ID: 1192433660

View in Genome Browser
Species Human (GRCh38)
Location X:71129153-71129175
Sequence AAGGTGAAGGAGGATGCGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 384}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192433660_1192433666 15 Left 1192433660 X:71129153-71129175 CCTGCCGCATCCTCCTTCACCTT 0: 1
1: 0
2: 0
3: 38
4: 384
Right 1192433666 X:71129191-71129213 CTCAATCCTTGCCAGTCTGATGG 0: 1
1: 0
2: 1
3: 16
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192433660 Original CRISPR AAGGTGAAGGAGGATGCGGC AGG (reversed) Exonic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900459470 1:2795511-2795533 AAGGTGAAGGTGGAAGCCGTGGG + Intronic
901321579 1:8343386-8343408 AAGGTGAAGGAGGGGATGGCAGG + Intronic
902089818 1:13894045-13894067 GGGGTGAAGGAGGGTGCGTCAGG + Intergenic
902792000 1:18775718-18775740 AAGCTGAAGGAGGAGGAGACAGG - Intergenic
903057681 1:20647881-20647903 GAGGTGAAGGAGGCTGAGACAGG - Intronic
903502616 1:23809766-23809788 AAGGTGCAGAGGGATGTGGCAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905106700 1:35567444-35567466 TAGGTGGAGGAGGTTGCGGAGGG - Intergenic
905353397 1:37363240-37363262 GAGGCAAAGGAGGATGGGGCGGG - Intergenic
905575804 1:39043745-39043767 AAGAAGGAGGAGGAGGCGGCAGG + Intergenic
906963056 1:50431052-50431074 AAGTTGAAGAAGGATGGGCCAGG - Intergenic
907678287 1:56538867-56538889 AAGGGGAAGGAGCCTGCTGCTGG + Intronic
907903425 1:58762457-58762479 AAGGTGATGCAGGATGAAGCTGG + Intergenic
909391847 1:75129027-75129049 GAGGTGAAGGAGGATGTGGTAGG + Intronic
909538923 1:76769332-76769354 AAGGTGTAGGATGATGCGTCTGG - Intergenic
910758998 1:90717560-90717582 AAGGCGAAGGCGCAGGCGGCGGG + Intergenic
910913985 1:92269401-92269423 AAGATGGAGGAGGATGCAGTGGG + Intronic
911068158 1:93810560-93810582 ATGGAGAAGGATGATGCTGCAGG - Intronic
911172746 1:94786104-94786126 AAGTTGAATGAGGATGTGGTGGG - Intergenic
912050790 1:105525857-105525879 AAGTTGAATGAGGATGTGGAGGG + Intergenic
912755846 1:112324432-112324454 AAGGTCAAGGAGGATGTGCCTGG + Intergenic
912878985 1:113390480-113390502 GAGGAGGAGGAGGTTGCGGCTGG + Intergenic
912915620 1:113811965-113811987 AAGGTGGCGGCGGAGGCGGCAGG + Exonic
915543766 1:156584365-156584387 AATGTGAAGGAGGAGGCGGTTGG - Intronic
915545581 1:156595517-156595539 AATGAGAAGGAGGACGCTGCAGG - Exonic
915935416 1:160087713-160087735 AAGGTGGAGGAGGAGGGGGCGGG + Exonic
916620198 1:166488786-166488808 AAGTTGGAAGAGGATGGGGCTGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919935969 1:202251198-202251220 AAGGTGTATGAGGAGGCTGCAGG + Intronic
920054288 1:203181295-203181317 AAGGGGATGGAGGGTGAGGCAGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921374548 1:214460347-214460369 AGGGTAAAGGAGGAAGGGGCAGG - Intronic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923009551 1:230077264-230077286 GAGGGGAAGGAGAGTGCGGCAGG - Intronic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
924261956 1:242240704-242240726 AAGGTGAGGGTGGAGGCAGCAGG + Intronic
924262902 1:242250392-242250414 AAGGTGAAGGGGAATGGGGAAGG + Intronic
924539901 1:244970768-244970790 AGGGGGAAGGAGGACGGGGCGGG - Exonic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
1066479908 10:35785801-35785823 CAGGGGAAGGAGGCTGCAGCTGG - Intergenic
1066721884 10:38348062-38348084 AAGGTGAAGGGGAATGGGGAAGG - Intergenic
1067476267 10:46568860-46568882 AAGGTGAAGGAGGATGATGAGGG + Intergenic
1067618470 10:47772920-47772942 AAGGTGAAGGAGGATGATGAGGG - Intergenic
1069718477 10:70535433-70535455 AGGGGGAAGGAGGAAGCGGGGGG - Intronic
1070587854 10:77780026-77780048 AGGCTGAAGGAGGCTGCAGCAGG + Intergenic
1070877380 10:79826362-79826384 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1071643875 10:87342406-87342428 CAGGCGGAGGAGGAAGCGGCGGG + Intergenic
1071827786 10:89342423-89342445 AAGGAGCAGGAGGATGGGGGAGG - Intronic
1073442181 10:103558802-103558824 GAGGTGAAGGAGGAAGTGGGGGG - Intronic
1073537566 10:104291566-104291588 AAGGGGAAGGAGGAAGCGCGCGG - Intronic
1074205706 10:111281071-111281093 AAGATGAAGGAGGCTGCTTCAGG - Intergenic
1074244737 10:111677359-111677381 GAGGTCAAGGAGGATGAGGGAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1079176731 11:18148883-18148905 AAGGTGGGAGAGGATGAGGCAGG + Intronic
1079365663 11:19807311-19807333 AAGGTGAGGGTGGAGGAGGCCGG - Intronic
1079987629 11:27215530-27215552 AAGATGAAGGAGGAGGCCACTGG + Intergenic
1080386352 11:31813156-31813178 GAGGTGAAGGAGGTGGCGCCGGG + Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080908041 11:36566511-36566533 AAGGAGCAGGAGGATGGGGGGGG + Intronic
1081942291 11:46954250-46954272 AAGAAGAGGGAGGATTCGGCTGG + Intronic
1083715905 11:64576863-64576885 GAGGGGAATGAGGATGGGGCTGG - Intergenic
1084072435 11:66745018-66745040 AAGGTGAAGGAGGAAGGTTCGGG + Intronic
1084092195 11:66886080-66886102 GAAGTGAAGGATGATGAGGCGGG + Intronic
1084362030 11:68674969-68674991 AAGGTCAAGGAGGACCCTGCAGG + Intergenic
1084517179 11:69643311-69643333 AAGGTGCAGGCGGTGGCGGCCGG + Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1084772577 11:71353312-71353334 AAAATGAAGGAGGTTGGGGCTGG - Intergenic
1085792225 11:79506085-79506107 AAGGTGAAGGGGGATAGGGAGGG + Intergenic
1085806117 11:79637928-79637950 AAAGAGAAGGAGGATGTGCCAGG + Intergenic
1088258993 11:107927595-107927617 AAGGTGAAGGAGTTTTGGGCAGG - Intronic
1088645494 11:111913391-111913413 AGGATGAGGGAGGATGAGGCTGG - Intronic
1089307360 11:117535141-117535163 AAGGTGATGCAGGCTGAGGCTGG - Intronic
1089454023 11:118615400-118615422 AAGGTGAAGGGGGCTGTGCCAGG - Intronic
1089683576 11:120133002-120133024 AAGGTGAAGGAGGAGACTGAGGG - Intronic
1090365714 11:126203586-126203608 CAGGTGAAGGGGGATGTAGCGGG + Exonic
1090451471 11:126810101-126810123 AAAGTGAAGGATGATGGGGAGGG + Intronic
1091212369 11:133873121-133873143 AAGTTGAATGAGGATGGGGTGGG - Intergenic
1091453935 12:591320-591342 GAGGTGAAGGGAGATGCTGCCGG - Intronic
1091558680 12:1594446-1594468 CAGGAGGCGGAGGATGCGGCAGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092760284 12:11804414-11804436 AAGGTGATGGAGGATGAGGGTGG - Intronic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093925222 12:24902832-24902854 AAGGCGAAGGAGGATGGTGCAGG + Intronic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1096412940 12:51390524-51390546 AAGGTTAAGAAGGATGAGACAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096620557 12:52862086-52862108 ATGGTAAAGGAGGCTGCAGCAGG - Intergenic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1096977181 12:55706235-55706257 AAGGTGAATGAGGAAGCAGATGG + Intronic
1097151602 12:56983451-56983473 CAGGTGCAGGAGGATGAGGGAGG + Intergenic
1097827392 12:64188226-64188248 AAGGTAAGAGAGGATGGGGCTGG + Intronic
1098071356 12:66679114-66679136 AAGGGGGAGGAGGCTGTGGCAGG - Intronic
1099061088 12:77910265-77910287 AAGGTGAAGGGGGAGCAGGCAGG + Intronic
1100130008 12:91480599-91480621 AAGATGAAGGAGGATAGAGCGGG - Intergenic
1100846807 12:98667554-98667576 CTGGTGAAAGAGTATGCGGCTGG - Exonic
1101814250 12:108133743-108133765 AAGGTGAGGGAGGCGGGGGCAGG - Intronic
1101910122 12:108855324-108855346 AAGGTTAGGGAGAATGGGGCAGG + Intronic
1102471917 12:113164080-113164102 AAGGAGGAGGAGGAGGAGGCGGG - Exonic
1103825101 12:123731794-123731816 GAGGAGAGGGAGGATGTGGCTGG - Intronic
1104876922 12:132041364-132041386 GTGGAGGAGGAGGATGCGGCGGG + Intronic
1105448123 13:20475003-20475025 AGGGTGAAGGAGGCTGCGCACGG - Intronic
1106835554 13:33630792-33630814 AAGGTGAAGGAGGATTAGGATGG - Intergenic
1109209990 13:59524161-59524183 AAGGTCAAGGAGGCTAAGGCTGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1113015987 13:105828708-105828730 AAGGTGAAGGGGGAGCAGGCAGG - Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113285643 13:108845487-108845509 AATGGGAAGGAGGAAGAGGCAGG + Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114522481 14:23347951-23347973 AAGGAAAAGGAGGATGTTGCAGG + Exonic
1117339128 14:54778881-54778903 AAGGGGAAGGAGGCTGCAGAAGG + Intronic
1117579582 14:57138710-57138732 AGGGGGAAGGAGGATGGGTCAGG + Intergenic
1118290406 14:64515893-64515915 CAGGTAGAGGAGTATGCGGCAGG - Intronic
1119407042 14:74405472-74405494 ATGGTGAAGGAGCAGGCAGCAGG + Intergenic
1121151582 14:91640160-91640182 AAGGTGAGGAAGGCTGGGGCTGG - Intronic
1122107319 14:99468274-99468296 GAGGTGCAGGAGGAAGTGGCTGG - Intronic
1122161929 14:99791286-99791308 AGAGTCAAGGAGGATGAGGCTGG - Intronic
1122741064 14:103871911-103871933 CCGGTGGAGGAGGACGCGGCAGG + Intergenic
1122947158 14:105017322-105017344 AAGTTGAGGGAAGATGAGGCAGG - Intronic
1122982747 14:105198979-105199001 GAGGTGGAGGAGGGTGTGGCAGG - Intergenic
1123151495 14:106185965-106185987 CAGGTGAAGGAGGCTGGGGAGGG - Intergenic
1123774633 15:23566263-23566285 AAGGAAAGGGAGGATGCAGCCGG - Exonic
1123826362 15:24086287-24086309 AAGGTGAAGCAGTTTGTGGCAGG - Intergenic
1123991595 15:25687572-25687594 CAGGCGAAGGAGGATGGAGCAGG + Intronic
1125983923 15:44030710-44030732 AAGGTGAAGGAGGAGGAAGATGG + Intronic
1128791021 15:70434064-70434086 AAGGCGAAGGAGGATGCCGTGGG - Intergenic
1128818235 15:70629771-70629793 AATGTGAAGGGAGCTGCGGCTGG - Intergenic
1129111427 15:73339487-73339509 AACGTGAAGGAGGATGCCCTCGG - Intronic
1129232660 15:74205389-74205411 AAGGTGAAGGGGGGTCAGGCAGG + Intronic
1129608789 15:77037545-77037567 GGGGTGCAGGAGGATGTGGCAGG + Intergenic
1130941344 15:88512009-88512031 AATGTGACAGAGGATGTGGCTGG + Intronic
1131284688 15:91047700-91047722 AAGGTGAAGGGGGAGGAGGGAGG - Intergenic
1131675606 15:94667369-94667391 AAGGTGGAGGAGGAGGAGGTAGG - Intergenic
1131788616 15:95940046-95940068 AAGAAGAAGGTGGATGCTGCAGG - Intergenic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1132906777 16:2286541-2286563 ATGGTGGAGGAGGATGTGGCAGG + Intronic
1134232598 16:12440154-12440176 AAGGGGAGGGAGGATGTGACAGG - Intronic
1135730065 16:24886854-24886876 GAGGTTAAGGAGGTTGAGGCAGG + Intronic
1135983747 16:27168572-27168594 AAGATGAAGGAGGATGGAGAAGG + Intergenic
1136403532 16:30030840-30030862 CAGGAGGAGGAGGATGCGGATGG + Exonic
1137290916 16:47051350-47051372 ACGATGAAGGAGGATGAGGAAGG + Intergenic
1137580322 16:49629964-49629986 AAGCTGAAGCTGGATGCGTCAGG + Intronic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139215848 16:65123368-65123390 ACGGGGAAGGAGGCTGCGGAGGG + Intronic
1140203140 16:72910961-72910983 AATGTGAAAGAGAATGTGGCTGG + Intronic
1140265063 16:73413359-73413381 GGAGTGAAGGAGGATGAGGCTGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141098948 16:81182865-81182887 AAGGTGAATGAGGCTGAGACAGG + Intergenic
1141103508 16:81215008-81215030 AACGTCAAGGAGGAGGTGGCAGG - Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141896055 16:86959371-86959393 AAGGGGAAGATGGATGGGGCTGG + Intergenic
1142399394 16:89851435-89851457 AAGGGGCAGGAGAATGAGGCTGG - Intronic
1142886911 17:2918557-2918579 AAGGTGAAGGGAGAGGAGGCAGG + Intronic
1143262606 17:5611185-5611207 AAGCTCAAGGAGGAAGTGGCCGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143449511 17:7027455-7027477 AAGGTGATTGTGGATGGGGCAGG + Intronic
1143598507 17:7929546-7929568 AAGGCTGAGGAGGCTGCGGCGGG + Intronic
1143944981 17:10583157-10583179 AAAGTGAAGGAAGAGGAGGCAGG + Intergenic
1144952247 17:19000597-19000619 AAGGTGAGTGAGGAGGCGGAAGG + Intronic
1145994453 17:29097409-29097431 GAGGGGAAGGAGGATGGGGCAGG + Intronic
1148128509 17:45248712-45248734 AAGGTGAAGGAGGGTGAGGAGGG + Intergenic
1148837641 17:50474274-50474296 AAGGTGGAGGAGGCTGGGGAGGG + Intronic
1148854396 17:50570803-50570825 AAGCTGAAGGGGGATGGGGTAGG + Intronic
1149273165 17:55004726-55004748 AGGGGGAAGGAGGAGGAGGCGGG + Intronic
1149584963 17:57780330-57780352 ACGGTGAAGGAGCATGCGGTGGG - Intergenic
1152158035 17:78647747-78647769 ATGGTGAAGGAGGCTCCGGAGGG + Intergenic
1152576666 17:81144151-81144173 AAGGTGAAAGAGGCTGCCTCGGG - Intronic
1154008169 18:10552270-10552292 AGGGTGAAGGAGGCTGCACCTGG - Exonic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155251608 18:23958313-23958335 AAGGTGGAGGAGGGTGAAGCCGG - Intergenic
1157187389 18:45552326-45552348 AAGGAGAAGGGGAATGCAGCTGG + Intronic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1158129015 18:54132316-54132338 AAGGTGAAGGGGGAGTAGGCAGG - Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159310234 18:66698388-66698410 AAGGTGAAGGAGGAGGAGAAAGG + Intergenic
1159945432 18:74441320-74441342 CAGGTGAGGGAGGATGCATCTGG - Intronic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160308216 18:77761095-77761117 AAGGAGAAGCAGGCTGCAGCAGG - Intergenic
1160401279 18:78613106-78613128 AACGTGAAAGAAGCTGCGGCTGG - Intergenic
1160811540 19:1015025-1015047 AAGGTGAGGCAGGAAGCAGCAGG - Intronic
1160941388 19:1621909-1621931 GAGGAGAAGGAGGATGCAGATGG + Exonic
1160983431 19:1827035-1827057 GAGGAGGAGGAGGATGGGGCGGG + Exonic
1161204593 19:3034415-3034437 AAGGTGAAGCTGGCTGGGGCAGG - Intronic
1161213638 19:3081682-3081704 AAGCTGAGGGAGGATAGGGCTGG - Intergenic
1162736918 19:12751972-12751994 AAGGTCAAGGCGGATCCGGGAGG + Exonic
1164340187 19:24386866-24386888 AAGGGGAAGGAGTATACGGTAGG + Intergenic
1164394347 19:27850673-27850695 ATGGTGTAGGAGGAGGAGGCGGG - Intergenic
1164541228 19:29122909-29122931 AAGATGATGGAGCAGGCGGCAGG - Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165348913 19:35266318-35266340 CAGGAGAAGGGGGATGAGGCAGG - Intronic
1165898956 19:39159724-39159746 AAGGTGAAGGTTGAGGGGGCAGG + Intronic
1166187429 19:41150283-41150305 CAGGTGAGGGAGGCTGAGGCAGG - Intergenic
1167060532 19:47142517-47142539 AAGGTGAGGGAGGATGATGGTGG - Intronic
1167083538 19:47293567-47293589 AAAATGAAGGAGGAAGTGGCTGG - Intronic
1167427507 19:49437008-49437030 AATGTGAAGAAGGAGGGGGCTGG - Intronic
1168246911 19:55117145-55117167 ACGGGGAAGGAGGATGCCCCAGG + Intronic
1168359151 19:55723815-55723837 AAGGTGAAGGTAGATTCTGCCGG - Intronic
925912500 2:8582927-8582949 AAGGTGGTGGAGGAAGGGGCAGG - Intergenic
926109373 2:10172268-10172290 GAGATGAAGGAGGCTGGGGCTGG + Intronic
927561649 2:24077563-24077585 CCAGTGAAGGAGGATGGGGCAGG - Exonic
928167131 2:28979705-28979727 GAGCTGAAGGAGGATGCAGTGGG + Intronic
928396476 2:30946498-30946520 AAGGTGAAGGGGGAGCAGGCTGG - Intronic
930634236 2:53787119-53787141 GAGGTGGAGGAGGAGGCGGCGGG - Exonic
930749002 2:54914442-54914464 ATGGTAGAGGAGGATGAGGCTGG + Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931953961 2:67397407-67397429 AATGTGAAAGAAGAAGCGGCTGG + Exonic
932316380 2:70786708-70786730 AAGGTGAAAGAGAATTGGGCTGG - Intronic
932743879 2:74314998-74315020 AAGGTGAAGGAGGAGAAGGCTGG - Exonic
933786549 2:85847387-85847409 AAGTTGGAGGAGCATGCTGCTGG - Intronic
934069837 2:88373742-88373764 AGGCTGAAGGAGGCTGAGGCGGG + Intergenic
934557392 2:95294675-95294697 AAGGTTAAGGAGGCTGTGGAAGG - Intergenic
935643094 2:105309110-105309132 AAGATGAAGTAGGAGGCGACGGG - Intronic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
938396176 2:130950102-130950124 CAGCTGAAGGAGGATGAGGAAGG + Intronic
938957427 2:136311543-136311565 AAGGAGGAGGAGGAAGCTGCTGG + Intergenic
939213745 2:139211297-139211319 GAGGTGAATGAGGATGTGGTGGG - Intergenic
939858557 2:147390657-147390679 AAGGTGAAGCTGGAAGCTGCAGG + Intergenic
939969653 2:148644928-148644950 AAGGAGGTGGAGGAGGCGGCGGG + Intronic
940011537 2:149060025-149060047 AAGGAGGAGGAGGAGGGGGCAGG + Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943309037 2:186304070-186304092 GAGGTGATGGTGGATGAGGCTGG - Intergenic
946164796 2:217857416-217857438 AAGGTGAAGATGGCTGGGGCTGG + Intronic
947054071 2:226080449-226080471 AAGGGGAAGAAGGCTGTGGCAGG + Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947982953 2:234425720-234425742 CAGGTGAAAGAGGAAGAGGCAGG - Intergenic
948295135 2:236855157-236855179 TGGGAGAAGGAGGATGAGGCAGG - Intergenic
1168743234 20:212968-212990 AAAGTGAAGGAGGAAGCGTCTGG - Intergenic
1168838195 20:891693-891715 GAGATGAAGGAGGAAGTGGCTGG - Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1170034941 20:11980352-11980374 AAGGAGAAGGTAGATGCTGCTGG + Intergenic
1170429797 20:16265534-16265556 AAGTTGCAGCAGGATGCGGGTGG - Intergenic
1170553912 20:17500694-17500716 GAGCTGTAGGAGGCTGCGGCTGG - Intronic
1170687684 20:18584326-18584348 ATGGTGGAGCAGGATGCTGCAGG + Intronic
1170699998 20:18695417-18695439 AAGGGGAAGGGGGAGGCGGAGGG - Intronic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173249939 20:41358970-41358992 AAGGGGAAGGAGGAGGCTGCAGG + Exonic
1174179094 20:48663792-48663814 CAGGGGAAGGAGGATATGGCTGG - Intronic
1174191695 20:48744938-48744960 CTGGTGAAGGCGGATGGGGCAGG + Intronic
1174404279 20:50293688-50293710 AGGGTGAAGGAGGAAGCTGTGGG - Intergenic
1175586101 20:60141144-60141166 AAGGTGGAGCAGGAAGCTGCTGG + Intergenic
1175830412 20:61962270-61962292 AAGGGGAAGGCGGATGGGCCTGG + Intronic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176081006 20:63273004-63273026 CGGGTGGAGGAGGCTGCGGCAGG - Intronic
1176664235 21:9669596-9669618 GAGGTGGAGGAGGAAGGGGCTGG - Intergenic
1178242544 21:30919307-30919329 AATGTGAAGGAGGATGTAACTGG - Intergenic
1180101459 21:45589638-45589660 AGGGTGCAGGAGGCTGAGGCAGG + Intergenic
1181534223 22:23533421-23533443 CAGGTGAGGGAGGCAGCGGCAGG + Intergenic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1182025512 22:27115066-27115088 AAGATGAAGGTGGAAGGGGCAGG + Intergenic
1182586334 22:31346135-31346157 AAGGCGAAGGCGGCGGCGGCGGG + Exonic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183093825 22:35540739-35540761 GAGGTGAAGGAGGAGGAGCCGGG + Intergenic
1183385433 22:37511460-37511482 AAGGAGAAGGAGGAGGCGGGAGG + Intronic
1183603278 22:38852424-38852446 AAGGTCAAGGAGGCTGTGTCTGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1184172839 22:42769603-42769625 GAGGTGACGGGGGAGGCGGCTGG + Intergenic
1184354971 22:43973745-43973767 ACGGTGACGGAGGCTGAGGCAGG - Intronic
1184590222 22:45477060-45477082 GAGGAGGAGGAGGATGCGGCAGG - Intergenic
1184925263 22:47632017-47632039 AAGGTGCGGAAGGAGGCGGCTGG + Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949815206 3:8050882-8050904 ATGGTGAAGGAGGGTGGGGATGG + Intergenic
949854019 3:8443534-8443556 AAGGTGGAGCAGGAAGAGGCAGG + Intergenic
952651271 3:35729462-35729484 AAGTGGAAGGAGGATGTAGCTGG - Exonic
953550083 3:43895034-43895056 AAGGTGAAGGCGCCTGCGGGTGG - Intergenic
953569384 3:44059044-44059066 AAAGTCAAGGAGGGTGCAGCTGG - Intergenic
954539128 3:51382213-51382235 AAGGTGGAGTAGGAGACGGCTGG - Exonic
956506439 3:69945278-69945300 AAATTGAAGGAAGATGCGCCTGG - Intronic
956693375 3:71898250-71898272 AGGGTGGAGGAGGATCCAGCAGG + Intergenic
960528789 3:118740388-118740410 AAGGTCAAGGAGACTGCTGCTGG + Intergenic
960665991 3:120109329-120109351 AAGATGATGGAGGCTGGGGCAGG - Intergenic
961021173 3:123508326-123508348 AAAGCGAGGGAGGAGGCGGCTGG + Intronic
961487497 3:127227240-127227262 GAGGGGGAGGAGGAGGCGGCTGG - Intergenic
961895747 3:130166595-130166617 AAGGAGAAAGAGGAGGCTGCTGG - Intergenic
962727621 3:138248096-138248118 AGAGTGAAGGAGGATGGTGCTGG + Intronic
964368668 3:155976082-155976104 GAGGTGGAGGAGGCTGAGGCAGG + Intergenic
964372460 3:156015043-156015065 AAGGAGAAAGAGGATGCTGTAGG + Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
967979190 3:195055334-195055356 AAGGTGAAGGAGGCTTGGGTTGG - Intergenic
968359923 3:198139670-198139692 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
968808520 4:2789801-2789823 CAGGAGAGGGAGGATGAGGCAGG + Intergenic
969257239 4:6010795-6010817 CAGGGGAAGGACGATGGGGCTGG - Intergenic
969315211 4:6377730-6377752 CAGGTGAAGGAGGATGGGCAGGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
975540027 4:75499764-75499786 AAGGGTAGGGAGGATGGGGCAGG + Intronic
976036460 4:80828636-80828658 AAGGTGAAGGGGGAGCAGGCAGG - Intronic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976381275 4:84402012-84402034 AAGGTTAAGCAGAATGGGGCTGG + Intergenic
976408415 4:84685258-84685280 AAGGTGGAGGAGGCTGGGGTAGG + Intronic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
978119872 4:105065524-105065546 AAGATGAAGAAGGAAGGGGCAGG + Intergenic
978925554 4:114238527-114238549 AAGGTGAAGAAGGATGCACATGG - Intergenic
982769379 4:159381915-159381937 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
982856034 4:160384174-160384196 AAAGTGAAGGAAAATGCTGCAGG - Intergenic
983524709 4:168749178-168749200 AAGGTGAAGCAGGAGCAGGCAGG - Intronic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987295847 5:16550602-16550624 AAGGGGAAGAAGCATGCAGCAGG - Intronic
988888445 5:35585948-35585970 AAATTGAAGGAGGATGAGGCAGG + Intergenic
992558033 5:77922272-77922294 AAGGTGAAGGGGGATCAGGCAGG - Intergenic
994204059 5:97013038-97013060 AAGGTGTAGGATGAGGCAGCAGG - Intronic
995340990 5:111059373-111059395 CAGTTGCAGGAGGATGAGGCAGG - Intergenic
995849313 5:116528381-116528403 AAGGCGAATGAGGATGGGGCTGG - Intronic
996087348 5:119318666-119318688 AGGGGGCAGGAGGATGCGGGGGG - Intronic
996212291 5:120826286-120826308 AAGATGAAGGAGGATGCCTGTGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997722493 5:136090526-136090548 AAAGTGAAAGAGAATGAGGCCGG + Intergenic
998172514 5:139880927-139880949 AAGGTGAAGGTGGAGGACGCTGG - Exonic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
1000284661 5:159816628-159816650 AAAGTGAAGGTGGCTGTGGCTGG - Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1002316919 5:178349571-178349593 AAGGTGAGGCAGGAAGCGGGAGG - Intronic
1002512430 5:179731694-179731716 AAGGTTAAGCAGGAGGTGGCAGG - Intergenic
1002795097 6:465638-465660 AAGGAGAAAGAGGATGGGGCAGG - Intergenic
1003019436 6:2497011-2497033 AAGATTAAGGAGGATGGGGATGG - Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1005956966 6:30671000-30671022 AGGGTGAGAGAGGATGGGGCAGG - Intronic
1007111280 6:39314583-39314605 AGGGAGAAGGAGGAAGCTGCTGG + Intergenic
1007302461 6:40877608-40877630 AAGGTGAAGGTGGAGGAGGCAGG - Intergenic
1007451106 6:41940973-41940995 AAAGTGCAGGAGGCAGCGGCAGG - Intronic
1007829059 6:44624496-44624518 AACCTGAAGGAGGAGGGGGCTGG + Intergenic
1008011401 6:46471534-46471556 AAGGTGGAGTAGGCTGTGGCAGG + Intronic
1011157627 6:84350669-84350691 AAGGTCAAGGTGAATGAGGCTGG + Intergenic
1012305101 6:97645939-97645961 AAGGTGAAGGAGAAAGTGTCAGG + Intergenic
1012998361 6:105995101-105995123 AATGGGGAGGAGGATGAGGCTGG - Intergenic
1013650763 6:112192402-112192424 CAGGTGAAGGAAGAGGCAGCAGG + Intronic
1014298585 6:119651983-119652005 AGGCTGAGGGAGGATGAGGCAGG - Intergenic
1016692231 6:146951105-146951127 CAGGAGAAGGGGGATGCGGGGGG - Intergenic
1017104566 6:150875406-150875428 GAGGTGAAGGTGGCTGCTGCTGG + Intronic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017645258 6:156534138-156534160 TAGGTGGAGGAGGCTGGGGCAGG - Intergenic
1019260060 7:76952-76974 GAGGTGAAGGAGGAGGAGTCGGG - Intergenic
1019262197 7:87887-87909 AAGGTGACAGAGGATGCAGGTGG + Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019721651 7:2575861-2575883 AAGGTGGAGAAGGAGGCGGATGG - Intronic
1021879664 7:25082438-25082460 AAGGTGAAGAGGGAGGAGGCAGG + Intergenic
1023006730 7:35878272-35878294 AAGGAGAAGGAGGATGAGAATGG + Intronic
1023305402 7:38820632-38820654 AATGTGAAGGAAGATTGGGCTGG - Intronic
1024067431 7:45752368-45752390 AAGGAGAAGGAGGATGAGAATGG - Intergenic
1024114797 7:46182460-46182482 AAGGTATTGGAGGATGAGGCAGG - Intergenic
1026360646 7:69598874-69598896 GAAGGGAAGGAGGATGCTGCTGG - Intergenic
1026613681 7:71883009-71883031 AAGGTAAAGTAAGATGAGGCTGG - Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026831676 7:73614103-73614125 GAGGTGCAGGAGGCTGAGGCAGG + Intronic
1027046344 7:74993916-74993938 AGGGGGAAGGAGGGTGCAGCAGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027544013 7:79503733-79503755 AAGGGGGAGGAGGAGGCGGAGGG + Intergenic
1028905055 7:96144166-96144188 AAGGTGAAGTGGGGTGGGGCTGG + Intronic
1029386635 7:100247692-100247714 AGGGGGAAGGAGGGTGCAGCAGG + Intronic
1030077905 7:105752304-105752326 AAGCTGAAGGAGGATCCAGAAGG + Intronic
1030690707 7:112529601-112529623 AGGGTGAAGGAGAATCCTGCGGG - Intergenic
1032653473 7:133903575-133903597 ATTGTGACGGAGGATGCTGCAGG + Intronic
1033045967 7:137962444-137962466 AAGGGGAAGGAGGATGGTGCGGG - Intronic
1033354374 7:140587583-140587605 AAGGGGAGGGAGAATGGGGCTGG - Intronic
1034080620 7:148274626-148274648 AAGGTGAAGGTGGAGCAGGCAGG - Intronic
1034553076 7:151833429-151833451 AAGGAGAGGGTGGAAGCGGCAGG + Intronic
1034958324 7:155349751-155349773 AGGGTCAAGGAGTACGCGGCTGG + Intergenic
1035171499 7:157019688-157019710 AAATTGAAGGGGGATGGGGCCGG - Intergenic
1035407223 7:158607057-158607079 AAGGTGATGGAGGATGGAGCAGG + Intergenic
1036548204 8:9792430-9792452 CAGCTGAAGGAGGCTGAGGCAGG + Intergenic
1036662342 8:10716347-10716369 CAGGAGCAGGAGGATGTGGCTGG - Intergenic
1037611545 8:20480396-20480418 AAAGGGAAGGAGGATGGGGGTGG + Intergenic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1040913602 8:52545547-52545569 AAGTTGAAGGGGGATGGGGGAGG - Intronic
1042041682 8:64598408-64598430 AGCGTGAAGGAGGAAGCAGCAGG - Intronic
1044264756 8:90168149-90168171 AAAGTGAAGAAGGCTGTGGCAGG + Intergenic
1047371122 8:124256937-124256959 AAGGGGAAGGAGGATGAGTCTGG - Intergenic
1047806148 8:128362158-128362180 GAGGTGGAGGAGGAAGCTGCTGG + Intergenic
1048201441 8:132377496-132377518 AAGGGGCAGGAGGATGAGGCTGG + Intronic
1048990732 8:139758696-139758718 AAGGTGAAGGCGGTTGGGGCAGG + Intronic
1049690539 8:143957043-143957065 AAGGTGGAGGTGGCTGCAGCCGG + Intronic
1050388169 9:5111770-5111792 AAGGAGAAGGTGGATGCAGCCGG - Intronic
1052370865 9:27663173-27663195 AAGGGAAAGGAGGATGGGGGAGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1054800661 9:69345160-69345182 CAGGTGAAGGAGGCTGGGTCGGG + Intronic
1054805662 9:69393897-69393919 AAGGTGGAGAGGGATGCAGCTGG - Intergenic
1055604819 9:77957658-77957680 AAGCTGAAGGAGGAGGCTACAGG + Intronic
1056126279 9:83538573-83538595 CAGCTGAAGGAGGAGGCGGAGGG + Intergenic
1056214905 9:84397738-84397760 AAAGTGAGGGAGGAAGCCGCAGG + Intergenic
1056983027 9:91334396-91334418 AAGGTGAAGGAGGAAGGAACTGG + Intronic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1060234438 9:121852603-121852625 AAGGTGACTGAGGATGAGGAAGG + Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1060734056 9:126055130-126055152 AAGGTGGACGAGGGTGGGGCAGG + Intergenic
1061020022 9:128008310-128008332 AGTGTGGAGGAGGAGGCGGCAGG + Intergenic
1061246249 9:129402493-129402515 CAGGCGAAGGAGGCAGCGGCAGG - Intergenic
1061397722 9:130352705-130352727 AAGGTGCAGGAGGTGGGGGCGGG - Intronic
1061427455 9:130508426-130508448 AAGGTGAAGGGGGATACAGAAGG + Intergenic
1061430214 9:130526189-130526211 AAGGTGAAGGAAGAAATGGCTGG + Intergenic
1062051075 9:134447420-134447442 CAGAGGGAGGAGGATGCGGCTGG + Intergenic
1062077597 9:134600236-134600258 AGGGTGAAAGGGGATGAGGCAGG + Intergenic
1062082846 9:134633603-134633625 ACGGTGGAGGAGGAATCGGCTGG - Intergenic
1062254244 9:135613643-135613665 CAGGGGCAGGAGGATGGGGCAGG + Intergenic
1062340673 9:136092667-136092689 AAGGTGAAGGTGGACTGGGCCGG + Intronic
1062623507 9:137433103-137433125 CGGGTGAAGGAGGAAGCTGCTGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062685305 9:137809590-137809612 GAGGGGAAGGAGGCTGCAGCCGG + Intronic
1062709286 9:137965055-137965077 AAGCTTATAGAGGATGCGGCAGG - Intronic
1062744627 9:138203490-138203512 GAGGTGAAGGAGGAGGAGTCGGG + Intergenic
1203661866 Un_KI270753v1:52156-52178 GAGGTGGAGGAGGAAGGGGCTGG + Intergenic
1185830102 X:3293293-3293315 GAGGAGGAGGAGGATGAGGCAGG + Intergenic
1186589815 X:10918044-10918066 AAGGTGATGAAGGATACGGCAGG + Intergenic
1189309559 X:40009925-40009947 AGGGTGGCGGAGGTTGCGGCTGG - Intergenic
1189314008 X:40040901-40040923 AAGGAGAAGGAGGAGGGGCCAGG - Intergenic
1190145881 X:47891373-47891395 AAGGTGAATGGGGATGTGGTGGG + Intronic
1190385515 X:49879573-49879595 GAGGGGAAGGCGGAGGCGGCGGG + Intergenic
1190619326 X:52269592-52269614 AGGGTGGAGTAGGATGGGGCGGG + Intergenic
1192433660 X:71129153-71129175 AAGGTGAAGGAGGATGCGGCAGG - Exonic
1192759350 X:74079332-74079354 AAGGTGAAGAAGGGAGTGGCAGG + Intergenic
1195675101 X:107502016-107502038 AAGGTTAAGGAGGGTGTGGGTGG + Intergenic
1199851135 X:151725537-151725559 ATGGTGAAGCAGGATGCTGTGGG + Intergenic
1199995477 X:153022084-153022106 AAGGTGTGGGAGGCTGAGGCAGG + Intergenic