ID: 1192432725

View in Genome Browser
Species Human (GRCh38)
Location X:71123427-71123449
Sequence ACATCAAGGCTTCAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192432725 Original CRISPR ACATCAAGGCTTCAGTTGGG AGG Intronic
900407960 1:2500733-2500755 AGATCCAGGGTTCAGCTGGGTGG + Intronic
902291147 1:15436010-15436032 ACATCAAGGCCTCAGTCCTGGGG - Intergenic
903312425 1:22470045-22470067 ACAACAGGGCTTCAGTGGGGAGG - Intronic
907270180 1:53286503-53286525 ACCTTCAGGCTTCTGTTGGGAGG - Intronic
910438471 1:87228965-87228987 ACCTCCATGCTACAGTTGGGGGG - Intergenic
915273917 1:154775103-154775125 CCATCAAGGAGACAGTTGGGTGG - Intronic
918548690 1:185714780-185714802 ACATCACTGCCTCAGCTGGGAGG + Intergenic
918983567 1:191595382-191595404 GCATGCTGGCTTCAGTTGGGTGG + Intergenic
919782339 1:201229015-201229037 TATTCCAGGCTTCAGTTGGGAGG + Intergenic
920436756 1:205951903-205951925 ACATCTAGGCTCCAGCTGGCAGG - Intergenic
921050517 1:211508088-211508110 ACATCAAGGTGTCAGCTGGGAGG - Intergenic
921383118 1:214544909-214544931 AAAGGAAGGCTTCAGTGGGGAGG + Intronic
921421510 1:214954222-214954244 AGATCAAGGTGTCAGTGGGGTGG + Intergenic
922334789 1:224609887-224609909 AAACCAAGTCTTCAGTTGTGTGG + Intronic
1063169283 10:3492423-3492445 AAATCATGGCTTCATTTGAGGGG - Intergenic
1068390698 10:56392461-56392483 ACATCCAGGCTTCAGAAGAGTGG + Intergenic
1073009613 10:100349064-100349086 ACTTCATGGCATCAGTAGGGGGG - Intronic
1080300957 11:30784493-30784515 AAATCAAGGCATCAGCTAGGAGG + Intergenic
1085265059 11:75232464-75232486 TCATCAAGGCTTGAGTGCGGTGG - Intergenic
1085784094 11:79436755-79436777 TCATCAAGGCCTCTGTTTGGGGG - Intronic
1086124066 11:83331885-83331907 AAATAAAGGCTGCAGTTGTGTGG - Intergenic
1090669414 11:128935703-128935725 AGACCAAGGCCTCAGTAGGGAGG + Exonic
1091234649 11:134013024-134013046 ACATCAAGGCCAGAGTTGGATGG + Intergenic
1091271503 11:134315014-134315036 AAGTCAAGGCAGCAGTTGGGAGG - Intronic
1092365017 12:7870833-7870855 ACATTTTGGCTTCAGGTGGGTGG - Intronic
1093132226 12:15405358-15405380 ACATAAAAGTTTCAGTTGGCTGG - Intronic
1094264825 12:28544983-28545005 ACAACTAGGCTTCAGTTTGCTGG - Intronic
1096320122 12:50604491-50604513 ACATCCAGGCTTCAGTACAGTGG + Intronic
1096905759 12:54933948-54933970 AGATCAAGGCTTCACTGGAGAGG + Intergenic
1098307978 12:69120441-69120463 AAATCAAGGCGTCAGCTGGGTGG + Intergenic
1101044921 12:100794921-100794943 ACCTCCAGGCTCCAGTCGGGAGG - Intronic
1103369292 12:120406611-120406633 ACAACAAGGCAGCTGTTGGGTGG + Intergenic
1104437805 12:128769701-128769723 AGATGATGGCTTCAGTTTGGCGG - Intergenic
1106051595 13:26195250-26195272 AAATCAAGGCTGCCTTTGGGGGG + Intronic
1107998946 13:45889081-45889103 GCAGCAGTGCTTCAGTTGGGTGG + Intergenic
1110447187 13:75599036-75599058 ACATCAAGGCTGCAGTTTGAAGG - Intronic
1112926863 13:104687214-104687236 ATATTAAGGCTTTATTTGGGAGG + Intergenic
1114011944 14:18378523-18378545 ACATCATGGCTTAAATTTGGTGG + Intergenic
1114028464 14:18553020-18553042 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1116950045 14:50871321-50871343 GCATCAAGGCTTCATCTTGGAGG - Intronic
1124417040 15:29480808-29480830 ACCTCACGGCTGCAGTTGGGGGG + Intronic
1125182454 15:36893093-36893115 ATATCAAGGCATTATTTGGGGGG - Intronic
1125343735 15:38698526-38698548 ACATCAAGGCCTAGTTTGGGTGG - Exonic
1128141220 15:65302111-65302133 ACATCGAGGGGTCAGTGGGGGGG - Intergenic
1128511682 15:68317381-68317403 ACATCATGGCAGCAGTTAGGTGG + Intronic
1136386196 16:29927464-29927486 ACATCAAGGCTTCTGGAGTGAGG - Intergenic
1137685598 16:50384756-50384778 ACAAAGAGGCATCAGTTGGGTGG - Intergenic
1139280308 16:65764888-65764910 AGATCAAGGTGTCAGTAGGGTGG - Intergenic
1139611357 16:68061299-68061321 ACATCAAGGCTGCTGTAGGCTGG - Intronic
1140050051 16:71472536-71472558 ACCTCAAGGCTGAAGTTGGGGGG + Intronic
1141015428 16:80444529-80444551 ACATGAAGGCTTCAAATGTGCGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143207097 17:5150833-5150855 AAACCAAGGTTTCAGTAGGGTGG + Intronic
1144842258 17:18194501-18194523 ACATGAAGTCTCCATTTGGGGGG - Intronic
1147335693 17:39725811-39725833 ACATCAATGGTGCAGATGGGGGG - Exonic
1153260289 18:3217097-3217119 AGATCAAGGTGTCAGCTGGGTGG - Intronic
1165373056 19:35422085-35422107 ACTTCAAAGTTTCAGTTAGGAGG - Intergenic
925462463 2:4075294-4075316 AGATCAAGGCGTCAGCAGGGTGG + Intergenic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
937456050 2:122042661-122042683 AAATCGAGGCTTCACCTGGGAGG - Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
939696683 2:145334139-145334161 ACACCAAGGGTAGAGTTGGGGGG + Intergenic
941544340 2:166828690-166828712 AAATCAAGGCTTCAATTGTGGGG + Intergenic
942028823 2:171937933-171937955 AGATCAAGGCTGCAGTTAGCTGG + Intronic
942948258 2:181693702-181693724 ACAGCAAAGCCTTAGTTGGGTGG + Intergenic
946475248 2:220000696-220000718 ACATCAAGGCTCCTCTTGGGAGG - Intergenic
947889683 2:233605838-233605860 ACCTCAAGGCTTGTGATGGGAGG + Intergenic
948417119 2:237816807-237816829 CCTTCAAGGCATCATTTGGGAGG + Intronic
1169849785 20:10036144-10036166 ACTTCAGGGCTTTAGCTGGGAGG + Intronic
1171046263 20:21811270-21811292 TCACAAAGGCTTAAGTTGGGTGG - Intergenic
1172657287 20:36544866-36544888 ACATCTTGGCTTCTGGTGGGTGG - Exonic
1177750195 21:25271772-25271794 ACATCTAGGGTTCTGTTGGCAGG - Intergenic
1179404424 21:41113479-41113501 AGATCAAGGCGTCAGCAGGGTGG + Intergenic
1180436436 22:15309331-15309353 ACATCATGGCTTAAATTTGGTGG + Intergenic
1180452587 22:15480072-15480094 ACAGAAAGACTTCAGATGGGAGG - Intergenic
1180518675 22:16173523-16173545 ACATCATGGCTTAAATTTGGTGG + Intergenic
1185397955 22:50602021-50602043 ACCTCAAGGGTTAAGTGGGGAGG - Intronic
949849046 3:8403348-8403370 AAAACTAGGCTCCAGTTGGGAGG + Intergenic
950695970 3:14701391-14701413 ACTTCGAGGCTGCAGCTGGGTGG + Intronic
955298824 3:57757485-57757507 ACATCAACTCTTCACTTGGGTGG - Exonic
957313360 3:78546846-78546868 ACAGCAAGCCTTCAGGTGGATGG - Intergenic
958950776 3:100413311-100413333 CCATCAAAGCATCAGTTGAGTGG + Intronic
964939259 3:162134805-162134827 ACAGGATGACTTCAGTTGGGAGG + Intergenic
966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG + Intergenic
968474410 4:796325-796347 ACATGAAGTCTTCAGTGGGGTGG - Intronic
971640401 4:29124600-29124622 ACATCAAGACACCAGTTTGGTGG - Intergenic
978229508 4:106382030-106382052 ACATCAAGGAGAGAGTTGGGAGG - Intergenic
985078443 4:186241773-186241795 ACATCATGGTTTCTGTTCGGAGG + Intronic
990315714 5:54581476-54581498 ACATCTAGGTTTCACTTGGGAGG + Intergenic
990515233 5:56525184-56525206 ACATCAAGGTTTAAGTTGTCAGG - Intronic
990707526 5:58546483-58546505 AAATCAAGGCTTCATTTCGTTGG + Intronic
992073095 5:73166621-73166643 TCATCAAGGCCTCAGTTGATCGG + Intergenic
992170690 5:74098753-74098775 ACATTAAGGTTTCAGTTTAGTGG + Intergenic
992349272 5:75912421-75912443 AGGTCAAGGCTGCAGTGGGGTGG + Intergenic
995237548 5:109846889-109846911 ACATCAGGGATCCAGTAGGGAGG + Intronic
999738768 5:154533112-154533134 AGTTCAAGGCTTCAGTGAGGGGG + Intergenic
1002379468 5:178815993-178816015 ACATCAAGGCTTCAAGTGAGCGG - Intergenic
1002762139 6:210373-210395 ATATCAAGGATTCAGCTGAGAGG + Intergenic
1003849856 6:10210416-10210438 ACATGAATGGTTCAGTTAGGAGG - Intronic
1004636078 6:17469141-17469163 CCATCAAGGCATCAGATGCGTGG - Intronic
1008814307 6:55545047-55545069 ACCTCTAGTCTTCAGTTGGCAGG + Intronic
1011460264 6:87595871-87595893 TCACCCAGGCTTCAGTTCGGCGG + Intronic
1011819757 6:91237497-91237519 AAATAAAGACATCAGTTGGGTGG + Intergenic
1015665127 6:135619781-135619803 ACATGATGGCTTCAGTAGAGGGG + Intergenic
1018647890 6:165964960-165964982 GCATCAAGCCTTCAGTTGGGTGG + Intronic
1019904168 7:4048271-4048293 CCATCAAGGCTTCCACTGGGTGG - Intronic
1020058635 7:5135934-5135956 TCATCTAGGTTTCAGTTGAGTGG - Intergenic
1023182423 7:37498518-37498540 CCCTCAAGACCTCAGTTGGGTGG + Intergenic
1030436821 7:109532312-109532334 AAATCAAGCCTTCATTTAGGAGG - Intergenic
1032407387 7:131666546-131666568 TCATCCAGGCTTGAGGTGGGAGG - Intergenic
1032567662 7:132964260-132964282 ACATAAAGTCTTCATTTGTGCGG - Intronic
1033621524 7:143066070-143066092 ATATCAAGGGTTCAGTTCAGTGG - Intergenic
1039859909 8:41448193-41448215 AGATCAAGGCTTCCGTTTGAAGG - Intergenic
1040016194 8:42702189-42702211 ATGTGAAGGCTTCAGTTCGGAGG - Intronic
1043256073 8:78138204-78138226 CCAGGAATGCTTCAGTTGGGTGG + Intergenic
1043475428 8:80601028-80601050 CCATCAAGGCTCGAGTAGGGGGG - Intergenic
1049332816 8:142064214-142064236 AGATGAAGGCGTCAGTAGGGTGG + Intergenic
1050428440 9:5536452-5536474 ACATCCAGGCAGCAGCTGGGAGG + Intronic
1052717437 9:32134029-32134051 ACATCAAGTCTTAGGTGGGGAGG - Intergenic
1053703704 9:40728224-40728246 ACATCATGGCTTAAATTTGGTGG - Intergenic
1054413786 9:64851833-64851855 ACATCATGGCTTAAATTTGGTGG - Intergenic
1054790003 9:69247906-69247928 ACATCAAGGTTTCAGTCGCTTGG + Intronic
1056059659 9:82870914-82870936 ACAATAAGCCTTCATTTGGGGGG - Intergenic
1058009238 9:99957917-99957939 ACATTAAGGATGCAGTTGGAAGG - Intronic
1058553378 9:106139561-106139583 AAATCAAGGCATCAGCAGGGTGG - Intergenic
1188317286 X:28690202-28690224 ATATCAAGCTGTCAGTTGGGAGG - Intronic
1192432725 X:71123427-71123449 ACATCAAGGCTTCAGTTGGGAGG + Intronic
1194446631 X:93995352-93995374 AGATCAAGGGTTCAGTTTGGAGG + Intergenic
1195323073 X:103736711-103736733 ACAGCAAAGTTTCATTTGGGAGG - Intergenic
1200395109 X:155981195-155981217 ACATAAAGGGTTCAATTTGGGGG - Intergenic