ID: 1192433331

View in Genome Browser
Species Human (GRCh38)
Location X:71127070-71127092
Sequence GGCAGGCATGATAGTGCCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192433331_1192433335 1 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433335 X:71127094-71127116 CATCCTCAACCAGGACCAGATGG 0: 1
1: 1
2: 1
3: 11
4: 177
1192433331_1192433341 17 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433341 X:71127110-71127132 CAGATGGCACAGGTCTTTGAGGG 0: 1
1: 0
2: 0
3: 23
4: 238
1192433331_1192433340 16 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433340 X:71127109-71127131 CCAGATGGCACAGGTCTTTGAGG 0: 1
1: 0
2: 1
3: 28
4: 231
1192433331_1192433332 -8 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433332 X:71127085-71127107 TGCCTGCCTCATCCTCAACCAGG 0: 1
1: 0
2: 1
3: 35
4: 279
1192433331_1192433342 18 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433342 X:71127111-71127133 AGATGGCACAGGTCTTTGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 156
1192433331_1192433337 7 Left 1192433331 X:71127070-71127092 CCTGCGGCACTATCATGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1192433337 X:71127100-71127122 CAACCAGGACCAGATGGCACAGG 0: 1
1: 0
2: 1
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192433331 Original CRISPR GGCAGGCATGATAGTGCCGC AGG (reversed) Exonic