2:199552787-199552809 CCTCCCAAAGGGATATTGTCAGG + Intergenic
1171041629 20:21769466-21769488 CCTCCCAAGTCCAAGTAGTCGGG + Intergenic
1172504970 20:35455091-35455113 CCTCCCAAAGGGCGGGAGTTTGG + Intergenic
1175264546 20:57694807-57694829 CCTCACAACAGGAGGAAGTCAGG + Intronic
1177207156 21:18023269-18023291 GCTCTCAAGGGGAGGTGGTGTGG + Intronic
1178876910 21:36420776-36420798 ACTCCCAAGGGGAGGGTGACAGG - Intergenic
1179263700 21:39782877-39782899 GCTGGGAAGGGGAGGTAGTCGGG - Intronic
1179792231 21:43762419-43762441 CCTCCAAAGGGGAGGTTTTTAGG - Intergenic
1181179050 22:21054570-21054592 CCTCCCATGGGGAGGAAAGCTGG - Intronic
1184723389 22:46329026-46329048 CAACCCAAAGGGAGGCAGTCAGG + Intronic
952005461 3:28837525-28837547 CCTCCCATGGGGAGGTATGCTGG - Intergenic
959242076 3:103808878-103808900 CCTCAGAAAGGGAGGTACTCTGG + Intergenic
963063022 3:141240558-141240580 CCTTCCAAGGGGAGGAAATGTGG + Intronic
964641779 3:158916119-158916141 CCACCCAAGGTGAGGAAATCTGG - Intergenic
967086362 3:186098401-186098423 CCTCCCCTGGGGAGGAAGCCAGG - Intronic
971299245 4:25428341-25428363 CATCCCAAAGGGAGGCTGTCTGG + Intergenic
975696602 4:77020132-77020154 CCTCCCAAAGAGAGGTAGCAGGG - Intronic
978323037 4:107519229-107519251 CCTCCCACAGGGAGGCAGTGTGG - Intergenic
983823273 4:172224609-172224631 CCTCCCAAGGGCTGTTGGTCTGG - Intronic
984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG + Intergenic
985129633 4:186726705-186726727 CCTCCAAGGGGGAGGGAGTGGGG - Intronic
993346002 5:86783397-86783419 CCTCTGAAGGGGAGGAAGGCTGG + Intergenic
996694868 5:126383080-126383102 CTTCCCCAGTGGAGGTAGCCGGG + Intronic
1001514424 5:172345418-172345440 CCTCCCAAGGTGAGGTGGGGAGG + Intronic
1001702567 5:173717989-173718011 CTTCCCATGGGTGGGTAGTCTGG - Intergenic
1002542348 5:179914571-179914593 TCTCCCAAGGGGAGCTGGCCAGG - Intronic
1003395593 6:5749769-5749791 CTTCCCCAGGGGAGGAAGTCGGG - Intronic
1007394071 6:41567356-41567378 TCTCCCTAGGGAAGGGAGTCAGG - Intronic
1007817199 6:44532978-44533000 CCCCGCAAGTGGTGGTAGTCAGG - Intergenic
1011142786 6:84178570-84178592 CATCCCTAGGGGATGTAGTAAGG + Intronic
1018785151 6:167102524-167102546 CCACCCAAAGGGAGGGAGTGGGG + Intergenic
1019772356 7:2891622-2891644 TCTTTCACGGGGAGGTAGTCCGG + Intergenic
1024220727 7:47284463-47284485 TCTCCCAAGAGGAGATGGTCAGG - Intronic
1024716771 7:52088247-52088269 CCTCCCAGGGGAAGCTGGTCAGG - Intergenic
1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG + Intronic
1032395419 7:131586125-131586147 CCTCCCTGGGGGAGGTGGTCAGG - Intergenic
1034458022 7:151182058-151182080 CCTACCAAGGGAATGTAGTGAGG - Intronic
1035659081 8:1333334-1333356 CCTCCCCAGGGAAGGGAGACAGG - Intergenic
1037473936 8:19237815-19237837 GCGGCCAAGGGGAGGAAGTCCGG + Intergenic
1042182468 8:66105228-66105250 CCTTCAAAGGGGAGGTAGGCTGG + Intergenic
1044339227 8:91027855-91027877 CCTTCCCAGGGGAGGTAGTGAGG - Intronic
1047625243 8:126649528-126649550 CCTGCCAAATGGAGGTAGTGAGG + Intergenic
1056752927 9:89364810-89364832 CCTCCCCAGGCGAGGCAGCCTGG - Intronic
1056969668 9:91191745-91191767 CCTCCAAAGGGTACGGAGTCTGG + Intergenic
1059470159 9:114498847-114498869 CTTCCCCAGGGGAGGCAGGCAGG - Intronic
1059833901 9:118128847-118128869 CTTACCCAGGGGAGGTATTCTGG - Intergenic
1061385946 9:130289435-130289457 CCTCCCAGGGGGAGGTGGTTAGG + Intronic
1192429733 X:71103727-71103749 CCTCCCAAGGGGAGGTAGTCTGG + Intergenic
1196389042 X:115190249-115190271 CCTCTCAAGGGACGGTAGTCCGG - Exonic
1199264849 X:145818099-145818121 CCTCGCAAGGAGAGGTGGCCGGG - Intronic
1199535551 X:148898577-148898599 ACTCCGAAGAGGAGGGAGTCTGG - Intronic
1199720724 X:150541216-150541238 CATCCCAAGTGGTGGTAGGCAGG - Intergenic
1200065440 X:153502316-153502338 CCTCCCAGGGAGAGTGAGTCAGG - Intronic